I. Introduction
Polyamines are naturally
occurring aliphatic polycations found in almost all living organisms.
Polyamines include spermidine, spermine, and their diamine precursor,
putrescine (Tian et al, 2006a). Polyamines have critical physiological
functions in cell growth and differentiation. In mammalian cells, the
intracellular polyamine biosynthetic pathway is primarily regulated by the
action of two rate-limiting enzymes. Ornithine decarboxylase (ODC) is the first
key enzyme required for polyamine synthesis, decarboxylating ornithine to
produce putrescine (Tian et al, 2006b). The second, rate-limiting enzyme is
S-adenosylmethionine decarboxylase (AdoMetDC). It generates the aminopropyl
donor, decarboxylated Sadenosylmethionine (dcSAM), by decarboxylating
adenosylmethionine. DcSAM donates its propylamine moiety for the formation of
spermidine and spermine via catalysis by spermidine synthase and spermine
synthase, respectively.
The association of increased
polyamine synthesis with cell proliferation and cancer progression was first
reported in the late 1960s. High polyamine levels and elevated polyamine synthesis
activity were found in many tumors. Environmental and genetic risk factors for
cancer, such as ultraviolet light (Ahmad et al, 2001) and various oncogenes
(Holtta et al, 1988; Sistonen et al, 1989; Auvinen et al, 1992), have been
reported to induce high ODC activity in normal tissues. Overexpression of ODC
or AdoMetDC was also reported to cause malignant transformation of NIH3T3 cells
(Auvinen et al, 1992; Paasinen-Sohns et al, 2000). Therefore, inhibition of ODC
and/or AdoMetDC activity might induce a depletion of intracellular polyamines,
providing an effective anticancer treatment strategy. Previous work has
primarily focused on the development of polyamine synthesis inhibitors.
Difluoromethylornithine (DFMO) irreversibly inactivates ODC activity and has
been used in clinical chemoprevention trials for epithelial cancers, including
colon, breast, cutaneous, and prostate malignancies (Meyskens and Gerner,
1999). AdoMetDC inhibitors, such as methylglyoxalbis (guanylhydrazone) (MGBG),
have also been shown to inhibit tumor growth (Warrell and Burchenal, 1983).
SAM486A is a new AdoMetDC inhibitor that has been shown to possess
anti-proliferative activity in both tissue culture cells and preclinical animal
studies (Regenass et al, 1994).
Esophageal cancer is one of the most lethal cancers
known to mainland in China because of the high incidence and high mortality.
Metastatic esophageal cancer is essentially resistant to systemic cytotoxic
chemotherapy, while external beam and radioisotope radiotherapy offers only
symptom palliation. The development of novel therapies, such as gene therapy,
is of high priority.
In the present study, we
constructed a replicationdeficient recombinant adenovirus containing antisense
sequences of both ODC and AdoMetDC (Ad-ODCAdoMetDCas) to downregulate their
gene expression levels simultaneously. Our data show that downregulation of
these two key enzymes by Ad-ODC-AdoMetDCas significantly inhibited esophageal cancer
cell growth and tumor invasiveness in vitro.
The tumor cells were arrested in the G1 phase of the cell cycle.
Polyamine levels were significantly decreased in Ad-ODC-AdoMetDCas-treated
cells compared with controls.
II.
Materials and methods
A. Cell culture and reagents
Human esophageal cancer Eca109 cell line obtained from
the Chinese Academy of Sciences, were maintained in RPMI 1640 medium
supplemented with 10% (v/v) heat-inactivated bovine serum, 100 U/ml penicillin
and 100 g/ml streptomycin. HEK293 cells (transformed human embryonic kidney
cells), also purchased from the Chinese Academy of Sciences, were grown in
DulbeccoÕs modified EagleÕs medium (DMEM) (Invitrogen USA) containing 10% fetal
bovine serum. All cells were cultured in a 5% CO2 incubator at 37℃.The
polyamine standards (putrescine, spermidine, and spermine) and densyl chloride
for high-performance liquid chromatography (HPLC) were purchased from Sigma
(St. Louis, MO, USA). An anti-ODC mouse monoclonal antibody (mAb) and an
anti-AdoMetDC mouse polyclonal antibody were prepared in our laboratory. An
anti-p21 (sc-6246) mousemAb and an antiactin (sc-1616) goat polyclonal antibody
were purchased from Santa Cruz Biotechnology. Matrigel and Transwell plates
were obtained from BD Biosciences (Bedford, MA, USA) and Costar (Cambridge, MA,
USA), respectively.
B. Construction of Ad-ODC-AdoMetDCas
The construction of the adenoviral vector,
rAd-ODC/EX3as, containing antisense ODC sequence with both a cytomegalovirus
(CMV) promoter and a green fluorescent protein (GFP) gene, was reported
previously (Zhang et al, 2005). To construct an adenoviral vector harboring
additional antisense AdoMetDC sequence, a 205-bp cDNA fragment of the 5' end of
the AdoMetDC gene was ampli-fied by reverse-transcription polymerase chain
reaction (RT-PCR) using specific primers and was subcloned downstream of the
ODC gene in the pAd-ODCas vector in the reverse direction. The forward primer
was 5'GGTCTAGATTCGCTAGTCTCACGGTGAT3' and the reverse primer was 5'GGCTCGAGTAAGCTTCCTGCTTGTCAGT3'.
The sequence of the resulting clone, pAd-ODC-AdoMetDCas, was confirmed by
sequencing and was then linearized by digestion with Pme I and transformed into Adeasier-1 cells containing the
33-kb pAdeasy-1 vector to generate recombinant clones as previously described (He
et al, 1998). The recombinant adenovirus genome was digested with Pac I and transfected into HEK293 cells with
Lipofectamine2000 (Invitrogen USA) for the isolation of recombinant
adenovirus.Recombinant viral plaques were identified and amplified by PCR in
order to verify ligation success. The recombinant virus particles were purified
by CsCl ultracentrifugation (Prevec et al, 1991) and a standard plaque assay
was performed to measure the titer of the purified viral stock. The control
virus, Ad-GFP, contained no gene insertion in the multiple cloning site.
C. Analysis of gene transduction efficiency in
vitro
The efficiency of adenovirus-mediated gene transfer was
assessed by detection of GFP. Eca109 cells (3x105 cells/well) seeded
in 6-well plates were infected with Ad-GFP at different multiplicities of infection
(MOIs) of 5, 10, 20, 50 and 100. GFP expression was analyzed at 48 h after the
infection using a flow cytometer (Beckman Coulter, Miami, FL, USA).
D. Western blot analysis
After the Eca109 cells had been treated with
phosphate-buffered saline (PBS), Ad-GFP, Ad-ODCas, and Ad-ODC-AdoMetDCas for 72
h, total cell lysates were prepared in extraction buffer containing 50 mM Tris
(pH8.0), 1% NP-40, 1 mg/ml aprotinin, 0.1% sodium dodecyl sulfate (SDS), 0.02% sodium azide,
150mM NaCl, and 100 mg/ml phenylmethylsulfonyl fluoride. Sample protein concentrations were
quantified using the bicinchoninic acid (BCA) protein assay. After
electrophoresis samples were transferred onto nitrocellulose membranes
(Millipore, Bedford, MA, USA). After an incubation with appropriate antibodies
in PBS containing 5% nonfat dry milk and 0.02% Tween 20, the membranes were
incubated with horseradish peroxidase-conjugated secondary antibodies,
developed using the Western blotting luminol reagent (Santa Cruz Biotechnology,
USA), and exposed to X-ray film (Kodak, Shantou, China).
E. Measurement of polyamine content
Polyamine content was measured as previously described
(Aboul-Enein and al-Duraibi, 1998). After an incubation with PBS, Ad-GFP,
Ad-ODCas,and Ad-ODC-AdoMetDCas for 3 days, Eca109 cells were harvested by
scraping and permeabilized with 5% trichloroacetic acid. The polyamines in the
supernatant were separated and quantified on an ionpaired, reversed-phase HPLC
system. Protein content was subsequently measured in the precipitate.
F. Measurement of cell growth
Viable cell counts were used to evaluate the effects of
recombinant adenovirus on cell proliferation. Eca109 cells were plated in
6-well tissue culture plates at a density of 5x104 cells/well. After
24 h, tumor cells were treated with Ad-GFP, Ad-ODCas, and Ad-ODCAdoMetDCas at
an MOI of 50 or with PBS as a control. Cells in each treatment group were
plated in triplicate and cultured for 6 days. Cells were then treated with
trypsin and harvested every 24 h and subsequently stained with 0.4% trypan blue
(Gibco, USA) for the identification of dead cells. Viable cells were then
counted using a hemocytometer.
G. Cell cycle analysis
Eca109 cells were seeded at a density of 3x105
cells/well in 6-well plates and treated with Ad-GFP, Ad-ODCas, or Ad-
ODC-AdoMetDCas at an MOI of 50 or treated with PBS as a control. Three days
following treatment, cells were harvested as described above, washed once with
cold PBS, and fixed with 70% ethanol. Cells were then washed with ice-cold PBS
and treated with RNase. DNA was subsequently stained with propidium iodide.
Cell cycle phases were analyzed using FACScan (Becton Dickinson).
H. Matrigel invasion assay
Eca109 cells were infected with Ad-GFP, Ad-ODCas, or
Ad- ODC-AdoMetDCas at an MOI of 50 for 2 days. Invasiveness was measured by
counting cells that had traveled through Matrigel-coated Transwell inserts.
Transwell inserts (6.5 mm) with a 8.0-mm pore size were coated with 30 ml of Matrigel and dried for 2 h at room temperature.
Cells were harvested as described above. A 100-ml cell suspension containing 5x104 cells was
added to wells in triplicate. After 24 h of incubation, nonmigrated cells were
scraped from the upper side of the membrane with cotton swaps. Cells that
passed through the filter into the bottom side of the membrane were fixed and
stained with hematoxylin. Five representative fields in each well were
quantified to determine the number of invasive cells under a light microscope
at 200 x magnification.
I. Statistical analysis
Data are reported as the mean ± standard deviation
(SD).Statistical differences between control and treated cells were evaluated
using Student,s t-test.
A value of P < 0.05 was considered significant.
III. Results
A.
Ad-ODC-AdoMetDCas inhibits ODC and AdoMetDC gene expression in cancer cells in
vitro
Adenovirus infects host cells through the coxsackie
and adenovirus receptor (CAR) (Bao et al, 2005). As the CAR status in cancer
cells is largely unknown, we first evaluated adenoviral gene transfer
efficiency in tumor cells using Ad-GFP. Eca109 tumor cells were infected with
AdGFP at MOIs of 5, 10, 20, 50 and 100 for 48 h. We demonstrated that 73.6 ± 2.3%
of A-549 cells were positive for GFP at an MOI of 50; this MOI was used for
further study. To study the inhibitory effects of adenoviral vector-gene
transfer on both ODC and Ad-ODCas gene expression, Eca109 cells were infected
with Ad-GFP, Ad-ODCas, and Ad-ODC-AdoMetDCas at an MOI of 50 for 72 h. Protein
extracted from both adenoviral vector-treated and control conditions were
probed with antibodies against ODC and AdoMetDC. Figure 1 shows that Ad-ODC-AdoMetDCas induced a greater than 50%
reduction of both ODC and AdoMetDC protein in Eca109 cells compared with
Ad-GFP-infected or uninfected cells. Similarly, Ad-ODC-AdoMetDCas induced a
greater than 50% reduction of both ODC and AdoMetDC protein in Eca109 cells
compared with control conditions. Not surprisingly, ODC protein levels dropped
more than 50% in Eca109 cells after Ad-ODCas treatment compared with
Ad-GFP-infected or uninfected cells. However, there was no appreciable change
in AdoMetDC protein levels in Ad-ODCas-treated cells compared with control
cells.
B.
Ad-ODC-AdoMetDCas gene transfer decreases polyamine content in cancer cells
After demonstrating that Ad-ODC-AdoMetDCas depressed
ODC and AdoMetDC protein expression levels in Eca109 cells, we next evaluated
whether the polyamine content could be decreased accordingly by adenoviral gene
transfer into these tumor cells. Polyamines in adenovirus-infected or uninfected
cancer cells were separated by ion-paired, reversed-phase HPLC. As shown in Table
1, both Ad-ODCas and Ad-ODCAdoMetDCas
decreased the polyamine content of Eca109 cells, correlating with the
downregulation of polyamine biosynthesis. Table 1 also shows that incubation with Ad-ODCas alone caused
a drop in putrescine content in Eca109 cells. Spermidine concentrations
decreased, while spermine levels remained low too. In cells treated with
Ad-ODC-AdoMetDCas, all three polyamines were reduced to very low levels. After
a comparison of Ad-ODC-AdoMetDCas- and Ad-ODCas-infected cells, both spermidine
and spermine were significantly reduced (P<0.05).
C.
Ad-ODC-AdoMetDCas inhibits cancer cell proliferation
After confirming the suppression of ODC and AdoMetDC
gene expression and polyamine reduction by adenoviral gene transfer, we then
asked whether these inhibitory effects could be translated into inhibition of
cell growth. We used viable cell counts to determine rates of tumor cell
proliferation. The results in Figure 2 demonstrate significant inhibition of cell proliferation in cancer
cell lines treated with either Ad-ODCas or Ad-ODC-AdoMetDCas (P < 0.05)
compared with control cells treated with either Ad-GFP or PBS. This inhibition
of cell growth was maintained for 7 days (data not shown). Significant
differences in the inhibitory effects existed between Ad-ODCas- and
Ad-ODC-AdoMetDCas-mediated transduction (P <0.05).
When compared with Ad-ODCas, Ad-ODC-AdoMetDCas was shown to be more effective
in inhibiting proliferation of Eca109 cell.
IV. Discussion
It has been known for many years that normal cell
growth is regulated in a cyclical manner by the increase and decrease of
cyclins and cyclin-dependent kinases (cdks). Furthermore, there are also
changes in polyamine, ODC and AdoMetDC concentrations during the cell cycle. Both
ODC and AdoMetDC mRNA levels and polyamine concentration are doubled during the
cell cycle. Elevated levels of ODC and AdoMetDC activity were found in various
cancers (Cohen, 1998), such as prostate, breast, and colorectal cancer, and are
related to cancer recurrence (Pegg and McCann, 1982; Gutman et al, 1995). Our
recent work has proven that inhibition of ODC activity by recombinant antisense
ODC adenovirus has had antitumor effects on human lung cancer (Tian et al,
2006a,b).This adenovirus, however, did not inhibit AdoMetDC, a critical enzyme
that is normally elevated in tumor cells. We speculate that double inhibition
of ODC and AdoMetDC might be a more effective way to suppress tumor growth. Our
in vitro study demonstrated more
robust antitumor effects by dual inhibition of both ODC and AdoMetDC activities
compared to inhibition of ODC activity alone. Double inhibition by
Ad-ODCAdoMetDCas infection significantly reduced ODC and AdoMetDC protein
levels more than 50% Eca109 cells compared to controls. A substantial decrease
in ODC and AdoMetDC expression levels also causes a reduction of polyamine
biosynthesis. Ad-ODC-AdoMetDCas infection depresses three types of polyamines.
In contrast, only putrescine and spermidine were shown to be decreased after
Ad-ODCas infection. Ad-ODCas treatment of tumor cells did not elicit a
statistical difference in spermine content compared with control treatment. We
speculate that the inability of Ad-ODCas to block AdoMetDC activity might be
responsible for this observation, consistent with results reported by other
researchers who demonstrated that the ODC inhibitor, DFMO, had no effect on
spermine levels in tumor cells. Spermine, however, plays an equally important
role in carcinogenesis as do the other polyamines. Furthermore, high levels of
spermine also contribute to cellular resistance to apoptotic cell death (Hashimoto
et al, 1999). The inability of Ad-ODCas to decrease intracellular spermine
levels therefore represents an inherent drawback in its potential antitumor
effects.
P53, also known as tumor protein 53 (TP53), is a transcription factor that regulates the cell cycle
and hence functions as a tumor suppressor. It is important in multicellular organisms as it helps to
suppress cancer.
p53 has been described as "the guardian of the genome",
"the guardian angel gene", or the "master watchman",
referring to its role in conserving stability by preventing genome mutation. It
has also been found to play an important role in sun tanning. The alteration of gene
p53 is a key event in esophagus cancer and if there is a relationship between
ODC and AdoMetDC on this issue,we will study it in the future.
To further understand the underlying mechanism of
tumor cell growth inhibition, cell cycle and cell-cyclerelated proteins were
examined. Previous studies have shown that DFMO arrests a broad spectrum of
tumor cell types, such as IEC-6, Hep-2, MKN45, and HL-60, in G1 phase
(Wallace et al, 2003). Our recent work also demonstrated that treatment of Eca109
cells with Ad-ODCas causes lung cell cycle arrest in G1 phase (Tian
et al, 2006a). In agreement with these findings, we demonstrated that both
Ad-ODC-AdoMetDCas and Ad-ODCas decreased the rate of DNA synthesis of cancer
cells and blocked cell cycle at the G1/S boundary. This result also
suggests that synergistic inhibition of ODC and AdoMetDC activities may be more
effective in inducing cell cycle arrest and halting cell growth than a single
blockade of ODC activity. These data are in agreement with a report that
treatment of MALME-3M cells with either the ODC inhibitor, DFMO, or the
AdoMetDC inhibitor, MDL-73811, slows cell growth but fails to induce cell cycle
arrest, and treatment with a combination of both inhibitors halts cell growth
and causes a significant G1 arrest (Kramer et al, 2001).
We also assessed the effects of the two antisense
constructs in the context of tumor invasiveness. Both Ad-ODCAdoMetDCas and
Ad-ODCas reduced the invasiveness of Eca109 cells compared with vector
controls. Furthermore, the data also showed that Ad-ODC-AdoMetDCas was superior
in inhibiting cancer cell invasion compared with Ad-ODCas infection.
Overexpression of ODC has been suggested to confer an invasive phenotype on
cells. Kubota and colleagues reported in 1997 that overexpression of ODC in
mouse 10T1/2 fibroblasts induced not only cell transformation and
anchorage-independent growth in soft agar, but also invasiveness through a
Matrigel-coated filter. Similar work had been done by this same group (Kubota
et al, 1995) that compared the invasiveness of mouse mammary carcinoma FM3A and
EXOD cell lines that overexpress ODC and found that EXOD cells showed more than
a 5.6-fold increase in invasiveness compared with FM3A cells by Matrigel assay.
Inhibition of ODC by DFMO reduced invasiveness in breast cancer cells
significantly (Manni et al, 2002). Our previous work in which ODC levels were
reduced using the adenovirus-delivered antisense ODC found that lower ODC
levels also inhibited tumor invasion in lung cancer (Tian et al, 2006a). ODC,
however, is not the sole enzyme responsible for olyamine biosynthesis or tumor
invasion. AdoMetDC was also proven to strongly correlate with progression of
tumor invasiveness. Overexpression of AdoMetDC alone has been reported to be
sufficient to transform NIH 3T3 cells and induce highly invasive tumors in nude
mice (Manni et al, 1995). High expression levels of AdoMetDC may compensate for
and strengthen the activity of ODC through different molecular pathways (Ravanko
et al, 2004). Therefore, we simultaneously targeted both these critical enzymes
and obtained superior inhibition of cancer invasion.
In summary, we provide evidence that polyamine
reduction by antisense techniques that targeted ODC and AdoMetDCas suppresses
cancer cell growth and invasiveness in vitro. Synergistic inhibition of both ODC and AdoMetDC activities
by gene therapy approaches therefore might represent a novel treatment option
for esophageal cancer.
References
Aikawa M, Rabkin E, Okada Y, Voglic SJ, Clinton SK,
Brinckerhoff CE, Sukhova GK, Libby P (1998) Lipid lowering by diet reduces matrix
metalloproteinase activity and increases collagen content of rabbit atheroma: a
potential mechanism of lesion stabilization. Circulation 97, 2433–2444
Blackford J, Reid HW, Pappin
DJ, Bowers FS, Wilkinson JM (1996)
A monoclonal antibody, 3/22 to rabbit CD11c which induces homotypic T cell
aggregation: evidence that ICAM-1 is a ligand for CD11c/CD18. Eur J Immunol 26, 525-531
Chavakis T, Kanse SM, Yutzy B, Lijnen HR, Preissner KT (1998) Vitronectin concentrates
proteolytic activity on the cell surface and extracellular matrix by trapping
soluble urokinase receptor‑urokinase complexes. Blood 91, 2305-2312
Chavakis T, May AE, Preissner KT, Kanse SM (1999) Molecular mechanisms of
zinc‑dependent leukocyte adhesion involving the urokinase receptor and §2‑integrins.
Blood
93, 2976-2983
Chavakis T, Kanse SM, Lupu F, Hammes HP, Muller-Esterl W,
Pixley RA, Colman RW, Preissner KT (2000) Different
mechanisms define the antiadhesive function of high molecular weight kininogen
in integrin- and urokinase receptor-dependent interactions. Blood 96, 514-522
Chavakis T, Kanse SM, Pixley RA, May AE,
Isordia-Salas I, Colman RW, Preissner KT (2001) Regulation of leukocyte
recruitment by polypeptides derived from high molecular weight kininogen. FASEB
J 15 2365-2376
Chavakis T, Hussain M, Kanse SM, Peters G, Bretzel RG, Flock JI,
Herrmann M, Preissner KT (2002) Staphylococcus aureus extracellular adherence
protein (Eap) serves as anti-inflammatory factor by inhibiting the recruitment
of host leukocytes. Nature Medicine 8, 687-693
Corsini A, Maggi FM, Catapano
AL (1995) Pharmacology of
competitive inhibitors of HMG-CoA reductase. Pharmacol Res 31, 9–27
Diomede
L, Albani D, Sottocorno M, Polentarutti N, Donati MB, Bianchi M, Fruscella P,
Salmona M (2001) The in vivo anti-inflammatory effect of statins is mediated by nonsterol
mevalonate products. Arterioscler Thromb Vasc Biol 21, 1327–1332
Essig M, Nguyen G, Prie D, Escoubet B, Sraer JD, Friedlander G (1998)
3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase
fibrinolytic activity in rat aortic endothelial cells: role of
geranylgeranylation and Rho proteins. Circ Res 83, 683–690
Frenette PS (2001) Locking a leukocyte integrin with statins. N Engl J
Med 345, 1419-1421
Gahmberg CG (1997) Leukocyte adhesion: CD11/CD18 integrins and
intercellular adhesion molecules. Curr Opin Cell Biol 9, 643-650
Ganne F, Vasse M,
Beaudeux JL, Peynet J, Francois A, Mishal Z, Chartier A, Tobelem G, Vannier JP,
Soria J, Soria C (2000) Cerivastatin, an inhibitor of HMG-CoA
reductase, inhibits urokinase/urokinase-receptor expression and MMP-9 secretion
by peripheral blood monocytes-a possible protective mechanism against
atherothrombosis. Thromb Haemost 84, 680-688
Guijarro
C, Blanco-Colio LM, Ortego M, Alonso C, Ortiz A, Plaza JJ, Diaz C, Hernandez G,
Edigo J (1998) 3-Hydroxy-3-methylglutaryl coenzyme A reductase and isoprenylation
inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ
Res 83,
490 –500
Horejsi V, Drbal K, Cebecauer
M, Cerny J, Brdicka T, Angelisova P, Stockinger H (1999) GPI-microdomains: a role in signalling via
immunoreceptors. Immunol Today 20,
356-361
Issekutz AC (1998) Adhesion molecules mediating neutrophil migration to
arthritis in vivo and across endothelium and connective tissue barriers in
vitro. Inflamm Res 47,
S123–S132
Kallen J, Welzenbach K, Ramage
P, Geyl D, Kriwacki R, Legge G, Cottens S, Weitz-Schmidt G, Hommel U (1999) Structural basis for LFA-1 inhibition upon lovastatin
binding to the CD11a I-domain. J Mol Biol 292, 1-9
Katznelson S, Kobashigawa JA (1995) Dual roles of HMG-CoA reductase inhibitors in solid
organ transplantation: Lipid lowering and immunosuppression. Kidney Int 48, S112–S115
Krauss K, Altevogt P (1999) Integrin leukocyte function-associated
antigen-1-mediated cell binding can be activated by clustering of membrane
rafts. J Biol Chem 274, 36921-36927
Krueger J, Gottlieb A, Miller
B, Dedrick R, Garovoy M, Walicke P (2000) Anti-CD11a treatment for psoriasis concurrently increases circulating
T-cells and decreases plaque T-cells, consistent with inhibition of cutaneous
T-cell trafficking. J Invest Dermatol 115, 333
Kurzchalia TV, Parton RG (1999) Membrane microdomains and caveolae. Curr Opin Cell
Biol 11, 424-431
Kwak BR, Mach F (2001) Statins inhibit leukocyte recruitment. New evidence
for their anti-inflammatory properties. Arterioscler Thromb Vasc Biol 21, 1256-1258
Kwak B, Mulhaupt F, Myit S, Mach F (2000) Statins as a newly recognized
type of immunomodulator. Nat Med 6, 1399-1403
Laufs U, La Fata V, Plutzky J, Liao JK (1998) Upregulation of
endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation 97, 1129–1135
Laufs U, Liao JK (1998) Post-transcriptional regulation of endothelial
nitric oxide synthase mRNA stability by Rho GTPase. J Biol Chem 273,
24266–24271
Laufs U, Marra D, Node K, Liao JK (1999) 3-Hydroxy-3-methylglutaryl-CoA
reductase inhibitors attenuate vascular smooth muscle proliferation by
preventing rho GTPase-induced down-regulation of p27(Kip1). J Biol Chem 274, 21926
–21931
Liu L, Moesner P, Kovach NL,
Bailey R, Hamilton AD, Sebti SM, Harlan JM (1999) Integrin-dependent leukocyte adhesion involves
geranylgeranylated protein(s). J Biol Chem 274, 33334–33340
Maron DJ, Fazio S, Linton MF (2000) Current perspectives on statins. Circulation 101, 207–213
Martin X, Da Silva M, Virieux
SR, Hadj Aissa A, Buffet R, Tiollier J, Dubernard JM (2000) Protective effect of an anti-LFA 1 monoclonal antibody
(odulimomab) on renal damage due to ischemia and kidney autotransplantation.Transplant
Proc 32, 481
May AE, Kanse SM, Lund LR,
Gisler RH, Imhof BA, Preissner KT (1998) Urokinase receptor (CD87) regulates leukocyte recruitment via
§2-integrins in vivo. J Exp Med 188,
1029-1037
Nakakura EK, Shorthouse RA,
Zheng B, McCabe SM, Jardieu PM, Morris RE (1996) Long-term survival of solid organ allografts by brief
anti-lymphocyte function-associated antigen-1 monoclonal antibody monotherapy. Transplantation 62, 547–552
Ossowski L, Aguirre-Ghiso JA (2000) Urokinase-receptor and integrin partnership: coordination of signaling
for cell adhesion, migration and growth. Curr Opin Cell Biol 12, 613-620
Porter JC, Hogg N (1998) Integrins take partners: cross-talk between integrins
and other membrane receptors. Trends Cell Biol 8, 390-396
Poston RS, Robbins RC, Chan B, Simms P, Presta L, Jardieu P, Morris RE (2000) Effects of humanized monoclonal antibody to rhesus
CD11a in rhesus monkey cardiac allograft recipients. Transplantation 69, 2005–2013
Preissner KT, Kanse SM, May AE(2000) Urokinase receptor: a molecular organizer in cellular
communication. Curr Opin Cell Biol
12, 621-628
Romano
M, Diomede L, Sironi M, Massimiliano L, Sottocorno M, Polentarutti N,
Guglielmotti A, Albani D, Bruno A, Fruscella P, Salmona M, Vecchi A, Pinza M,
Mantovani A (2000) Inhibition of monocyte chemotactic protein-1 synthesis
by statins. Lab Invest 80, 1095–1100
Simons K, Toomre D (2000) Lipid rafts and signal transduction. Nat Rev Mol
Cell Bio 1, 31-39
Sitrin RG, Todd RF, Petty HR,
Brock TG, Shollenberger SB, Albrecht E, Gyetko MR (1996) The urokinase receptor (CD87) facilitates
CD11b/CD18-mediated adhesion of human monocytes. J Clin Invest 97,
1942-1951
Smart EJ, Graf GA, McNiven MA,
Sessa WC, Engelman JA, Scherer PE, Okamoto T, Lisanti MP (1999) Caveolins, liquid-ordered domains, and signal
transduction. Mol Cell Biol 19,
7289-7304
Soma
MR, Donetti E, Parolini C, Mazzini G, Ferrari C, Fumagalli R, Paoletti R (1993) HMG CoA reductase
inhibitors: in vivo effects on carotid intimal thickening in
normocholesterolemic rabbits. Arterioscler Thromb 13, 571–578
Springer TA (1994) Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep
paradigm. Cell 76, 301-314
Stewart
M, Thiel M, Hogg N (1995) Leukocyte integrins. Curr
Opin Cell Biol 7, 690-696
Weber C, Erl W, Weber KS, Weber PC (1997) HMG-CoA reductase inhibitors
decrease CD11b expression and CD11b-dependent adhesion of monocytes to
endothelium and reduce increased adhesiveness of monocytes isolated from
patients with hypercholesterolemia. J Am Coll Cardiol 30, 1212–1217
Weber C, Erl W, Weber PC (1995) Lovastatin induces differentiation of Mono Mac 6
cells. Cell Biochem Funct 13, 273-277
Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA (1994) Identification of the urokinase receptor as an adhesion
receptor for vitronectin. J Biol Chem
269, 32380-32388
Weitz-Schmidt G, Welzenbach K, Brinkmann V, Kamata T, Kallen
J, Bruns C, Cottens S, Takada Y, Hommel U (2001) Statins selectively inhibit
leukocyte function antigen-1 by binding to a novel regulatory integrin site. Nat
Med 7,
687-692
Wojciak-Stothard B, Williams
L, Ridley AJ (1999) Monocyte
adhesion and spreading on human endothelial cells is dependent on Rho-regulated
receptor clustering. J Cell Biol 145,
1293–1307
Woods A, Couchman JR (2000) Integrin modulation by lateral
association. J Biol Chem 275, 24233-24236
Yoshida M, Sawada T, Ishii H,
Gerszten RE, Rosenzweig A, Gimbrone MA Jr, Yasukochi Y, Numano F (2001)
HMG-CoA reductase inhibitor modulates monocyte endothelial interaction under
physiological flow condition in vitro: involvement of Rho GTPase-dependent
mechanism. Arterioscler Thromb Vasc Biol 21,
1165–1171
