Gene Ther Mol Biol Vol 1, 1-172. March, 1998.
Status of gene therapy in 1997: molecular mechanisms, disease targets, and clinical applications
Teni Boulikas
Institute of Molecular Medical Sciences, 460 Page Mill Road, Palo Alto, California 94306
and Regulon Inc., 249 Matadero Avenue, Palo Alto, CA 94306
__________________________________________________________________________________________________
Correspondence: Teni Boulikas, Regulon Inc., 249 Matadero Avenue, Palo Alto, CA 94306, Tel (650) 813-9264, Fax: (650) 424-9594, E-mail: Boulikas@Worldnet.att.net
Key words: gene therapy, gene transfer, clinical trials, cancer, immunotherapy, p53, adenovirus, retrovirus, adeno-associated virus, HIV-1, HSV-1, EBV, AIDS, tumor vaccines, IFN-g, TNF-a, VEGF, retinoblastoma, purine nucleoside phosphorylase, HSV-tk, E1A, E1B, Cre, LoxP, recombination, HIV vectors, liposomes, fusogenic peptides, plasmovirus, transcription factor, TIL, IL-2, IL-3, IL-7, IL-12, GM-CSF, prostate cancer, p21, p16, apoptosis, Bcl-2, Bax, Bcl-xs, E2F, bystander effect, MDR1, IGF-I, antisense, triplex DNA, Parkinson’s disease, lysosomal storage disease, hemophilia, cystic fibrosis, CFTR, rheumatoid arthritis, hypertension, familial hypercholesterolemia, LDL, angiopoietin, restenosis, angiogenesis, TGF-b, arterial injury, atherosclerosis, ADA deficiency, obesity, leptin.
Summary
Gene therapy is a newly emerging field of biomedical research aimed at introducing therapeutically important genes into somatic cells of patients; a new and revolutionary era in molecular medicine has begun. Diseases already shown to be amenable to therapy with gene transfer in clinical trials include cancer (melanoma, breast, lymphoma, head & neck, ovarian, colon, prostate, brain, chronic myelogenous leukemia, non-small cell lung, lung adenocarcinoma, colorectal, neuroblastoma, glioma, glioblastoma, astrocytoma, and others), AIDS, cystic fibrosis, adenosine deaminase deficiency, cardiovascular diseases (restenosis, familial hypercholesterolemia, peripheral artery disease), Gaucher disease, a1-antitrypsin deficiency, rheumatoid arthritis and a few others. Human diseases expected to be the object of clinical trials include hemophilia A and B, Parkinson’s disease, ocular diseases, xeroderma pigmentosum, high blood pressure, obesity and many others. The establishment of novel animal models for human disease, the discovery of new genes, and improvements in successful gene delivery open bright new prospects for molecular medicine. A wide variety of delivery vehicles for genes have been tested including murine retroviruses, recombinant adenoviral vectors, adeno-associated virus, HSV, EBV, HIV vectors, and baculovirus. Nonviral gene delivery methods use cationic or neutral liposomes, direct injection of plasmid DNA, and polymers. Various strategies to enhance efficiency of gene transfer have been tested such as fusogenic peptides in combination with liposomes, or polymers, to enhance the release of plasmid DNA from endosomes. Recombinant retroviruses stably integrate into the DNA and require host DNA synthesis; adenoviruses can infect nondividing cells but cause immune reactions leading to the elimination of therapeutically transduced cells. Adeno-associated virus (AAV) is not pathogenic, does not elicit immune responses but new strategies are required to obtain high AAV titers for preclinical and clinical studies. Wild-type AAVs integrate into chromosome 19 whereas recombinant AAVs are deprived of site-specific integration and may also persist episomally; HSV vectors can infect nonreplicating cells such as neuron cells, have a high payload capacity for foreign DNA but inflict cytotoxic effects. It seems that each delivery system will be developed independently of the others and that each will prove its strengths for specific applications. At present, retroviruses are most commonly used in human clinical trials followed by adenoviruses, cationic liposomes and AAV. Polymer-encapsulated syngeneic or allogeneic cells implanted into a tissue of a patient can be used to secrete therapeutic proteins; the method is in trials for amyotrophic lateral sclerosis using the ciliary neurotrophic factor gene, and can be extended to Factor VIII and IX for hemophilia, interleukin genes, dopamine-secreting cells to treat Parkinson's disease, nerve growth factor for Alzheimer's disease and other diseases. Ingenious techniques under development with great future prospects for human gene therapy, include the Cre-LoxP recombinase system to rid of undesirable viral DNA sequences used for gene transfer, use of tissue-specific promoters to express a gene in a particular cell type or use of ligands, such as peptides selected from random peptide libraries, recognizing surface molecules to direct the gene vehicle to a particular cell type, designing p53 “gene bombs” that explode into tumor cells, exploit the HIV-1 virus to engineer vectors for gene transfer, the combining of viruses with polymers or cationic lipids to improve gene transfer, the attachment of nuclear localization signal peptides to oligonucleotides to direct them to nuclei, and the invention of molecular switch systems allowing genes to be turned on or off at will.
Although many human tumors are non- or weakly immunogenic, the immune system can be reinforced and instructed to eliminate cancer cells after transduction of patient’s cells ex vivo with the cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a, followed by cell vaccination of the patient (e.g. intradermally) to potentiate T-lymphocyte-mediated antitumor effects (cancer immunotherapy). DNA vaccination with genes encoding tumor antigens and immunotherapy with synthetic tumor peptide vaccines are further developments in this exciting field. The genes used for cancer gene therapy in human clinical trials include a number of tumor suppressor genes (p53, RB, BRCA1, E1A), antisense oncogenes (antisense c-fos, c-myc, K-ras), and suicide genes (HSV-tk, in combination with ganciclovir, cytosine deaminase in combination with 5-fluorocytosine). Important in gene therapy are also the genes of bcl-2, MDR-1, p21, p16, bax, bcl-xs, E2F, IGF-I VEGF, angiostatin, CFTR, LDL-R, TGF-b, and leptin. Reports on human clinical trials using adenoviral and retroviral injections of the p53 gene have been very encouraging; future directions might go toward the use of genes involved in the control of tumor progression and metastasis. The molecular mechanisms of carcinogenesis have been largely elucidated and improvements in gene delivery methods are likely to lead to the final victory of the human race in the fight against cancer and other deadly diseases.
Abbreviations:
a1-AT, a1-antitrypsin
5FC, 5-fluorocytosine
5FU, 5-fluorouracil
aa, amino acid
AAV, adeno-associated virus
Ad, adenovirus
ADA, adenosine deaminase
aFGF, acidic fibroblast growth factor
AIDS, acquired immunodeficiency syndrome
APCs, antigen-presenting cells
bFGF, basic fibroblast growth factor
bp, base pairs
CAT, chloramphenicol acetyltransferase
CD, cytosine deaminase
CDKs, cyclin-dependent kinases
CEA, carcinoembryonic antigen
CF, cystic fibrosis
CFTR, cystic fibrosis transmembrane regulator
cfu, colony forming units
CMV IE, cytomegalovirus immediate-early
CMV, cytomegalovirus
CNS, central nervous system
CNTF, ciliary neurotrophic factor
CTLs, cytotoxic T lymphocytes
DBD, DNA-binding domain
DSBs, double-strand DNA breaks
EBV, Epstein-Barr virus
EGF, epidermal growth factor
EGFR, epidermal growth factor receptor
FH, familial hypercholesterolemia
GCV, ganciclovir
GFP, green fluorescent protein
GM-CSF, granulocyte-macrophage colony stimulating factor
HIV-1, human immunodeficiency virus type 1
HPV, human papillomavirus
HSC, hematopoietic stem cells
HSV, herpes simplex virus
i.m., intramuscular
i.p., intraperitoneal
i.v., intravenous
ICE, interleukin-1b converting enzyme
IFN-g, interferon-g
IGF-I, insulin-like growth factor I
IGF-IR, insulin-like growth factor I receptor
IL, interleukin
IL-1b, interleukin-1b
ITR, inverted terminal repeat
LAK, lymphokine-activated killer cells
LDL-R, low density lipoprotein receptor
LTR, long terminal repeat
mAb, monoclonal antibody
MAR, matrix-attached region
MeP-dR, 6-methylpurine-2’-deoxyriboside
MHC, major histocompatibility complex
MLV, murine leukemia virus
MMTV, mouse mammary tumor virus
Mo-MLV, Moloney murine leukemia virus
MOI, multiplicity of infection
MT, metallothionein
NeoR, neomycin phosphotransferase
NK, natural killer cells
nt, nucleotides
ODNs, oligodeoxynucleotides
ORFs, open reading frames
ORIs, origins of replication
PAI-1, plasminogen activator inhibitor-1
PARP, poly(ADP-ribose) polymerase
PBL, peripheral blood lymphocytes
PCNA, proliferating cell nuclear antigen
PDGF, platelet-derived growth factor
PGF, placenta growth factor
PKC, protein kinase C
PMGT, particle-mediated gene transfer
PNP, purine nucleoside phosphorylase
PSA, prostate specific antigen
PVR, proliferative vitreoretinopathy
RA, rheumatoid arthritis
RA-SF, rheumatoid arthritis synovial fibroblasts
rAAV, recombinant adeno-associated virus
RAC, recombinant advisory committee
RB, retinoblastoma
RLU, relative luciferase units
RSV, Rous sarcoma virus
s.c., subcutaneous
SCID, severe combined immunodeficient
SMC, smooth muscle cell
TAD, transactivation domain
TGF-b, transforming growth factor-b
TIL, tumor-infiltrating lymphocyte
TK, thymidine kinase
TNF-a, tumor necrosis factor a
tPA, tissue plasminogen activator
uPA, urokinase plasminogen activator
VEGF, vascular endothelial growth factor
VSMC, vascular smooth muscle cell
VSMC, vascular smooth muscle cells
VSV, vesicular stomatitis virus
wt, wild-type
I. Introduction
Monumental progress in several fields including DNA replication, transcription factors and gene expression, repair, recombination, signal transduction, oncogenes and tumor suppressor genes, genome mapping and sequencing, and on the molecular basis of human disease are providing the foundation of a new era of biomedical research aimed at introducing therapeutically important genes into somatic cells of patients. The main targets of gene therapy are to repair or replace mutated genes, regulate gene expression and signal transduction, manipulate the immune system, or target malignant and other cells for destruction (reviewed by Anderson, 1992; Nowak, 1995; Boulikas, 1996a,b; Culver, 1996; Ross et al, 1996).
Two main approaches have been pursued for gene transfer to somatic cells (i) direct gene delivery using murine retroviruses, adenoviruses, adeno-associated virus, HSV, EBV, liposomes, polymers, or direct plasmid injection (gene therapy in vivo); and (ii) ex vivo gene therapy involving removal of syngeneic cells from a specific organ or tumor of an individual, genetic correction of the defect in cell culture (ADA deficiency, LDL-R for FH) or transfer of a different gene (IL-2 to tumor infiltrating lymphocytes to potentiate the cytotoxicity to tumors, cytokine genes to tumor cells from a patient for cancer immunotherapy, multidrug resistance gene transfer to render bone marrow cells resistant to certain antineoplastic drugs), followed by reimplantation of the cells. The reimplanted cells produce the therapeutic protein.
Several key factors or steps appear to be involved for the effective gene transfer to somatic cells in a patient or animal model: (i) the type of vehicle used for gene delivery (liposomes, adenoviruses, retroviruses, AAV, HSV, EBV, polymer, naked plasmid) which will determine not only the half-life in circulation, the biodistribution in tissues, and efficacy of delivery but also the route through the cell membrane and fate of the transgene in the nucleus; (ii) interaction of the gene-vehicle system with components in the serum or body fluids (plasma proteins, macrophages, immune response cells); (iii) targeting to the cell type, organ, or tumor, and binding to the cell surface; (iv) port and mode of entrance to the cell (poration through the cell membrane, receptor-mediated endocytosis), (v) release from cytoplasmic compartments (endosomes, lysosomes), (vi) transport across the nuclear envelope (nuclear import); (vii) type and potency of regulatory elements for driving the expression of the transferred gene in a particular cell type including DNA sequences that determine integration versus maintenance of a plasmid or recombinant virus/retrovirus as an extrachromosomal element; (viii) expression (transcription) of the transgene producing heterogeneous nuclear RNA (HnRNA) which is then (ix) spliced and processed in the nucleus to mature mRNA and is (x) exported to the cytoplasm to be (xi) translated into protein. Additional steps may include posttranslational modification of the protein and addition of a signal peptide (at the gene level) for secretion.
All steps can be experimentally manipulated and improvements in each one can enormously enhance the level of expression and therapeutic index of a gene therapy approach. It has been proposed that the plasmid vector is unable to translocate to the nucleus unless complexed in the cytoplasm with nuclear proteins possessing nuclear localization signals (NLSs). NLSs are short karyophilic peptides on proteins destined to function in the nucleus used for binding to specific transporter molecules in the cytoplasm, mediating their passage through the pore complexes to the nucleus (see Boulikas, 1998, this volume). NLS are present on histones, transcription factors, nuclear enzymes, and a number of other nuclear proteins; nascent chains of DNA-binding polypeptides could bind to the supercoiled plasmid in the cytoplasm mediating its translocation to the nucleus.
During delivery of foreign DNA in vivo vehicles may be attacked by macrophages, lymphocytes, or other components of the immune system and the vast majority will be cleared from blood, intracellular, or other body fluids before it is given the chance to reach the membrane of the cell target; the half-life of naked plasmids injected intravenously into animals is about 5 min (Lew et al, 1995). Cationic lipids, other than being very toxic, mediate efficient gene delivery passing through biological membranes; those lipid-DNA complexes surviving the immediate neutralization by serum proteins in the blood can reach the lung, heart and other tissues after vein or artery injection with one heart beat and transform endothelial vascular cells (reviewed by Boulikas, 1996d).
A variety of viral vectors have been developed to exploit the characteristic properties of each group to maintain persistence and viral gene expression in infected cells. Retroviral vectors and AAV integrate into target chromosomes and the transgene they carry can be inactivated from position effects from chromatin surroundings. Vectors with persistence/integration functions may not result in high levels of gene delivery in vivo.
Adenoviruses and retroviruses which are of the most frequently used vehicles for gene transfer can accommodate up to 7kb of total foreign DNA into their genome because of packaging limitations. This precludes their use for the transfer of large genomic regions. Transfer of intact yeast artificial chromosome (YAC) into transgenic mice will enable the analysis of large genes or multigenic loci such as human b-globin locus (reviewed by Peterson et al, 1997).
A small portion of plasmid molecules crossing the cell membrane will escape degradation from nucleases in the lysosomes and become released to the cytoplasm; even a smaller portion of these molecules will enter nuclei; finally, after successfully reaching the nucleus, plasmids with therapeutic genes are usually degraded by nuclear enzymes and transgene expression is permanently lost after about 2-7 days from animal tissues following successful gene delivery. During the peak of transgene expression (usually 7-48 h from injection) the transgene transcript can follow the normal fate of other nuclear transcripts when proper polyadenylation signals are provided; its processed mRNA will be exported to the cytoplasm and translated into the therapeutic protein.
The choice of the appropriate delivery system for successful somatic gene transfer demands understanding of the drawbacks and advantages of each delivery system, such as limitations in the total length of the DNA that can be introduced, including the cDNA of the therapeutically important gene and control elements. Understanding the pathophysiology of the disease and the cell targets can give clues on the way of introducing the gene (i.v., i.p., intratumoral, s.c. injection) or direct the gene therapist to designing methods to target and secrete a therapeutic protein from a tissue which is not the normal site of production of a therapeutic protein. The type of control elements required for the anticipated tissue-specific expression of the construct, the presence of viral or other origins of replication as well as of the cDNA encoding the viral replication initiator protein for an episomal replication of the transgene, sequences that prompt integration and others that insulate the gene from the chromatin surroundings at the integration site, are also important for successful gene transfer.
Cancer gene therapy and immunotherapy has been the first priority of human gene therapy protocols. New gene targets are being defined and new clinical protocols are being proposed and approved. Effective eradication of a great variety of tumors with drugs which inhibit angiogenesis has been extraordinarily successful on animal models and the method moves fast to clinical trials; transfer of anti-angiogenesis genes will be the next step. A number of anticancer genes are being tested in preclinical or clinical cancer trials including p53, RB, BRCA1, E1A, bcl-2, MDR-1, HER2, p21, p16, bax, bcl-xs, E2F, antisense IGF-I, antisense c-fos, antisense c-myc, antisense K-ras and the cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a. A promising approach is transfer of the herpes simplex virus thymidine kinase (HSV-tk) gene (suicide gene) and systemic treatment with the prodrug ganciclovir which is converted by HSV-tk into a toxic drug killing dividing cells. Theoretically, expression of therapeutic genes preferentially in cancer cells could be achieved by regulatory elements from tumor-specific genes such as carcinoembryonic antigen.
The first gene therapy products are expected to receive FDA approval by the year 2000; the market for gene therapy products is expected to exceed $45 billion by 2010.
This article reviews the molecular mechanisms and recent developments for the gene therapy of cancer, HIV, ADA deficiency, Parkinson's disease, lysosomal storage disease, hemophilia A and B, a1-antitrypsin deficiency, cystic fibrosis, rheumatoid arthritis, hypertension, familial hypercholesterolemia, atherosclerosis/restenosis, wound healing, and obesity including the treatment of cancer and heart diseases with angiogenesis inhibitors and gene transfer to the arterial wall. It is my intention to give a general overview rather to exhaust the field.
DIVISION ONE: GENE DELIVERY SYSTEMS AND GENE EXPRESSION
II. Gene delivery using retroviruses
A. Recombinant murine retroviruses
The recombinant Moloney murine leukemia virus (Mo-MLV or MLV) has been extensively used for gene transfer. Retroviral vectors derived from Mo-MLV promote the efficient transfer of genes into a variety of cell types from many animal species; up to 8 kb of foreign DNA can be packaged in a retroviral vector. Recombinant retroviruses have been the most frequently used and promising vehicles for the delivery of therapeutic genes in human gene therapy protocols (Appendix 1). Retroviral vectors cause no detectable harm as they enter their target cells; the retroviral nucleic acid becomes integrated into chromosomal DNA, ensuring its long-term persistence and stable transmission to all future progeny of the transduced cell.
The life cycle of the retrovirus is well understood and can be effectively manipulated to generate vectors that can be efficiently and safely packaged. An important contribution to their utility has been the development of retrovirus packaging cells, which allow the production of retroviral vectors in the absence of replication-competent virus.
Recombinant retroviruses stably integrate into the DNA of actively dividing cells, requiring host DNA synthesis for this process (Miller et al, 1990). Although this is a disadvantage for targeting cells at G0, such as the totipotent bone marrow stem cells, it is a great advantage for targeting tumor cells in an organ without affecting the normal cells in the surroundings. This approach has been used to kill gliomas in rat brain tumors by injection of murine fibroblasts stably transduced with a retroviral vector expressing the HSV-tk gene (Culver et al, 1992; see below).
B. Retrovirus packaging cell lines
The use of retroviral vectors in human gene therapy requires a packaging cell line which is incapable of producing replication-competent virus and which produces high titers of replication-deficient vector virus. The packaging cell lines have been stably transduced with viral genes and produce constantly viral proteins needed by viruses to package their genome. Wild-type virus can be produced through recombinational events between the helper virus and a retroviral vector. Methods are also available for generating cell lines which secrete a broad host range retrovirus vectors in the absence of helper virus.
Retrovirus packaging cell lines containing the gag-pol genes from spleen necrosis virus and the env gene from spleen necrosis virus or from amphotropic murine leukemia virus on a separate vector have been used; retrovirus vectors were produced from these helper cell lines without any genetic interactions between the vectors and sequences in the helper cells (Dougherty et al, 1989). An ecotropic packaging cell line and an amphotropic packaging cell line, in which the viral gag and pol genes were on one plasmid and the viral env gene were on another plasmid have been constructed; both plasmids contained deletions of the packaging sequence and the 3' LTR; when the fragmented helper virus genomes were introduced into 3T3 cells they produced titers of retrovirus which were comparable to the titers produced from packaging cells containing the helper virus genome on a single plasmid (Markowitz et al, 1990).
The pBabe retroviral vector constructs which transmit inserted genes at high titers and express them from the Mo-MLV LTR have been designed with one of four different dominantly acting selectable markers, allowing the growth of infected mammalian cells in the presence of G418, hygromycin B, bleomycin/phleomycin or puromycin, respectively. The packaging cell line, omega E, generated with separate gag/pol and ecotropic env expression constructs, was designed in conjunction with the pBabe vectors to reduce the risk of generation of wild type Mo-MLV via homologous recombination events (Morgenstern and Land, 1990).
C. Pseudotyped retroviral vectors
The traditional retroviral vector enters the target cell by binding of a viral envelope glycoprotein to a cell membrane viral receptor. Coinfection of cells with a retrovirus and VSV (vesicular stomatitis virus) produces progeny virions containing the genome of one virus encapsidated by the envelope protein of the other (pseudotypes of viruses); this led to the development of pseudotyped retroviral vectors where the Moloney murine leukemia env gene product is replaced by the VSV-G protein able to interact with other membrane-bound receptors as well as with some components of the lipid bilayer (phosphatidylserine); because of the ubiquitous distribution of these membrane components pseudotyped particles display a very broad host range (Friedmann and Yee, 1995). Use of pseudotyped vectors has been a significant advancement for retroviral gene transfer.
Pseudotypes of VSV and Mo-MLV, are released preferentially at early times after infection of MuLV-producing cells with VSV; at later times, after synthesis of M-MLV proteins has been inhibited by the VSV infection, neither Mo-MLV virions nor the VSV (Mo-MLV) pseudotypes are made. There appears to be a stringent requirement for recognition of the viral core by homologous envelope components for the production of VSV (M-MLV) pseudotypes (Witte and Baltimore, 1977).
The finding that the G protein of vesicular stomatitis virus (VSV) can serve as the exclusive envelope protein component for one specific retroviral vector that expresses VSV G protein was extended to a general transient transfection scheme for producing very high-titer VSV G-enveloped pseudotypes from any Moloney murine leukemia-based retroviral vector (Yee et al, 1994). Pseudotyping of MuLV particles with VSV-G expressed transiently in cells producing MLV Gag and Pol proteins, has yielded vector preparations with a broader host range that could be concentrated by ultracentrifugation. For example, this technology allowed for efficient concentration of vector by ultracentrifugation to titers > 109 colony-forming units/ml and offers hope for potential use for gene transfer in vivo. Furthermore, these vectors could infect cells, such as hamster and fish cell lines, that are ordinarily resistant to infection with vectors containing the retroviral envelope protein (Burns et al, 1993).
A human 293-derived retroviral packaging cell line was generated by Ory et al (1996) capable of producing high titers of recombinant Mo-MLV particles that have incorporated the VSV-G protein. This new packaging cell line may be used for direct in vivo gene transfer using retroviral vectors because the retroviral/VSV-G pseudotypes generated with these cells were significantly more resistant to human complement than commonly used amphotropic vectors.
A human immunodeficiency virus type 1 (HIV-1)-based retroviral vector containing the firefly luciferase reporter gene could be pseudotyped with a broad-host-range VSV envelope glycoprotein G; higher-efficiency gene transfer into CD34+ cells was achieved with a VSV-G-pseudotyped HIV-1 vector than with a vector packaged in an amphotropic envelope (Akkina et al, 1996).
Because the VSV-G protein is toxic to cells when constitutively expressed, Yang et al (1995) have used steroid-inducible and tetracycline-modulated promoter systems to derive stable producer cell lines capable of substantial production of VSV-G pseudotyped MLV particles. Similarly, the toxic G protein of VSV could be induced in a cell line by the removal of tetracycline and the addition of estrogen; this cell line was transduced with a modified tTA transactivator gene engineered with the ligand-binding domain of the estrogen receptor to the carboxy terminus of the tTA transactivator; a single retroviral vector could transduce both the transactivator gene and the VSV-G protein gene controlled by the tTA-inducible promoter into mammalian cells (Iida et al, 1996). The tetracycline-inducible system was modified by fusing the ligand binding domain of the estrogen receptor to the carboxy terminus of a tetracycline-regulated transactivator to regulate VSV-G expression in a tetracycline-dependent manner that could be modulated by b-estradiol in stable packaging cell lines (Chen et al, 1996).
D. Limitations and advancements using retroviral vectors
Before the in vivo gene therapy with retroviruses becomes a successful reality a number of problems must be overcome. Despite the extensive use of retroviral vectors in gene therapy, there are still problems to be solved and there is an ultimate need for the development of new, improved retroviral vectors and packaging systems to fuel further advances in the field of human gene therapy. The principle limitation of retroviruses has been poor gene expression in vivo which has been overcome through the use of tissue-specific promoters. Use of internal ribosome entry sites from picornaviruses in retroviral vectors has provided stable expression of multiple gene enhancers (reviewed by Naviaux and Verma, 1992; Boris-Lawrie and Temin, 1993).
Little is known about the factors that influence the efficiency of retroviral infection in vivo. Many commonly used experimental animal strains, such as mice, harbor endogenous C-type proviruses, some of which are expressed and have circulating antibodies against the viral envelope glycoproteins that cross-react with the Mo-MLV; the efficiency of retrovirus-mediated transfection in vivo using a variety of mouse strains was affected by humoral immune competence and interference between endogenous MLVs and exogenous recombinant Mo-MLV (Fassati et al, 1995).
One of the drawbacks of retroviruses for their exploitation in gene therapy has been the low viral titers obtained, too low to achieve therapeutic levels of gene expression; methods for the efficient concentration from large volumes of supernatant and purification of amphotropic retrovirus particles have been developed in several laboratories. For example, Bowles et al (1996) have used concentration and further purification of virus particles by sucrose banding ultracentrifugation; animal studies have shown that viral transduction increased proportionally with titer of the retrovirus.
Transduced cells producing retrovirus are tissue-incompatible and are, therefore, expected to be attacked by the immune system; this will lead to the elimination of therapeutic cells from the body, a phenomenon markedly associated also with adenoviral gene transfer. A privileged exception are brain tumor cells expressing recombinant retrovirus which persist without immunologic rejection (Culver et al, 1992).
Sodium butyrate treatment of murine retrovirus packaging cells producing a CFTR vector increased the production of the retrovirus vector between 40- and 1,000-fold (Olsen and Sechelski, 1995).
The Cre/LoxP recombinase strategy (see below) has been used to generate retroviral vectors that have the ability to excise themselves after inserting a gene into the genome, thereby avoiding problems encountered with conventional retrovirus vectors, such as recombination with helper viruses or transcriptional repression of transduced genes (Russ et al, 1996). Retroviral vectors with the Cre/LoxP technology have also been used to deliver the GM-CSF gene to K562 cell culture (Fernex et al, 1997), for the development of retroviral suicide vectors for gene therapy using the HSV-tk gene (Bergemann et al, 1995), and for the production of a high-titer producer cell line containing a single LoxP site flanked by the viral LTRs (Vanin et al, 1997).
Because retrovirus vectors are integrated into the genome, transcriptional repression of transduced genes will often take place from position effects exerted from neighboring chromatin domains; two matrix-attached regions (MARs), one at either flank of the transgene, are proposed here to insulating the gene in the retrovirus vector from chromatin effects at the integration site by creating an independent realm of chromatin structure harboring the transgene. MAR insulators have been used and can enhance up to 2,000-fold the expression of genes in transgenic animals and plants (McKnight et al, 1992; Breyne et al, 1992; Allen et al, 1993; Brooks et al, 1994; Thompson et al, 1994; Forrester et al, 1994).
E. Targeting of retrovirus to specific cell types
A number of approaches have been directed to develop retroviral vectors that are able to target particular cell types; also efforts focus toward retroviral vectors that incorporate nonretroviral features and are tailored to desired needs for specific uses (reviewed by Vile and Russell, 1995; Gunzburg and Salmons, 1996).
Ideally, therapeutic genes should be delivered only to the relevant cell type and/or expressed in this cell type. Viral and nonviral vectors can be targeted through ligand-receptor interactions. Retroviral targeting through protease-substrate interactions has also been described; epidermal growth factor (EGF) was fused to a retroviral envelope glycoprotein via a cleavable linker comprising a factor Xa protease recognition signal. Vector particles displaying the cleavable EGF domain could bind to EGF receptors on human cells but did not transfer their genes until they were cleaved by factor Xa protease (Nilson et al, 1996).
A retroviral vector that infects human cells specifically through recognition of the low density lipoprotein receptor has been described by adding onto the ecotropic envelope protein of M-MLV a single-chain variable fragment derived from a monoclonal antibody recognizing the human LDL-R; the chimeric envelope protein was used to construct a packaging cell line producing a retroviral vector capable of transfer of the lacZ gene to human cells expressing LDL-R (Somia et al, 1995).
F. Other retroviruses
Viruses that contain RNA as their genetic material may be either negative- or positive-strand RNA viruses. The very large group of negative-strand RNA viruses includes some of the most serious and notorious pathogens subdivided into those with segmented RNA (influenza viruses, comprising eight separate segments of RNA and bunyaviruses containing three segments of single-stranded RNA, the large, L, the medium, M, and the small, S) and those with nonsegmented RNA (VSV, rabies, measles, Sendai, respiratory syncytial virus, Ebola viruses). Positive-strand RNA viruses include poliovirus.
Cloned positive-strand poliovirus cDNA is infectious but neither isolated genome nor antigenome RNA of negative-strand viruses is infectious; this is because the negative-strand viral RNA is assembled with viral nucleoprotein into an RNP complex that becomes the template for the viral RNA-dependent RNA polymerase. Helper influenza virus-dependent procedures have been developed in which an influenza virus-like RNA molecule, containing a reporter gene, was mixed with disrupted virion core proteins to reconstitute RNP complexes in vitro which were then transfected into influenza virus-transfected cells. Recombinant nucleocapsid and polymerase proteins for the unsegmented RNA viruses have also been used to produce infectious virus without help from an homologous virus using full-length cDNA clones of intracellularly transcribed antigenomes (rabies, VSV, measles, Sendai) (see Bridgen and Elliott, 1996 and the references cited therein).
Plasmids containing full-length cDNA copies of the three RNA genome molecules of Bunyamwera bunyavirus and a negative-sense copy of the GFP gene, flanked by T7 promoter and hepatitis delta virus ribozyme sequences, were used to produce infectious virus particles without helper virus; these plasmids were used to transfect HeLa cells which expressed T7 RNA polymerase and recombinant Bunyamwera bunyavirus proteins by previous transfection with the appropriate plasmids; 24 h after infection about 1 in 1,000 HeLa cells displayed fluorescence indicative of transcription and replication of the reporter RNA (Bridgen and Elliott, 1996).
III. Adenoviral gene delivery
A. Adenovirus replication, transcription, and attachment to the nuclear matrix
Before understanding the principle of adenoviral gene transfer, it is essential to comprehend the molecular events which are involved in the life cycle of the adenovirus. Adenoviruses posses a well-defined origin of replication which is stimulated by transcription factors NFI and NFIII (Hay, 1985; Pruijn et al, 1986). The transcription factor NF-I (also called CTF, CCAAT box-binding protein, or C/EBP) stimulates replication of adenovirus DNA in vitro (Pruijn et al, 1986; Jones et al, 1987; Santoro et al, 1988; Coenjaerts et al, 1991) by establishing cooperative interactions with Ad-DBP (Adenovirus DNA-binding protein) (Cleat and Hay, 1989). The transcription factor NFIII (also called Oct-1 or OTF-1), involved in the regulation of the histone H2B and immunoglobulin genes, can stimulate initiation of adenovirus DNA replication in vitro (O'Neil et al., 1988; Mul et al, 1990; Verrijzer et al, 1990; Coenjaerts et al, 1991).
The adenovirus 5 protein Ad-DBP is a single-stranded DNA binding protein product of the viral E2A absolutely required for chain elongation during Ad5 DNA replication; other than facilitating unwinding of the DNA, Ad-DBP might also protect single-stranded DNA at the replication fork from nuclease attack, increase the rate of processivity of the viral DNA polymerase, and increase binding of NFI of the core origin of Ad5 (Cleat and Hay 1989). This protein has a size of 529 amino acids, is phosphorylated and apart from its role in DNA replication is also involved in transcription, recombination, transformation, and virus assembly (see Tucker et al 1994). Crystal structure at 2.6 A resolution of Ad-DBP shows that a 17 aa C-terminal domain hooks onto a second Ad-DBP molecule thus promoting its cooperativity during DNA binding; Ad DBP was proposed to act by forming a core around which single-stranded DNA winds (Tucker et al, 1994).
Adenoviruses replicate episomally; they need to attach to the nuclear matrix of the host cell for their replication. Two adenoviral proteins have been found attached to the nuclear matrix and presumably mediating the anchorage of the adenovirus: (i) the E1a protein (11 kDa), a transcription and replication factor sufficient to immortalize primary rodent cells, which was crosslinked to matrix proteins with oxidation with o-phenanthroline/Cu2+ (Chatterjee and Flint, 1986) and (ii) the adenovirus terminal protein (55 kDa) which is covalently attached to the 5' end of Ad DNA and initiates DNA replication; the adenovirus terminal protein mediated adenovirus anchorage to nuclear matrix was resistant to 1M guanidine extraction (Bodnar et al, 1989; Schaack et al, 1990; Fredman and Engler, 1993).
Three types of internal matrix structures were recognized in HeLa cells infected with adenovirus 2; an amorphously dense region; granular regions representing virus capsid assembly structures; and filaments connecting these regions to one another and to the peripheral lamina (Zhonghe et al, 1987); the perinuclear matrix was also rearranged after adenovirus infection.
Electron micrographs of thin sections through nuclei of adenovirus-infected HeLa cells showed that the 3H-deoxyuridine grains were located at the periphery as well as in the interior of nuclei. Simultaneous visualization of adenovirus transcription and replication showed that the two processes occurred in adjacent, yet distinct, foci throughout the interior and periphery of nuclei presumably in association with the nuclear matrix; DNA molecules were found to be displaced from the replication foci and to become spread in the surrounding nucleoplasm serving as templates for transcription (Pombo et al, 1994).
Adenovirus infection provokes dramatic rearrangements to the nuclear matrix. A reorganization in both internal and peripheral NM was also observed in HeLa cells after infection with adenovirus 2 giving structures able to support the increased replication demands and capsid assembly of the virus (Zhonghe et al, 1987). Splicing of adenoviral HnRNA takes place on the nuclear matrix. All adenovirus 2 polyadenylated RNAs could be UV crosslinked to two host HnRNP proteins that are involved in the association of HnRNA to the matrix (Mariman et al, 1982).
Adenovirus establishes foci called replication centers within the nucleus, where adenoviral replication and transcription occur; although the rAAV genome was faintly detectable in a perinuclear distribution after successfully entering the cell, AAV was mobilized to the adenovirus replication centers when the cell was infected with adenovirus; thus AAV colocalizes with the adenovirus replication centers (Weitzman et al, 1996).
B. Adenovirus E1A and E1B proteins in apoptosis and control of the host cell cycle
Viruses have developed strategies to shut down protein synthesis in the host and subdue its protein synthesizing machinery to produce progeny virus when infecting cells. In response, many cell types commit suicide after viral infection to protect the organism from further infection. Striking back, viruses have evolved mechanisms to prevent infected cells from perishing using mechanisms that inhibit apoptosis of the host cell; adenoviruses synthesize the 19 kDa E1B protein which has a domain similar to that of the cellular protein Bcl-2, the apoptosis inhibitor (Sarnow et al, 1982; van den Heuvel et al., 1990). p53 can be complexed with adenovirus E1B (Sarnow et al, 1982; van den Heuvel et al., 1990).
Expression of the adenovirus E1A protein stimulates host DNA synthesis and induces apoptosis; on the contrary E1B 19 kDa associates with Bax protein and inhibits apoptosis (Figure 1). The E1A oncogene of adenovirus exerts its effect via p53 protein (Debbas and White, 1993; White, 1993). Indeed, expression of E1A increases the half-life of p53 resulting in accumulation of p53 molecules in adenovirus-infected cells leading to apoptosis. Although induction of host DNA synthesis by E1A provides a suitable environment for virus replication, the induction of apoptosis by the same protein impairs virus production since virus-infected cells are eliminated (see Han et al, 1996 for references). p53-deficient cells are transformed by E1A because of absence of the pathway for induction of apoptosis by p53 (Lowe et al, 1994).
E1A represses HER-2/neu transcription and functions as a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. Transfer the E1A gene into cancer cells that overexpress HER-2/neu is an interesting aspect of gene therapy (see E1A in gene therapy; Yu et al, 1995; Chang et al, 1996; Ueno NT et al, 1997; Rodriguez et al, 1997; Xing et al, 1997).
The E1B oncogene products inhibit apoptosis induced by E1A expression thus preventing premature death of host cells during adenovirus infection. This gives an advantage to virus for its proliferation and E1B proteins (19 kDa and 55 kDa) are necessary for transformation of primary rodent cells by E1A. E1A alone is unable to transform primary rodent cells (White, 1993).
The E1B 19K protein of adenovirus is the putative viral homolog of the cellular Bcl-2 protein; using the yeast two-hybrid system for the identification of proteins interacting with E1B, Han and coworkers (1996) have identified Bax as one of the seven 19k-interacting clones. The 50-78 amino acid domain of Bax contains a conserved region homologous to Bcl-2 which is able to interact specifically with either Bcl-2 or E1B. In p53 mutant cells expression of Bax induced apoptosis; inhibition of apoptosis by Bcl-2 may proceed via its ability to bind the death-promoting Bax protein (Han et al, 1996). The bax gene is upregulated by p53.
Expression of p53 and of adenovirus E1A induce apoptosis (Debbas and White, 1993; Lowe and Rudley, 1993). A number of proteins when expressed at sufficient amounts block apoptosis; these include Bcl-2 and E1B 19 kDa protein of adenovirus (Debbas and White, 1993; Chiou et al, 1994). All four protein molecules act upstream of Bax which is a potent inducer of apoptosis: both the cellular Bcl-2 and the 19 kDa protein E1B of adenovirus are able to interact with Bax inhibiting its involvement in induction of apoptosis (Han et al, 1996; Figure 1). E1A acts upstream of p53 by increasing the half-life of p53 resulting in an accumulation of p53 molecules in the nucleus (Lowe and Ruley, 1993); increased levels of p53 are then believed to upregulate the bax gene.
The transcription factor E2F was originally identified as an activator of the adenovirus E2 gene and is implicated in the regulation of DNA replication (Shirodkar et al., 1992). Following infection of cells with adenovirus, the DNA binding activity of E2F increases and as a consequence transcription of the E2 gene of adenovirus increases (Kovesdi et al., 1987). These changes in E2F are mediated by E1A protein of adenovirus. RB forms specific complexes with E2F keeping E2F in a form unable to upregulate its target regulatory sequences. E2F can form specific complexes also with cyclin A during S-phase in NIH 3T3 cells (Mudryj et al., 1991). Both types of complexes, E2F-RB and E2F-cyclin A, can be dissociated by the adenovirus E1A protein (Chellappan et al., 1991; Bagchi et al., 1990; reviewed by White, 1998 this volume) but also by phosphorylation of RB at G1/S causing release of E2F and stimulation in transcription of genes required for DNA replication (myc, DHFR). These events contribute to the uncontrolled proliferation of adenovirus-transformed cells (Mudryj et al., 1990, 1991). Release of E2F from RB induced by E1A is critical for transformation of cells by E1A (for references see Hiebert et al, 1995).
C. Strategies of adenoviruses to enter the cell
In order to enter the host cell the adenovirus first attaches with a high affinity to a cell surface receptor, whose nature still remains elusive, using the head domains of the protruding viral fibers; the fibronectin-binding integrin on the cell surface then associates with the penton base protein on the adenovirus triggering endocytosis of the virus particle via coated pits and coated vesicles (Svensson and Persson, 1984; Greber et al, 1996). The third step in adenovirus entry into the host cell includes

Figure 1. Role of E1A and E1B19-kDa proteins of adenovirus in apoptosis.
penetration of the adenoviral particles by acid-catalyzed rupture of the endosomal membrane involving the penton protein and the integrins and allowing escape to the cytoplasmic compartment; a decrease in endosome pH during internalization expose hydrophobic domains of these adenoviral capsid proteins which permits these proteins to insert into the vesicle membrane in a fashion that ultimately disrupts its integrity (Seth et al, 1984). At the final step the adenoviral particle is attached to the cytoplasmic side of pore complexes and the DNA is released to the interior of pore annuli entering the nucleoplasm.
These highly ordered processes are accompanied by losses or protease degradation of specific proteins on the viral particles; the fibers and some of the penton base complexes on the adenovirus surface are already lost during the process of endocytosis; a viral protease, L3/p23, located inside the capsid at 10 copies per virion, plays a key role in the stepwise dismantling and in the weakening of the capsid structure culminating with the release of the adenovirus DNA by degrading of the viral capsid protein VI (Greber et al, 1996). The mechanism of disruption of endosomes by the adenoviral particles has been exploited to augment efficiency of transfection with transferrin-polylysine-DNA complexes (see fusogenic peptides and Curiel et al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al, 1993; Morishita et al, 1993; Harries et al, 1993; Curiel, 1994).
To overcome one of the major limitations to the clinical utility of adenoviruses which is the low efficiency of gene transfer achieved in vivo, Arcasoy et al (1997) found that the presence of the polycations polybrene, protamine, DEAE-dextran, and poly-L-lysine significantly increased the transfection efficiency in cell culture using the lacZ gene; because the polyanion heparin did not significantly alter gene transfer efficiency, but completely abrogated the effects of polycations it supports the idea that the negative charges presented by membrane glycoproteins reduce the efficiency of adenovirus-mediated gene transfer, an obstacle that can be overcome by polycations.
D. Advantages and drawbacks of adenoviral vectors in gene delivery
Adenoviruses possess a linear double-stranded genome which can be manipulated to accommodate up to 7.5 kb of DNA. Adenoviruses have the advantage of being able to infect nondividing cells. Other advantages are the rarity of recombination events between adenoviral vectors and the host chromosomes, the absence of induction of human malignancies by adenoviruses, and the relative safety of their use as vaccines (e.g. Ballay et al, 1985; Haj-Ahmad and Graham, 1986). For safety, replication-deficient, infectious adenoviruses are being used in somatic gene transfer; for example deletion in a portion of the E3 region of the virus permits encapsidation whereas deletion of a portion of the E1A coding sequence impairs viral replication (Gilardi et al, 1990; Rosenfeld et al, 1991).
E. Deletion of adenoviral DNA sequences for gene delivery
First generation recombinant adenoviruses were rendered defective by deletion of sequences spanning the E1A and E1B genes; these adenoviruses expressed low levels of early and late viral genes responsible for activating destructive cellular immune responses. Further deletion of other essential genes and growth in new packaging cell lines or incorporation of temperature sensitive mutations which allow propagation of the virus in available packaging cell lines at permissive temperatures are strategies for improving the therapeutic efficacy of recombinant adenoviruses and for minimizing the immune response elicited to the host (Fisher et al, 1996).
E1-defective, recombinant adenoviruses can be replication-enabled by the codelivery of a plasmid encoding the deleted E1 functions, a strategy now designated as “conditional replication-enablement system for adenovirus” (CRESA); when the original replication-enabling plasmid was replaced by two separate plasmids that encoded the necessary E1A and E1B functions the E1-defective adenovirus could become conditionally replication-enabled by an RNA transcript encoding the required E1 functions. The RNA transcript of E1A enhanced the therapeutic efficacy of the E1-defective adenovirus: subcutaneous human tumor nodules containing a fraction of cells cotransduced with the replication-enabling RNA + DNA and an HSV-tk adenovirus were reduced to a greater extent than control nodules generated from the same fraction of cells cotransduced with the HSV-tk adenovirus and an irrelevant plasmid (Dion et al, 1996).
A new type of recombinant adenovirus, (called delta-rAd), deprived of all viral open reading frames and retaining only the essential cis elements (i.e., ITRs and contiguous packaging sequence), was propagated in 293 cells in the presence of E1-deleted helper virus (Fisher et al, 1996). This adenovirus was packaged as concatamers into virions and was used to deliver successfully the CFTR gene to human airway epithelial cells in culture derived from a cystic fibrosis patient. The new delivery system needs improvements in its production and purification to allow its evaluation and use in vivo.
F. Immune response to adenoviruses eliminate therapeutic cells
Adenoviruses can achieve high levels of gene transfer (Haffe et al, 1992; Morsy et al, 1993; Herz and Gerard; Wilson, 1995; Kozarsky et al, 1996). However, the duration of transgene expression is limited (i) by clearance of the infected cells because of the cellular and humoral immune response (including those mediated by cytotoxic T lymphocytes) to adenoviral antigens (Yang Y et al, 1994, 1995) and (ii) by loss of adenoviral episomes in progeny cells (Feng et al, 1997). To circumvent this problem adenoviral/retroviral chimeric vectors were constructed where the nonintegrative adenoviral vector was able to induce target cells to function as transient retrovirus producer cells and the retroviral particles were able to transduce neighboring cells; thus the recombinant adenovirus became integrative via the intermediate generation of a retroviral producing cell (Feng et al, 1997). First generation adenovirus-mediated gene transfer of CFTR to the mouse lung resulted in the expression of viral proteins leading to the elimination of the therapeutic cells expressing CFTR by cellular immune responses and repopulation of the lung with nontransgene containing cells; second generation E1-deleted viruses, also crippled by a temperature sensitive mutation in the E2A gene, displayed substantially longer recombinant gene expression and induced a lower inflammatory response (Yang et al, 1994).
In order to circumvent the elimination of adenovirus-transduced cells by immune responses and for achieving persistence of transgene expression strategies to reduce the potential for viral gene expression have been developed; for example, an E4 modified adenovirus which was replication defective in cotton rats and displayed a reduced potential for viral gene expression in vivo was engineered (Armentano et al, 1997). Vectors containing a wild-type E4 region, E4 open reading frame 6, or a complete E4 deletion were compared in the lungs of BALB/c mice for persistence of CFTR or lacZ expression; expression was transient from the E1a promoter with all vectors but persisted from the CMV promoter only with a vector containing a wild-type E4 region; thus, transient expression from adenoviral vectors may result from the down-regulation of a promoter and not necessarily from immune response-related factors (Armentano et al, 1997).
The elimination of therapeutically important cells from the body after recombinant adenovirus-mediated delivery seems to be a great limiting factor for the use of adenoviruses in long-term gene therapy (Dai et al, 1995). This problem can be partially circumvented by daily administration of the immunosupressant cyclosporin A prohibiting the elimination of virally-transduced cell by activated T lymphocytes (Fang et al, 1995). A different approach to suppress elimination of therapeutically-transduced cells after intra-articular delivery of genes to treat RA is by pretreatment of the joints with the anti-T cell receptor monoclonal antibody H57, a treatment which resulted in a significant reduction in lymphocytic infiltration and a persistence of transgene expression (Sawchuk et al, 1996).
The prokaryotic Cre-LoxP recombination system was adapted to generate recombinant adenoviruses with extended deletions in the viral genome in order to minimize expression of immunogenic and/or cytotoxic viral proteins. An adenovirus was produced with a 25-kb deletion that lacked E1, E2, E3, and late gene expression; this vector exhibited viral titers similar to those achieved with first-generation (E1a-deleted) vectors which was efficient for gene transfer to cell culture but gene expression declined to undetectable levels much more rapidly than that sustained from first-generation vectors. Vectors deleted only at E1a were sustaining a better reporter gene expression because of their ability to replicate (Lieber et al, 1996).
A clinical protocol proposed recently for the therapy of amyotrophic lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells which is implanted intrathecally to provide human ciliary neurotrophic factor; the membrane prevents immunologic rejection of the cells interposing a virus impermeable barrier between the transduced cells and the host (Deglon et al, 1996; Pochon et al, 1996); the method has been applied before for cross-species transplantation of a polymer-encapsulated dopamine-secreting cell line to treat Parkinson's disease and for the delivery of nerve growth factor in rat and primate models of the Alzheimer's disease (Kordower et al, 1994; see Pochon et al, 1996 for more references). Evidently, similar approaches could be used to protect adenovirus- and retrovirus-transduced syngeneic cells from immunologic rejection provided that the therapeutic protein is secreted.
A new area of investigation is directed toward surface modification of recombinant adenoviruses to render them safer and to minimize the strong immune responses against the virus and virus-infected cells; to this end Fender et al (1997) proposed a dodecahedron made of adenovirus pentons or penton bases and having only one or two adenovirus proteins instead of the 11 contained in an adenovirus virion; the penton is a complex of two oligomeric proteins, a penton base and fiber, involved in the cell attachment, internalization, and liberation of virus from endosomes.
It is certain that great improvements in adenoviral gene delivery will solve many of the current problems and permit a higher therapeutic efficacy in the near future.
G. Examples of adenoviral gene transfer
Recombinant adenovirus vectors have been used: for the transfer of factor IX gene in hemophilia B dogs via vein injection (Kay et al, 1994) and in mice (Smith et al, 1993); for the transfer of genes into neurons and glia in the brain (le Gal la Salle, 1993); for the transfer of the gene of ornithine transcarmylase in deficient mouse and human hepatocytes (Morsy et al, 1993); for the transfer of the VLDL receptor gene for treatment of familial hypercholesterolaemia in the mouse model (Kozarsky et al, 1996); for the transfer of low density lipoprotein receptor gene in normal mice (Herz and Gerard, 1993); and for the ex vivo transduction of T cells from ADA-deficient patients (Blaese et al, 1995; Bordignon et al, 1995). The adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia of cotton rat respiratory pathway as a model for the treatment of a1-antitrypsin deficiency; both in vitro and in vivo infections


Figure 2. Localization of a recombinant adenoviral vector carrying 6.3 kb of dystrophin cDNA by in situ PCR following intramuscular injection to immunosuppressed mdx mice. Shown are transverse cryostat sections of mdx tibialis anterior muscle. Panel A shows a strong in situ hybridization signal (an E4 adenoviral sequence was amplified and an E4 probe was used) in myonuclei of an immunosuppressed animal injected with E1, E3-deleted adenovirus at 30 days postinjection (magnification 650x). Panel B was produced without Taq polymerase during PCR as a negative control. Panel C shows an uninjected muscle processed as described in panel A showing no hybridization signal. From Zhao JE, Lochumuller H, Nalbantoglu J, Allen C, Prescott S, Massie B, Karpati G (1997) Study of adenovirus-mediated dystrophin minigene transfer to skeletal muscle by combined microscopic display of adenoviral DNA and dystrophin. Hum Gene Ther 8, 1565-1573. With kind permission of the authors (George Karpati, Montreal Neurological Institute, Canada) and Mary Ann Liebert, Inc.

have shown production and secretion of a1-antitrypsin by the lung cells (Rosenfeld et al, 1991).
A transductional preference of adenovirus-polylysine-DNA complexes and E1A/B-deleted replication-deficient adenoviruses was demonstrated for the prostate carcinoma cell lines DU145, LNCaP, and PC-3 over primary human bone marrow cells and the leukemia cell line KG-1; this finding led to a strategy to purge bone marrow of a specific subset of prostate carcinoma cells (Kim et al, 1997).
Figure 2 shows the localization of a recombinant adenoviral vector carrying 6.3 kb of dystrophin cDNA, driven by the CMV promoter, by in situ PCR following intramuscular injection to immunosuppressed mdx mice. Figure 3. shows a comparison of the persistence of dystrophin expression and adenoviral genomes in immunosuppressed versus immunocompetent mdx mice. The maximum number of fibers containing recombinant adenovirus was maintained until 60 days in immunosuppressed mice but for only 10 days in immunocompetent animals. Thus, optimization of immunosuppression could assure successful long term dystrophin gene transfer for gene therapy of Duchenne muscular dystrophy (Zhao et al, 1997).
A number of RAC-approved protocols for gene transfer to humans use recombinant adenoviruses (Appendix 1, protocols 118-157). Genes transferred to patients with recombinant adenoviruses include p53 (#130, 131, 147, 148, 152-156), RB (#140), CFTR (#118-123, 125, 128, 129), HSV-tk (126, 127, 132, 136, 139, 141, 143, 145, 146), cytosine deaminase (#134, 151), VEGF (#157), IL-2 (#135), GM-CSF (#149, 150), anti-erbB-2 single chain antibody (#133), ornithine transcarbamylase (#137), and GP100 melanoma antigen (#142).

Figure 3. Comparison of the persistence of dystrophin expression and adenoviral genomes in immunosuppressed versus immunocompetent mdx mice. Shown are combined dystrophin immunostaining and in situ PCR in tibialis anterior muscles of mdx mice at 10 days (A and C) and 60 days (B and D) postinjection. In A and B, FK506 was used as an immunosuppressant, whereas in C and D no immunosuppression was employed. At 10 days there was no significant difference in adenovirus positive nuclei (arrows) fibers between the immunosuppressed and the immunocompetent groups. At 60 days, however, there was a dramatic decline in the number of positive nuclei in the immunocompetent muscle. Magnification 650X. From Zhao JE, Lochumuller H, Nalbantoglu J, Allen C, Prescott S, Massie B, Karpati G (1997) Study of adenovirus-mediated dystrophin minigene transfer to skeletal muscle by combined microscopic display of adenoviral DNA and dystrophin. Hum Gene Ther 8, 1565-1573. With kind permission of the authors (George Karpati, Montreal Neurological Institute, Canada) and Mary Ann Liebert, Inc.
IV. Gene delivery with Adeno-Associated Virus (AAV)
A. Replication of AAV and rAAV: the role of the inverted terminal repeats
AAVs are replication-defective parvoviruses, not associated with any human disease (nonpathogenic), requiring cotransfection with a helper virus to produce infectious virus particles; they can replicate in cell culture only in the presence of coinfection with adenovirus or herpes virus. Five serotypes of distinct AAV isolates have been recovered from human and other primates. AAV infections in humans are asymptomatic acquired with other viral infections such as adenovirus or HSV infections; 80-90% of adults are seropositive for antibodies against AAV (for references see Clark et al, 1995; Berns and Linden, 1995).
The replication of the AAV is dependent on two copies of a 145-bp inverted terminal repeat (ITR) sequence that flanks the AAV genome which is the primary cis-acting element required for productive infection and the generation of recombinant AAV (rAAV) vectors.
In the absence of helper virus, the AAV particle can penetrate cells and find its way to the cell nucleus where the linear genome is uncoated and becomes integrated at a specific site on chromosome 19q13.3; several copies of AAV may integrate in tandem arrays. Thus, the AAV establishes a latent infection; the integrated viral genome can be activated and rescued by superinfection with helper virus (either adenovirus or any type of herpes virus). Inverted repeats at the ends of the viral DNA serve for the integration appearing near the junctions with cellular DNA sequences (Bohenzky et al, 1988).
Adenovirus establishes foci called replication centers within the nucleus, where adenoviral replication and transcription occur; AAV was colocalized with the adenovirus replication centers using in situ hybridization and immunocytochemistry; AAV may, thus, utilize adenovirus and cellular proteins for its own replication; the rAAV genome was faintly detectable in a perinuclear distribution after successfully entering the cell; however, rAAV was mobilized to replication centers when the cell was subsequently infected with adenovirus (Weitzman et al, 1996).
Xiao et al (1997) have engineered the pDD-2 plasmid containing two copies of the D element, a unique sequence adjacent to the AAV nicking site, flanking a single ITR (a total of only 165 bp of AAV sequence); this modified hairpin was sufficient to sustain replication of the plasmid vector when Rep and adenovirus helper functions were supplied in trans. This plasmid has a significant prospect in gene transfer because is replicated more efficiently than infectious AAV clones; as a prelude to its replication the input circular plasmid was converted into a linear substrate by resolution of the AAV terminal repeat through a Holliday-like structure, a process most likely mediated by host factors. Linear monomer, dimer, and other higher-molecular-weight replicative intermediates were generated during the replication of pDD-2, a feature characteristic of AAV replication. The replicative intermediates of this plasmid substrate were competent for AAV DNA replication, encapsidation, infection, integration, and subsequent rescue from the chromosome when superinfected with Ad and wild-type AAV (Xiao et al, 1997). The elucidation of the important role of this 165-bp ITR sequence for AAV replication and the entire life cycle invigorates the important role of inverted repeats at the origin of replication not only of viruses but also of cellular origins of replication (Boulikas, 1996e).
B. Packaging capabilities of AAVs
AAVs posses a 4.7 kb single-stranded DNA genome. Hermonat et al (1997) have examined the maximum amount of DNA which can be inserted into the wild-type AAV genome without compromising packaging into an infectious virus particle; the maximum effective packaging capacity of AAV, examined as increments of 100 bp ligated at map unit 96 of AAV, is approximately 900 bp larger than wild type. Thus, wtAAV therapy vectors can be generated carrying a foreign gene of 900 bp or less with the advantages of wtAAV such as the ease in which high titers of infectious virus can be generated and the ability to specifically integrate in chromosome 19.
On the contrary, the payload capacity of recombinant AAV, which has been deprived of its viral genes and bears only the ITRs is in the order of 4.5-4.7 kb; this means that a cDNA up to this size can be inserted into a rAAV; for example the size of the CFTR cDNA is 4.5 kb and thus, the combined length of the promoter that drives CFTR expression and ITRs needs to be kept under 500 bp (Dong et al, 1996).
Similar results were reported by Dong et al (1996) who have estimated that the optimal size of AAV vector is between 4.1 and 4.9 kb; the packaging efficiencies were sharply reduced above 5.2 kb and below 4.1 kb; two copies of the vector were packaged into each virion when vectors of 2.2-2.5 kb were provided.
C. Integration of wtAAV but not of rAAV is site-specific
Wild-type AAV is able to undergo targeted integration on chromosome 19 after infection in 15 out of 22 clones examined (Kotin et al, 1990, 1992). Of 51 integrations examined by fluorescence in situ hybridization (FISH) 48 (94%) were to chromosome 19 after infection of IB3-1 bronchial epithelial cells with wild-type AAV (Kearns et al, 1996). Site-specific integration has been reported for other viruses including avian leukosis virus (ALV) integrating adjacent to cellular oncogenes in tumors; however, the mechanism of ALV integration involves a process of selection of cells able to form tumors by overexpression of the oncogene due to virus integration rather than exclusive integration of the ALV at unique sites of the genome (Hayward et al, 1981). RSV also appears to be integrated at a limited number of sites (Shih et al, 1988). Adenovirus integration, a more rare event compared to the majority of episomal molecules, may also occur at a number of preferred sites (Jessberger et al, 1989). A larger number of recombinase molecules than those known today may be present in mammalian cell nuclei and promote site-specific integration and recombination events.
Although the human wild-type AAV (wtAAV) is unique in its ability to target viral integration to a specific site on chromosome 19, the recombinant AAV (rAAV) vectors have lost the site-specific integration and targeting ability; furthermore, rAAVs have incapacitated ability to integrate, and can be found as episomes. When wtAAV-2 was used to infect IB3-1 bronchial epithelial cells all metaphase spreads examined by fluorescence in situ hybridization (FISH) had integrated copies and 94% of the integrations were to chromosome 19; furthermore, 36 of 56 metaphase spreads had a single copy of wtAAV integrated and 20 of 56 showed two sites within chromosome 19 (Kearns et al, 1996). On the contrary, when a recombinant AAV containing the CFTR cDNA was used to infect the same cells, examination of 67 metaphase chromosome spreads identified four integrations (only 6% of total) to different chromosomes. No integration was to chromosome 19. When these studies were repeated on the A35 epithelial cell line selected for stable CFTR expression, the episomal AAV-CFTR sequences were abundant in the low molecular weight DNA fraction (Kearns et al, 1996).
Yang et al (1997) have cloned over 40 AAV and rAAV integration junctions to determine the terminal-repeat sequences that mediate integration. These studies have shown that in both immortalized and normal diploid human cells, wt AAV targeted integration to chromosome 19 in head-to-tail tandem arrays; the majority of the junction sequences were involving incomplete copies of the AAV inverted terminal repeats (ITRs); inversions of genomic and/or viral DNA sequences at the wt integration site took place. The viral integration event was found to be mediated by terminal repeat hairpin structures and cellular recombination pathways. In contrast, rAAV provirus integrated on chromosome 2 and at the same locus in two independent cell lines, in both the flip and flop orientations; genomic rearrangements took place at the integration site of rAAV, mainly involving deletions and/or rearrangement-translocations.
Similar data were reported by Rutledge and Russell (1997): recombinant AAV vectors were found to be integrated by nonhomologous recombination as single-copy proviruses in HeLa cells and at random chromosomal locations; the recombination junctions were scattered throughout the vector terminal repeats with no apparent site specificity; the flanking HeLa DNA at integration sites was not homologous to AAV or to the site-specific integration locus of wild-type AAV. Furthermore, vector proviruses with nearly intact terminal repeats were excised from the genomic HeLa DNA and were amplified after infection of cells with wild-type AAV and adenovirus.
The integration patterns of four recombinant AAV-2 genomes in individual clonal isolates of the human nasopharyngeal carcinoma cell line (KB) were different; the difference between the recombinant AAV-2 genomes were in the combinations of the genes for resistance to tetracycline, to neomycin, to ampicillin, with the genes for AAV replication, and the AAV capsid genes. None of the KB cell clones examined had the proviral genome covalently linked to the specific-site of integration of the wt AAV on chromosome 19 (Ponnazhagan et al, 1997a,b).
D. Drawbacks of AAV in gene therapy and their remedy
Gene transfer with AAV vectors has typically been low. Difficulties in generating recombinant virions on a large scale sufficient for preclinical and clinical trials and in obtaining high-titer virus stocks after the initial transfection into producer cells is a limiting factor for the widespread usage of AAV vectors; this obstacle is expected to be overcome in the near future. The high viral titers required for preclinical and clinical studies have been achieved by a new strategy developed by Tamayose et al (1996); AAV vector particles in cell lysates could be concentrated by sulfonated cellulose column chromatography to a titer higher than 108 cfu/ml or 5 x 1010 particles/ml. A method for transfecting cells at extremely high efficiency with a rAAV vector and complementation plasmid while simultaneously infecting those cells with replication competent adenovirus using adenovirus-polylysine-DNA complexes has been developed by Mamounas et al (1995).
The difficulties in developing packaging cell lines for AAV relate to low levels of rep gene expression from the AAV-p5 promoter and to the propensity of Rep proteins to suppress continued growth of immortalized cell lines; expression of AAV rep under control of the LTR of the human HIV together with the development of cell populations containing rescuable AAV recombinant genomes increased 50-fold the packaging efficiency of AAV vectors (Flotte et al, 1995).
After infection of cell cultures with recombinant AAV there is a decline in the percentage of cells expressing the transferred gene with time in culture. This decline was associated with ongoing losses of vector genomes (Malik et al, 1997). For example, transfer to cultures of K562 human erythroleukemia cells of a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under control of the LTR of the Moloney murine leukemia virus showed that about 30% of cells expressed tNGFR on the surface early after transduction at a multiplicity of infection (MOI) of 13 infectious units (IU), which declined to 3% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately and the proportion of cells expressing tNGFR declined to 62% over 2 months of culture (Malik et al, 1997).
Another obstacle of rAAV vectors is the low rate of integration of rAAV into the host genome (which can be improved at high MOI). The efficiency of integration was about 2% at low MOI (1.3 IU) and increased to at about 49% at an MOI of 130 (Malik et al, 1997).
E. Advantages using AAV and improvements in AAV gene delivery
AAV does not elicit an immune reaction and is a nonpathogenic virus to humans. AAV contains normally a single-stranded copy of its genome. Transduction with AAV can be enhanced in the presence of adenovirus gene products through the formation of double stranded, non-integrated AAV genomes.
AAV has been reported to have advantages over other viruses for gene transfer to hematopoietic stem cells due to their high titers and relative lack of dependence on cell cycle for target cell integration. A robust CMV/LacZ reporter gene expression in primary human CD34+CD2- progenitor cells induced to undergo T-cell differentiation was obtained without toxicity or alteration in the pattern of T-cell differentiation. 70% to 80% of the cells isolated from either adult bone marrow or umbilical cord blood were efficiently transduced with AAV; however, the expression was transient without integration; this limits the potential use of AAV in gene therapy strategies for diseases such as AIDS (Gardner et al, 1997).
Gene transduction by AAV vectors in cell culture can be stimulated over 100-fold by treatment of the target cells with agents that affect DNA metabolism, such as irradiation or topoisomerase inhibitors (Russell et al, 1995); great improvements in transduction efficiency can also be achieved in vivo: previous g-irradiation increased the transduction rate in mouse liver by up to 900-fold, and the topoisomerase inhibitor etoposide increased transduction by about 20-fold after direct liver injection or after systemic delivery via tail vein injection; up to 3% of hepatocytes could be transduced after a single systemic vector injection (Koeberl et al, 1997). This is a significant advantage compared to stealth liposomes which , although concentrating in the liver, spleen and tumors can transduce Kupffer cells but not hepatocytes after systemic delivery (Martin and Boulikas, 1998, following article).
A combination of the adenovirus-5 capsid protein or the Fiber protein of adenovirus with liposomes, termed adenosomes (adenovirus protein-cationic liposome complexes) improved the efficiency of gene transfer. This complex was able to mediate efficient transfer of a AAV/CMV-LacZ construct to endothelial cells (Zhou et al, 1995).
Clark et al (1996) have developed a sensitive assay system to determine infectivity of AAV vectors based on the replication of input rAAV genomes rather than transgene expression which depends on the type of promoter which drives the foreign gene; this system uses a cell line that expresses AAV helper functions (rep and cap) upon induction by adenovirus infection.
F. Examples using AAV for gene transfer
AAV will infect a broad number of mammalian cell lines and has been used as a cloning vector to transduce the NeoR gene into mammalian tissue culture cells (Hermonat and Muzyczka 1984). Antisense AAV vectors have been used to inhibit HIV replication (Chatterjee et al, 1992), and to correct Fanconi's anemia in human hematopoietic cells (Walsh et al, 1994). AAVs transduce preferentially cells in S phase; topoisomerase inhibitors increase transduction efficiency (Russell et al, 1995).
Using AAV, the genomic copy of a normal human b-globin gene under control of the DNase l-hypersensitive site 2 (HS-2) from the locus control region was expressed in K562 human erythroleukemia cells, which normally lack the b-globin gene; following selection with G418 by virtue of the neo-resistance function which was provided in the rAAV vector, stable integration of the exogenous b-globin allele was determined (Zhou et al, 1996). Similar data were reported by Einerhand et al (1995) transferring a recombinant AAV-vector containing a human b-globin gene together with the DNase1 hypersensitive sites 4, 3 and 2 of the human b-globin locus control region as an approach for the gene therapy of b-thalassemia and sickle cell anemia. The vector replicated to high titers and could efficiently transduce hematopoietic stem cells isolated from patients. In order to treat sickle cell anemia Lubovy et al (1996) have transferred lacZ with a recombinant AAV vector and stably transduced hematopoietic stem cells purified from normal and homozygous sickle cell anemia patients.
AAV was able to promote delivery of functional levels of glial cell line-derived neurotrophic factor (GDNF), in a degenerative model of Parkinson's disease (Mandel et al, 1997). AAV has also been used for the transduction of the mouse liver in vivo with Factor IX cDNA as a prelude to treatment of hemophiliacs (Snyder et al, 1997; Herzog et al, 1997) and for the human intratracheal instillation of CFTR cDNA into neonatal New Zealand white rabbits (Rubenstein et al, 1997), and to the lungs of rhesus macaques without eliciting inflammation (Conrad et al, 1996).
AAV has also been used for the transfer of the human multidrug resistance gene (hMDR1) cDNA to NIH-3T3 cells followed by selection of successfully transfected cells based on the drug-resistant phenotype conferred by the P-glycoprotein efflux pump (see below and Lee et al, 1997, this volume); integration of MDR1 sequences into the host cell genome was demonstrated by fluorescent in situ hybridization (FISH) but also the persistence of nonintegrated AAV-MDR1 episomal plasmids (Baudard et al, 1996).
Introduction of a human globin gene into murine hematopoietic bone marrow cells ex vivo with a recombinant AAV vector followed by transplantation of these cells into lethally irradiated congenic mice sustained a long-term repopulating ability: human globin gene sequences were detected in the bone marrow and spleen in primary recipient mice for at least 6 months.
Kessler et al (1996) have shown that following a single intramuscular administration of a recombinant adeno-associated virus (rAAV) vector, carrying either the lacZ or the human erythropoietin gene into adult BALB/c mice leads to the local production of the foreign protein in the muscle for at least 32 weeks; furthermore, human erythropoietin was secreted and stimulated red blood cell production in the mouse for up to 40 weeks. This finding was extended by Fisher et al (1997) who arrived to the unexpected finding that intramuscular injection of highly purified recombinant AAV can sustain a high level of transgene expression in the absence of adenovirus after direct injection to the muscle in mice (Figure 4); this expands the potential of AAV for the treatment of inherited and acquired diseases. Using this approach no humoral or cellular immune responses were elicited after transfer of lacZ against the neoantigenic E. coli b-galactosidase. The rAAV genome was integrated at single sites as head-to-tail concatamers into nuclei of differentiated muscle fibers. Transfer of the lacZ gene using a highly purified preparation of AAV which was injected into the skeletal muscle of adult mice in the presence of E2a-deleted adenovirus to enhance transduction followed by direct visualization of the b-galactosidase by X-gal histochemistry revealed high transduction of muscle fibers by day 17 associated with inflammation (Fig 4a and b). Animals that received the same AAVlacZ in the absence of adenovirus demonstrated higher levels of transduction that persisted for 240 days (Fig 4c-h).

Figure 4. Purified recombinant AAV-mediated lacZ gene transfer to the muscle in adult mice sustains a high level of expression and is inflammation-free. Purified AAVlacZ (1x109 genomes in 25 ml) was injected into the tibialis anterior of 5-week-old C57BL/6 mice and tissue was harvested at days 3 (c), 17 (d), 30 (e), 64 (f), and 180 (g, h) post-injection and analyzed by X-gal histochemistry. Samples of AAVlacZ (1x109 genomes in 25 ml) were also supplemented with an E2a mutant adenovirus dl802 (5x1010 A260 particles) just prior to injection and tissue was harvested at days 3 (a) and 17 (b) post-injection. Magnification: a-g, X10; h, X5.
Purified AAVlacZ (175 ml , 1x1012 genomes/ml) was injected into the tibialis anterior of a male rhesus monkey. Biopsies were taken 14 days post-injection and frozen sections were cut and stained for b-galactosidase activity (i and j); magnification: I, X5; j, X10.
k and l: rAAV vector expressing human b-glucoronidase was injected into the tibialis anterior of 5-week-old C57BL/6 mice (1x109 genomes in 25 ml). 30 days post-injection the muscle was harvested and frozen sections were cut and stained for b-glucoronidase. From Fisher KJ, Jooss K, Alston J, Yang Y, Haecker SE, High K, Pathak R, Raper SE, Wilson JM (1997) Recombinant adeno-associated virus for muscle directed gene therapy. Nat Med 3, 306-312. Reproduced with the kind permission of the authors and Nature America, Inc.
AAV-mediated delivery of the lacZ gene by direct injection to brain tumors which were induced from human glioma cells in nude mice showed that 30-40% of the cells along the needle track expressed b-galactosidase; subsequent delivery of the HSV-tk/IL-2 genes to these tumors with AAV and administration of GCV to the animals for 6 days resulted in a 35-fold reduction in the mean volume of tumors compared with controls by a significant contribution from the bystander effect (Okada et al, 1996).
A phase I clinical trial for CF is being conducted at Johns Hopkins Hospital using AAV (see Kearns et al, 1996, and protocols #165, 166 in Appendix 1).
V. Herpes Simplex Virus-1 (HSV-1) and miniviral vectors
HSV-1 has a capacity of inserting up to 30 kb of exogenous DNA which is a clear advantage over the adenovirus (up to 7.5 kb of exogenous DNA). High titer viral stocks can be prepared from HSV-1. HSV-1 also displays a wide range of host cells and can infect nonreplicating cells such as neuron cells in which the vectors can be maintained indefinitely in a latent state. However, infection with HSV-1 is cytotoxic to cells because of residual viral proteins produced by the virus. Strategies to circumvent this drawback led to the development of viral vectors with a very large capacity for insertion (almost as large as the size of the virus) which depend on defective helper virus for replication and packaging into infectious virions (see below). A miniviral vector can combine the advantage of cloning the gene in bacterial plasmids, the high efficiency of virus-mediated gene transfer, and the possibility to transfer large genomic DNA fragments including far upstream, downstream and intronic regulatory elements.
The HSV-1 genome is a 152 kb double-stranded DNA containing three origins of replication and encoding at least 72 unique proteins; it consists of a unique long segment replicated from oriL and two repeats flanking the unique segment each replicated from oriS. Spaete and Frenkel (1982) have constructed plasmids containing the lytic viral origin of replication, foreign DNA inserts, and the terminal packaging signal sequences; in the presence of a wild-type helper virus such an amplicon was amplified into multimeric tandemly-repeated forms of the original vector by rolling-circle replication and was packaged into infectious HSV virions (Spaete and Frenkel, 1982). However, the helper virus caused death of the infected cells due to lytic replication and this system is not amenable to gene therapy.
To circumvent this bottleneck two strategies have been developed leading to replication-defective helper HSV: (i) a temperature-sensitive system permitted production of virion stocks at 31o C whereas infection of cells at 37o C caused inactivation of the helper virus which was incapable of entering the lytic cycle and allowed delivery of the miniviral vector to the target cell without causing its death. (ii) In a different system, the immediately early gene IE3 was deleted from the helper virus; IE3 encodes for a protein (ICP4) essential for early and late viral gene expression and replication; the helper cell line used for packaging had a genomic insertion of the IE3 gene of HSV which was functionally expressed allowing for complementation and for lytic infection using the IE3-defective HSV virus (DeLuca and Schaffer, 1987; Geller and Freese, 1990).
Two types of viral vectors have been used for gene transfer to cancer cells: replication-incompetent vectors expressing a gene product that leads to the destruction of the tumor or replication-competent vectors that are inherently cytotoxic to the tumor cells. In order to combine the two modes of action Miyatake et al (1997) used a defective HSV vector that consisted of a defective particle, containing tandem repeats of the HSV-tk gene, and a replication-competent, non-neurovirulent HSV mutant as a helper virus. When glioma GL261 cells were infected with the tk-defective vector/helper virus the HSV-TK activity was significantly higher than that in helper virus-infected cells which contained a single copy of HSV-tk; subcutaneous injection of these cells to C57BL/6 mice inducing gliomas led to a significant decrease in tumor size after GCV treatment.
An HSV-1 vector containing a 6.8-kb fragment of the rat tyrosine hydroxylase promoter (pTHlac) supported a seven- to 20-fold increase in reporter gene expression in catecholaminergic cell lines compared to noncatecho-laminergic cell lines. Furthermore, 4 days after stereotactic injection into the midbrain of adult rats and for a duration of 6 weeks, pTHlac supported a 10-fold targeting of b-galactosidase expression to tyrosine hydroxylase-expressing neurons in the substantia nigra pars compacta compared with pHSVlac; this long term expression was significant compared to that from pHSVlac which decreased approximately 30-fold between 4 days and 6 weeks after gene transfer (Song et al, 1997); this study also shows the importance of large control regions in the order of 7 kb in sustaining cell type-correct gene expression, something feasible with HSV and liposomes but nor with recombinant retrovirus, adenovirus, or AAV.
VI. HIV vectors for gene transfer
Recent studies have succeeded in exploiting the deadly HIV-1 virus, after crippling some functions, as a gene delivery vehicle. An advantage of HIV vectors has been the broad range of tissues and cell types they can transduce, a property granted because lentiviral vectors are pseudotyped with vesicular stomatitis virus G glycoprotein. Human lentiviral (HIV)-based vectors can transduce non-dividing cells in vitro and deliver genes in vivo; expression of transgenes in the brain has been detected for more than six months. HIV vectors have been also used to introduce genes directly into liver and muscle; 3-4% of the total liver tissue was transduced by a single injection of 1-3 x 107 infectious units (I.U.) of recombinant HIV with no inflammation or recruitment of lymphocytes at the site of injection. Whereas expression of green fluorescent protein (GFP), used as a surrogate for therapeutic protein, was observed for more than 22 weeks in the liver and for over 8 weeks in the muscle using lentiviral vectors, little or no GFP could be detected in liver or muscle transduced with the Moloney murine leukemia virus (Mo-MLV), a prototypic retroviral vector (Kafri et al, 1997).
The development of a stable noninfectious HIV-1 packaging cell line capable of generating high-titer HIV-1 vectors is another important step towards use of HIV vectors in gene therapy (Corbeau et al, 1996). A hybrid murine leukemia virus-based vector containing U3 and R sequences from HIV-1 in place of the MLV U3 and R regions gave single transcriptional unit retroviral vectors under the control of Tat; this vector has advantages for anti-HIV gene therapy (Cannon et al, 1996).
Although replication-incompetent HIV vectors displayed a strict CD4+ T cell tropism for gene transfer, a feature important for AIDS therapy, it was thought to preclude HIV-based vectors for other gene transfer applications; a two-step gene transfer system, however, was developed to expand the host range of the HIV vector: in the first step, the CD4 gene was introduced into target cells using a replication-defective adenoviral vector; in the second step the CD4-transfected cells were incubated with HIV vectors which resulted in stable integration and HIV-mediated gene transfer (Miyake et al, 1996).
An HIV multiply attenuated vector in which the virulence genes env, vif, vpr, vpu, and nef were deleted was able to deliver genes in vivo into adult neurons (Zufferey et al, 1997).
HIV-mediated gene transfer was used to transfer the GFP gene under control of CMV to retinal cells by injection into the subretinal space of eyes in rats; the GFP gene was efficiently expressed in both photoreceptor cells and retinal pigment epithelium; predominant expression in photoreceptor cells was achieved using the rhodopsin promoter. The transduction efficiency was high and photoreceptor cells in >80% of the area of whole retina were expressing GFP (Miyoshi et al, 1997).
VII. Epstein-Barr virus (EBV) and baculovirus vectors
EBV is an episomaly-replicating virus in synchrony with the cell cycle. EBV infects human cells causing mononucleosis; the presence of the unique latent origin of replication (oriP) in EBV allows for episomal replication of the virus in human cells without entering the lytic cycle. The presence of oriP and of the replication initiator protein EBNA1 cDNA on a vector allows episomal replication in human cells; in addition, plasmids containing only oriP can replicate episomally into cell lines expressing EBNA-1 (Sun et al, 1994; Banerjee et al, 1995).
A hybrid HSV-1/EBV vector has been developed by Wang and Vos (1996), which combines (i) the HSV-1 lytic oriS; (ii) an HSV-1 packaging sequence which allows replication and packaging in the presence of defective helper virus carrying a deletion in the IE3 gene in the E5 cell line expressing the IE3 gene; (iii) the latent oriP of EBV and (iv) the EBNA-1 cDNA allow episomal replication of the infectious vector in the E5 cell line so that viral stocks of high titer can be made. Infection of tumor-derived fibroblast and epithelial cell lines in culture and local injection of human liver tumors in nude mice was used to demonstrate 95-99% efficiency of infection and transfer of the reporter b-galactosidase gene.
Genetically modified baculoviruses (Autographa californica nuclear polyhedrosis virus) were used to efficiently deliver genes into cultured hepatocytes of different origin; delivery into human hepatocytes with baculovirus vectors approached 100% efficiency in cell culture and expression levels were high when mammalian promoters were chosen. A number of drawbacks preclude their direct application in vivo; nevertheless gene transfer was feasible in ex vivo perfused human liver tissue (Sandig et al, 1996; Hofmann et al, 1998 this volume).
VIII. Liposomal gene delivery
Abbreviations:
DC-CHOL: 3b [N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol
DDAB: dimethyldioctadecyl ammonium bromide
DMRIE: N-[1-(2,3-dimyristyloxy)propyl]-N,N-dimethyl-N-(2-hydroxyethyl) ammonium bromide
DMTAP: 1,2-dimyristoyl-3-trimethylammonium propane
DOGS: Dioctadecylamidoglycylspermine (Transfectam, Promega)
DOPE: dioleyl phosphatidylethanolamine
DOSPA: 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl -1-propanaminium trifluoroacetate
DOTAP: N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
DOTMA: N-[1-(2,3-dioleyloxy) propyl]-n,n,n-trimethylammonium chloride
DPTAP: 1,2- dipalmitoyl-3-trimethylammonium propane
DSTAP: 1,2-disteroyl-3-trimethylammonium propane
Lipofectin: DOTMA:DOPE 1:1 (GIBCO BRL)
A. Immune responses and toxicity of cationic lipid-DNA complexes
Cationic lipids have been widely used for gene transfer; a number of clinical trials (34 out of 220 total RAC-approved protocols as of December 1997) use cationic lipids (see Table 4 in Martin and Boulikas, 1998, this volume, pages 203-206). Although many cell culture studies have been documented, systemic delivery of genes with cationic lipids in vivo has been very limited. All clinical protocols use subcutaneous, intradermal, intratumoral, and intracranial injection as well as intranasal, intrapleural, or aerosol administration but not i.v. delivery because of the toxicity of the cationic lipids and DOPE (see Table 4 in Martin and Boulikas, 1998, this volume, pages 203-206).
Liposomes formulated from DOPE and cationic lipids based on diacyltrimethylammonium propane (dioleoyl-, dimyristoyl-, dipalmitoyl-, disteroyl-trimethylammonium propane or DOTAP, DMTAP, DPTAP, DSTAP, respectively) or DDAB were highly toxic when incubated in vitro with phagocytic cells (macrophages and U937 cells), but not towards non-phagocytic T lymphocytes; the rank order of toxicity was DOPE/DDAB > DOPE/DOTAP > DOPE/DMTAP > DOPE/DPTAP > DOPE/DSTAP; the toxicity was determined from the effect of the cationic liposomes on the synthesis of nitric oxide (NO) and TNF-a produced by activated macrophages (Filion and Phillips, 1997).
Another factor to be considered before i.v. injections are undertaken is that negatively charged serum proteins can interact and cause inactivation of cationic liposomes (Yang and Huang, 1997). Condensing agents used for plasmid delivery including polylysine, transferrin-polylysine, a fifth-generation poly(amidoamine) (PAMAM) dendrimer, poly(ethyleneimine), and several cationic lipids (DOTAP, DC-Chol/DOPE, DOGS/DOPE, and DOTMA/DOPE) were found to activate the complement system to varying extents. Strong complement activation was seen with long-chain polylysines, the dendrimer, poly(ethyleneimine), and DOGS; complement activation was considerably reduced by modifying the surface of preformed DNA complexes with polyethyleneglycol (Plank et al, 1996).
B. Mechanism of liposome entry to cells
Cationic lipids increase the transfection efficiency by destabilizing the biological membranes including plasma, endosomal, and lysosomal membranes; indeed, incubation of isolated lysosomes with low concentrations of DOTAP caused a striking increase in free activity of b-galactosidase, and even a release of the enzyme into the medium demonstrating that lysosomal membrane is deeply destabilized by the lipid; the mechanism of destabilization was thought to involve an interaction between cationic liposomes and anionic lipids of the lysosomal membrane, allowing a fusion between the lipid bilayers; the process was less pronounced at pH 5 than at pH 7.4 and anionic amphipathic lipids were able to prevent partially this membrane destabilization (Wattiaux et al, 1997).
In contrast to DOTAP and DMRIE which were 100% charged at pH 7.4, DC-CHOL was only about 50% charged as monitored by a pH-sensitive fluorophore; this difference decreases the charge on the external surfaces of the liposomes and was proposed to promote an easier dissociation of bilayers containing DC-CHOL from the plasmid DNA and an increase in release of the DNA-lipid complex into the cytosol from the endosomes (Zuidam and Barenholz, 1997).
C. Tissue targets using cationic liposomes in vivo
Although cationic lipids have been used widely for the delivery of genes very few studies have used systemic i.v. injection of cationic liposome-plasmid complexes because of the toxicity of the lipid component and certainly in animal models, not humans. Administration by i.v. injection of two types of cationic lipids of similar structure, DOTMA and DOTAP, has shown that the transfection efficiency was determined mainly by the structure of the cationic lipid and the ratio of cationic lipid to DNA; the luciferase and GFP gene expression in different organs was transient, with a peak level between 4 and 24 hr, dropping to less than 1% of the peak level by day 4 (Song et al, 1997).
Figure 5 shows the effect of cationic lipid:DNA ratio on transfection efficiency after i.v. tail injection. Luciferase activity was detected in all organs examined with the highest level in lung. In the absence of neutral lipid both DOTMA and DOTAP promoted a linear increase in luciferase activity in the lung with increasing lipid:DNA from 12:1 to 36:1 nmol lipid: mg of DNA. DOTMA was 10 times more efficient than DOTAP (106 versus 107 relative luciferase units (RLU) per mg protein. Cholesterol (Chol) mixed with DOTMA (1:1 molar ratio) decreased the level of gene expression in the lung whereas cholesterol did not affect the transfection efficiency of DOTAP liposomes. Inclusion of DOPE into either DOTAP or DOTMA liposomes significantly decreased the transfection efficiency by 100-fold in the lung.
When a group of four cationic lipids with identical head group but of different fatty acyl chains were tested for their transfection efficiencies (Figure 6); these included DOTAP, DMTAP, DPTAP, and DSTAP. The C14 acyl chain-lipid DMTAP had a similar transfection efficiency as DOTAP which has 18 carbon atoms in the acyl chain and one double bond (C18D9); on the contrary, the transfection efficiencies of DPTAP (C16) was 10-100 fold lower and that of DSTAP (C18) was 100 to 1000 fold lower.
Confocal microscopy of lung tissue after injection of 25 mg pCMV-GFP plasmid DNA complexed with DOTMA liposomes to mice (Figure 7) has shown that the type of cells that express the transgene are the endothelial cells that have typical characteristics of neighboring multiple air-sac structures (Figure 7D).
A number of different organs in vivo can be targeted after liposomal delivery of genes or oligonucleotides. Intravenous injection of cationic liposome-plasmid complexes by tail vein in mice targeted mainly the lung and to a smaller extend the liver, spleen, heart, kidney and other organs (Zhu et al, 1993). Intraperitoneal injection of a plasmid-liposome complex expressing antisense K-ras RNA in nude mice inoculated i.p. with AsPC-1 pancreatic cancer cells harboring K-ras point mutations and PCR analysis indicated that the injected DNA was delivered to various organs except brain (Aoki et al, 1995).
A number of factors for DOTAP:cholesterol/DNA complex preparation including the DNA:liposome ratio, mild sonication, heating, and extrusion were found to be crucial for improved systemic delivery; maximal gene expression was obtained when a homogeneous population of DNA:liposome complexes between 200 to 450 nm in size were used. Cryo-electron microscopy showed that the DNA was condensed on the interior of invaginated liposomes between two lipid bilayers in these formulations, a factor that was thought to be responsible for the high transfection efficiency in vivo and for the broad tissue distribution (Templeton et al, 1997).
Steps to improve for successful liposome-mediated gene delivery to somatic cells include persistence of the plasmid in blood circulation, port of entry and transport across the cell membrane, release from endosomal compartments into the cytoplasm, nuclear import by docking through the pore complexes of the nuclear envelope, expression driven by the appropriate promoter/enhancer control elements, and persistence of the plasmid in the nucleus for long periods. A number of strategies for liposomal delivery and for enhancing the efficiency of uptake by the cells and release from endosomal compartments of plasmid or oligonucleotide DNA are reviewed in the following article (Martin and Boulikas, 1998).

Figure 5. Effect of cationic lipid:DNA ratio on transfection efficiency after i.v. tail injection. Each mouse received 25 mg of pCMV-Luciferase plasmid DNA complexed with various amounts of liposomes indicated on the charts (at 1:1 ratio when two lipids were used). Luciferase activity was assayed 20 h after i.v. injection in up to 5 different tissues represented with different bar forms: the empty bar is lung, the large stripe bar is spleen, the small stripe is heart, gray bar is liver, and black bar is kidney. Four time points (12h, 24h, 36h, and 48h from i.v. injection) of luciferase activity are shown. Numbers +02 to +08 to the left of the figure indicates 102 to 108 relative luciferase units (RLU) per mg protein in the tissue. From Song YK, Liu F, Chu S, Liu D (1997) Characterization of cationic liposome-mediated gene transfer in vivo by intravenous administration. Hum Gene Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu, University of Pittsburgh) and Mary Ann Liebert, Inc.
Figure 6. Effect of fatty acyl chain composition on transfection efficiency. Luciferase activity was assayed 20 h post-injection in the lung, spleen, heart, liver, and kidney (in the order shown, see legend to previous figure for bar symbols). From Song YK, Liu F, Chu S, Liu D (1997) Characterization of cationic liposome-mediated gene transfer in vivo by intravenous administration. Hum Gene Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu, University of Pittsburgh) and Mary Ann Liebert, Inc.


Figure 7. Analysis of green fluorescence protein (GFP) expression in the lung using confocal microscopy. 25 mg pCMV-GFP plasmid DNA complexed with DOTMA liposomes were injected to mice and GFP expression in the lung was examined 14 h post-injection . (A): transmitted light image and (B): fluorescence image (green) were observed at low magnification (Bar 100 mm). C and D are the images obtained at higher magnification showing the localization of GFP in endothelial cells (Bar 25 mm). E and F are the images from control animals injected with pCMV-Luc plasmid rather than GFP plasmid. From Song YK, Liu F, Chu S, Liu D (1997) Characterization of cationic liposome-mediated gene transfer in vivo by intravenous administration. Hum Gene Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu, University of Pittsburgh) and Mary Ann Liebert, Inc.
D. Cationic lipids in oligonucleotide transfer
Encapsulation of oligonucleotides into liposomes increased their therapeutic index, prevented degradation in cultured cells and in human serum and reduced toxicity to cells (Thierry and Dritschilo, 1992; Capaccioli et al, 1993; Morishita et al, 1993; Williams et al, 1996; Lewis et al, 1996); conjugation to a fusogenic peptide enhanced the biological activity of antisense oligonucleotides (Bongartz et al, 1994). However, most studies have been performed in cell culture, and very few in animals in vivo; there is still an important number of improvements needed before these approaches can move to the clinic.
Zelphati and Szoka (1997) have found that complexes of fluorescently labeled oligonucleotides with DOTAP liposomes entered the cell using an endocytic pathway mainly involving uncoated vesicles; oligonucleotides redistributed from punctate cytoplasmic regions into the nucleus; this process was independent of acidification of the endosomal vesicles. The nuclear uptake of oligonucleotides depended on several factors such as charge of the particle where positively charged complexes were required for enhanced nuclear uptake; DOTAP increased over 100 fold the antisense activity of a specific anti-luciferase oligonucleotide. Physicochemical studies of oligonucleotide-liposome complexes of different cationic lipid compositions indicated that either phosphatidylethanolamine or negative charges on other lipids in the cell membrane are required for efficient fusion with cationic liposome-oligonucleotide complexes to promote entry to the cell (Jaaskelainen et al, 1994).
Similar results were reported by Lappalainen et al (1997); digoxigenin-labeled oligodeoxynucleotides (ODNs) complexed with the polycationic DOSPA and the monocationic DDAB (with DOPE as a helper lipid) were uptaken by CaSki cells in culture by endocytosis. The nuclear membrane was found to pose a barrier against nuclear import of ODNs which accumulated in the perinuclear area. Although DOSPA/DOPE liposomes could deliver ODNs into the cytosol, they were unable to mediate nuclear import of ODNs; on the contrary oligonucleotide-DDAB/DOPE complexes with a net positive charge were released from vesicles into the cytoplasm; it was determined that DDAB/DOPE mediated nuclear import of the oligonucleotides.
DOPE-heme (ferric protoporphyrin IX) conjugates, inserted in cationic lipid particles with DOTAP, protected oligoribonucleotides from degradation in human serum and increased oligoribonucleotide uptake into 2.2.15 human hepatoma cells; the enhancing effect of heme was evident only at a net negative charge in the particles (Takle et al, 1997). Uptake of liposomes labeled with 111In and composed of DC-Chol and DOPE was primarily by liver, with some accumulation in spleen and skin and very little in the lung after i.v. tail injection; preincubation of cationic liposomes with phosphorothioate oligonucleotide induced a dramatic, yet transient, accumulation of the lipid in lung which gradually redistributed to liver. The mechanism of lung uptake involved entrapment of large aggregates of oligonucleotides within pulmonary capillaries at 15 min post-injection via embolism; labeled oligonucleotide was localized primarily to phagocytic vacuoles of Kupffer cells at 24 h post-injection; nuclear uptake of oligonucleotide in vivo was not observed (Litzinger et al, 1996).
Phosphorothioate oligonucleotides were found in most tissues 48 h after i.p. administration with highest concentrations in kidney and liver; complexation of the oligonucleotide with DOTMA did not affect neither the oligonucleotide uptake nor its tissue distribution in normal mice but increased the oligonucleotide cellular uptake (4-10 times) in LOX ascites tumors (Saijo et al, 1994).
Triplex-forming ODNs were delivered to cells in culture using adenovirus-polylysine-ODN complexes designed to take advantage of the receptor mediated endocytosis of adenoviruses to transfer the ODNs to the cell nucleus; nuclear uptake peaked at 4 h and intact ODN persisted in the nucleus with a half-life of 12 h (Ebbinghaus et al, 1996).
E. Fusogenic peptides enhance gene transfer efficiency
Enveloped viruses have evolved efficient mechanisms to release their genomes from the endosomes into the cytoplasm of the host cells; specific envelope proteins of the nucleocapsid are capable of destabilizing the endosomal membrane. Therefore, inactivated viruses have been used to enhance the transfer of plasmids. Addition of adenoviral particles capable of inducing endosome lysis (Blumenthal et al, 1986), mediated by a conformational change in the adenovirus penton protein induced at the lower pH of endosomes (Seth, 1994) can increase transfection efficiency 100-1000 fold using 109 adenoviral particles/ml and the transferrin receptor (Curiel et al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al, 1993; Morishita et al, 1993; Harries et al, 1993; Curiel, 1994; reviewed by Ledley, 1995).
Use of fusogenic peptides from influenza virus hemagglutinin HA-2 enhanced greatly the efficiency of transferrin-polylysine-DNA complex uptake by cells; in this case the peptide was linked to polylysine and the complex was delivered by the transferrin receptor-mediated endocytosis (Wagner et al, 1992a; Plank et al, 1994). This peptide had the sequence: GLFEAIAGFIENGWEGMID GGGYC and was able to induce the release of the fluorescent dye calcein from liposomes prepared with egg yolk phosphatidylcholine which was higher at acidic pH; this peptide was also able to increase up to 10-fold the anti-HIV potency of antisense oligonucleotides, at a concentration of 0.1-1 mM, using CEM-SS lymphocytes in culture (Bongartz et al, 1994). This peptide changes conformation at the slightly more acidic environment of the endosome destabilizing and breaking the endosomal membrane (Murata et al, 1992; Bullough et al, 1994). Fusogenic peptides have been used by other investigators (Midoux et al, 1993; Kamata et al, 1994). It is thought that several fusogenic peptides self-assemble following their conformational change forming a transmembrane channel (Bongartz et al, 1994).
Sendai virosomes were effective for delivering AAV neuropeptide Y (NPY) cDNA constructs in vivo. Injections into brain neocortex of Sendai-virosome encapsulated rAAV construct expressing NPY increased NPY-like immunoreactivity in neurons but not glia; injections into the rat hypothalamic para-ventricular nucleus increased body weight and food intake for 21 days (Wu et al, 1996). Tomita et al (1996) have found that newborn mice can sustain expression of the insulin gene delivered by Sendai virus-liposome complexes for at least 8 weeks as assayed by reverse transcriptase PCR and radioimmunoassay, compared to 2 weeks in adult animals.
A 27 residue peptide vector, containing the fusion sequence of HIV gp41 and the nuclear localization sequence of SV40 T antigen was used to deliver oligonucleotides to cell nuclei very rapidly in cell culture (1h). The complexes formed strongly increased the stability of the oligonucleotide to nucleases, enhanced passage through the plasma membrane, and led to endosomal internalization (Morris et at, 1997).
Certain cationic lipids are endowed with a better ability to disrupt the endosomal membrane and promote release of the plasmid to the cytoplasm, a prelude for its nuclear import. Presentation of plasmid DNA to COS cell cultures using three different lipid formulations: (i) vectamidine (3-tetradecylamino-N-tert-butyl-N'-tetradecylpropionamidi ne), (ii) DOTMA:DOPE (Lipofectin), and (iii) DMRIE-Chol (1:1) resulted in complex entry via endocytosis for all three cationic lipids as revealed using transmission electron microscopy. However, the endosomal membrane in contact with complexes containing vectamidine or DMRIE-Chol, but not Lipofectin, often exhibited a disrupted morphology (El Ouahabi et al, 1997).
F. Plasmid condensation with spermine, polylysine, protamine, histones enhances the transfection efficiency
DNA can be presented to cells in culture as a complex with polycations such as polylysine, or basic proteins such as protamine, total histones or specific histone fractions (Fritz et al, 1996), cationized albumin, and others (Smull and Ludwig, 1962). These molecules increase the transfection efficiency. In addition to HMG1, also histone H1 and HMG17 were identified as transfection-enhancing proteins in cell culture (Zaitsev et al, 1997). Histone H2A significantly enhanced in vitro DNA transfection whereas other histones and anionic liposomes did not (Balicki and Beutler, 1997). Gene transfer through the asialo-glycoprotein receptor-mediated endocytosis pathway was enhanced with the histones H1, H2a, H2b, H3, and H4 which were galactosylated with the crosslinker agent, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, conjugated to DNA and then used to transfect HepG2 cells, which display the asialoglycoprotein receptor (Chen et al, 1994). Plasmid DNA and HMG1 were efficiently co-encapsulated in liposomes by agitation and sonication, and were co-introduced into cells by hemagglutinating virus of Japan (HVJ)-mediated membrane fusion; the presence of HMG1 enhanced 3-fold the transfection efficiency (Kato et al, 1991).
The interaction of plasmid DNA with protamine sulfate followed by the addition of DOTAP cationic liposomes offered a better protection of plasmid DNA against enzymatic digestion and gave consistently higher gene expression in mice via tail vein injection compared with DOTAP/DNA complexes; 50 mg of luciferase-plasmid per mouse gave 20 ng luciferase protein per mg extracted tissue protein in the lung which was detected as early as 1 h after injection, peaked at 6 h and declined thereafter. Intraportal injection of protamine/DOTAP/DNA led to about a 100-fold decrease in gene expression in the lung as compared with i.v. injection; endothelial cells were the primary locus of lacZ transgene expression (Li and Huang, 1997). Protamine sulfate enhanced plasmid delivery into several different types of cells in vitro using the monovalent cationic liposomal formulations (DC-Chol and lipofectin); this effect was less pronounced with the multivalent cationic liposome formulation, lipofectamine (Sorgi et al, 1997).
Spermine has been found to enhance the transfection efficiency of DNA-cationic liposome complexes in cell culture and in animal studies; this biogenic polyamine at high concentrations caused liposome fusion most likely promoted by the simultaneous interaction of one molecule of spermine (four positively charged amino groups) with the polar head groups of two or more molecules of lipids. At low concentrations (0.03-0.1 mM) it promoted anchorage of the liposome-DNA complex to the surface of cells and enhanced significantly transfection efficiency (Boulikas et al, in preparation).
Because the receptor for ecotropic viruses is a transporter for basic amino acids, use of a histone as a facilitator increased the efficiency of retroviral infection (Singh and Rigby, 1996). Polybrene is the usual agent employed during retroviral infection. For supernate infections, concentrations of 5-10 mg/ml of protamine provided essentially the same infection efficiency as polybrene; protamine displayed low toxicity on a range of cell types and increased 7-fold the efficiency of retroviral infection (Cornetta and Anderson, 1989).
The polycations polybrene, protamine, DEAE-dextran, and poly-L-lysine significantly increased the efficiency of adenovirus-mediated gene transfer in cell culture; this was thought to act by neutralizing the negative charges presented by membrane glycoproteins which reduce the efficiency of adenovirus-mediated gene transfer (Arcasoy et al, 1997).
G. Targeted gene delivery
Targeting a specific cell type or animal tissue is an important goal of gene therapy. Many different approaches have been undertaken to achieve targeting. A recombinant adenovirus encoding an anti-erbB-2 intracellular single-chain antibody (sFv) displayed a genetic selectivity for the erbB-2-positive prostate carcinoma cell lines DU145 and LNCaP; delivery of this recombinant adenovirus resulted in cytotoxicity to the DU145 and LNCaP, but not PC-3, cell lines and reduced the clonogenic capacity of DU145 cells cultured alone or mixed with various ratios of irradiated human bone marrow. This finding led to a strategy for effectively reducing DU145 and erbB-2-positive primary prostate tumor contamination in bone marrow cultures (Kim et al, 1997). Delivery of an anti-erbB-2 single chain (sFv) antibody gene for previously treated ovarian and extraovarian cancer patients is in clinical trials using adenoviral gene delivery (protocol #133).
A luciferase expression vector (pRSVLuc) non-covalently linked to a humanized HER2 antibody (rhuMAbHER2) covalently modified with poly-L-lysine bridges was able to direct gene transfer to HER2 expressing cells in vitro (Foster and Kern, 1997).
A targeting gene therapy approach for hematopoietic stem/progenitor cells has been directed to cell lines expressing the c-kit receptor; plasmid DNA containing a luciferase reporter gene was condensed with polylysine covalently linked to streptavidin (which binds biotinylated ligand) and with polylysine covalently linked to adenovirus (to achieve endosomal lysis) with the final addition of biotinylated steel factor; omission of the adenovirus endosomalytic agent from the vector resulted in the loss of gene expression (Schwarzenberger et al, 1996).
Systemic administration of a c-fos antisense, regulated by mouse mammary tumor virus (MMTV) control elements in a retroviral vector, showed expression only in breast epithelium although the vector could be detected in several tissues thus supporting targeting to MMTV-regulated tissues (Arteaga and Holt, 1996).
Liposomes coated with polyethyleneglycol (PEG) can be efficiently targeted to tumor cells that express folate receptors (KB cells) via conjugation of folate to a PEG spacer of 25 nm in length; shorter PEG spacers were not efficient in mediating binding of the liposomes to KB cells (Lee and Low, 1995).
Neri and coworkers (1997) were able to target an angiogenesis-associated oncofetal fibronectin (B-FN) isoform by affinity-matured recombinant antibody fragments. B-FN is present in vessels of neoplastic tissues during angiogenesis but is absent from mature vessels and could provide a target for diagnostic imaging and therapy of cancer. Phage display libraries were screened to isolate human antibody fragments able to recognize this isoform across species; imaging of F9 murine teratocarcinomas grafted in nude mice is shown on Figures 8 and 9.
H. Targeted gene delivery with peptide-displaying phages
Development of methods to display and select collections of peptides specific for binding a target provide valuable tools to identification of peptide drugs; peptides could be selected for binding biological targets including cell surface receptor molecules, DNA, antibodies, or whole cells. The technique of peptide-displaying phages has been developed for targeted gene delivery. Selection of cell surface-binding peptides, ideally specific for each type of cell in the human body, will be used for incorporation into gene delivery vehicles to achieve the long-searched tissue specificity of the vector (reviewed by Russell, 1996).
Development of the random peptide library as a source of specific protein binding molecules (Devlin et al, 1990) and exposure of random peptides on the surface of phages (Cwirla et al, 1990) has been the catalyst for progress in this promising field. Libraries of random 8 to 12 amino acid peptides expressed on the N-terminus of the pIII protein of the fd phage or on the N-terminus of the pVIII major coat protein of the same phage have been selected that bind the extracellular domain of human IL-1 receptor; screening was against immobilized IL-1 receptor extracellular domain. Two families of peptides could act as antagonists blocking triggering of the IL-1 signaling pathway; because IL-1 levels become elevated in autoimmune and inflammatory disorders, these peptide antagonists of IL-1 receptor could provide novel drugs for these diseases (Yanofsky et al, 1996).
Phages displaying known integrin-binding peptides have been shown to bind and enter mammalian cells (Hart et al, 1994). A peptide antagonist to thrombin receptor has been identified using phage display (Doorbar and Winter, 1994). Production of cell-targeting ligands has been achieved by cell-binding peptides specific for different cell types in culture; these peptides are selected through six rounds of binding (and amplification of phage clones) to a particular cell type from random peptide-presenting phage libraries; the selected peptides are apparently recognizing specific surface receptor molecules. For example, the 20mer peptide KTLTLEAALRNAWLREVGLK has been selected for its high affinity for PEA10 mouse fibroblast cells binding 1000 more efficiently to the cells than random peptides (Barry et al, 1996).
IX. Gene delivery with polymers, peptides and other means
A. Delivery of transferrin-polylysine-DNA complexes
A number of polymers have been tested and shown to enhance significantly the transfection efficiency of plasmids but also of viruses; the enhancement in transfection results from a facilitation in the interaction of plasmids with the cell surface, transport to endosomes, release to the cytoplasm, and in some cases nuclear import (reviewed by Behr, 1994).
Figure 8. Role of antibody valence. ® Targeting of fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma grafted in nude mice using the monomeric scFv(CGS-1) and dimeric scFv(CGS-1)2 directed to oncofetal fibronectin; the dimeric scFv(D1.3)2 with a binding specificity to lysozyme was used as a negative control. t: tumor; b: bladder. From Neri D, Carnemolla B, Nissim A, Leprini A, Querze G, Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G (1997) Targeting by affinity-matured recombinant antibody fragments of an angiogenesis associated fibronectin isoform. Nat Biotechnol 15, 1271-1275. Reproduced with the kind permission of the authors (Dario Neri, Inst for Mol Biology and Biophysics, Zürich) and Nature America, Inc.


¬ Figure 9. Role of antibody affinity. Targeting of fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma grafted in nude mice using the affinity-matured scFv(CGS-2) and the lower affinity scFv(28SI) directed to the same epitope of oncofetal fibronectin; Tte dimeric scFv(D1.3)2 with a binding specificity to lysozyme was used as a negative control. t: tumor; b: bladder. From Neri D, Carnemolla B, Nissim A, Leprini A, Querze G, Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G (1997) Targeting by affinity-matured recombinant antibody fragments of an angiogenesis associated fibronectin isoform. Nat Biotechnol 15, 1271-1275. Reproduced with the kind permission of the authors (Dario Neri, Inst for Mol Biology and Biophysics, Zürich) and Nature America, Inc.
Curriel and coworkers (1991) have used the transferrin receptor on the surface of mammalian cells to deliver plasmid-polylysine-transferrin complexes to cells. These complexes are taken up by endosomes following receptor binding, a method which suffers from that the endocytosed DNA is trapped in the intracellular vesicle and is later largely destroyed by lysosomes; use of the capacity of the adenoviruses to disrupt endosomes as part of their entry mechanism to the cells have augmented over 1000-fold the efficiency of gene transfer. This method has been further developed in collaboration with Max Birnstiel; true chemical coupling rather than simple addition of replication-defective adenovirus particles has shown a further increase in transfection efficiency (Cotten et al, 1992; Wagner et al, 1992a,b).
A monoclonal antibody against the CE7 antigen (chCE7) covalently linked to polylysine in the presence of chloroquine was able to transfect NB cells as efficiently as DOTAP, transfectam, TF-X50, or lipofectamine; furthermore, transfection was not observed in cell lines negative for the CE7 antigen (Coll et al, 1997).
B. Polyethylenimine (PEI, ExGen500)
Polyethylenimine, H2N-(CH2-CH2-NH)n-H, is an organic polymer with a potential for high cationic charge. PEI enhanced transfection efficiency in cell culture (Boussif et al, 1996). ExGen500 is a linear 22 kDa form of PEI, which was found to be more efficient than lipofectin, DOTAP and DOGS in delivering the luciferase reporter gene in both newborn and adult rabbit lungs (Ferrari et al, 1997). The PEI 800 kDa and PEI 25 kDa branched polymers have also been used to transfer marker genes to the newborn and adult mouse brain (Boussif et al, 1995; Abdallah et al, 1996). Another advantage of PEI is that it yields high transfection efficiencies with a charge ratio of DNA:PEI close to neutral; this is an advantage as particles with a net positive charge (cationic lipid-DNA complexes) interact with circulating serum proteins or anionic components of the extracellular matrix in the various tissues hindering their bio-availability (Schwartz et al, 1995).
The high transfection efficiency of ExGen 500 was suggested to arise from the “proton sponge” effect which leads to osmotic swelling of endosomes which have uptaken the DNA complexes (Ferrari et al, 1997).
Different cationic compositions may result in different targeting and transfection abilities to specific organs; the branched, 25-kD polyethylenimine polymer (PEI 25k) was superior over DOTAP and DOGS (Transfectam) in the efficiency of transfection of the kidney when complexes of these cations with luciferase plasmid were injected into the left renal artery of rats; luciferase activity peaked at 2 days, was still significantly higher than controls at 7 days, but was undetectable at 14 days post-injection (Boletta et al, 1997).
Scanning force microscopy allowed plasmid DNA strands to be visualized without drying in incomplete condensates prepared with varying stoichiometries of lipospermine or polyethylenimine in physiological solution; discrete nucleation centers of condensation were observed often surrounded by folded loops of DNA using either condensing agent; increasing the amount of lipospermine or polyethylenimine led to further aggregation through folding rather than winding of the DNA (Dunlap et al, 1997).
C. APL PolyCat57 and other polymers
APL PolyCat57 is a synthetic polyamino derivative (nonpeptide, nonlipid polymer) with a glucose backbone which was used by Goldman and coworkers (1997) for gene transfer in vivo and in vitro. A variety of human carcinoma cell lines were transfected with an efficiency superior to that of Lipofectamine. The polymer-plasmid complex was resistant to inhibition by serum allowing for efficient gene transfer in vivo. The level of the luciferase and b-galactosidase reporter gene expression after intrathecal injection, evaluated in animal models bearing stereotactically implanted D54-MG human glioma cell xenografts, was comparable to that obtained with an adenoviral vector.
Liposomes composed of the cationic peptide amphiphile N,N-dihexadecyl-N a-[6-(trimethyl ammonio)- hexanoyl]-L-alaninamide bromide comprising an L-alanine residue interposed between a charged head group and a double-chain segment were more effective and less toxic than lipofectin, and DOTAP for the transfection of COS-7 cells (Kato et al, 1996).
D. Adenovirus-polymer complexes
An adenovirus/DNA complex was constructed by chemically linking poly-L-lysine to the capsid of the replication-defective adenovirus dl312; this complex was then coupled with plasmid DNA via ionic interaction. This system was used to deliver the tumor suppressor protein p53 to the p53- human lung cancer cell line H1299, both in vitro and in vivo, leading to induction of apoptosis; injection of the complex carrying the p53 gene to subcutaneous tumor sites 5 days after tumor cell implantation resulted in a significant inhibition of tumorigenicity as measured by the number and size of tumors that developed 21 days after treatment (Nguyen et al, 1997a,b).
Complexes of cationic polymers and cationic lipids with adenovirus increased adenovirus uptake and transgene expression in cells that were inefficiently infected by adenovirus alone; infection by both complexes was independent of adenovirus fiber and its receptor, occurred via a different cellular pathway than adenovirus alone, and enhanced gene transfer to the nasal epithelium of cystic fibrosis mice in vivo (Fasbender et al, 1997).
E. Peptides in transfer of oligonucleotides
Peptide/oligonucleotide complexes containing a peptide vector and single or double stranded oligonucleotides were delivered into cultured mammalian cells in less than 1 h with relatively high efficiency (90%) at a peptide/oligonucleotide ratio of 20/1. The peptide vector, termed MPG (27 residues), contained a hydrophobic domain derived from the fusion peptide of HIV gp41 and a hydrophilic domain derived from the nuclear localization sequence of SV40 T-antigen. The complexes involved electrostatic interactions between basic peptide residues and phosphate groups from the oligos, as well as additional peptide-peptide interactions yielding oligonucleotides most likely coated with several molecules of MPG; these complexes, which strongly increased the stability of the oligonucleotide to nucleases, enhanced passage through the plasma membrane, and did lead to endosomal internalization; such complexes are promising delivery systems for oligos (Morris et at, 1997).
The cationic amphipathic peptide WEAKLAKALA KALAKHLAKALAKALKACEA was synthesized by Wyman et al (1997) to display hydrophobic leucine residues on one side and hydrophilic lysine residues on the other after coiling to an amphipathic a-helix at pH 7.5; this peptide was suited for oligonucleotide nuclear delivery when complexes were prepared at a 10/1 (+/-) charge ratio and was endowed with the additional property of destabilizing membranes in cell culture.
F. Plasmoviruses
Plasmoviruses are plasmids capable of expressing all the viral genes required for generating infectious particles and packaging a defective genome; transfected as plasmids, plasmoviruses transform the transduced cells into packaging cells; the cells then release infectious replication-defective retrovirus particles of typical type C as revealed by electron microscopy, with the gag proteins correctly processed in the released particles and containing the transgene to be transferred. Released particles are capable of infecting nearby cells and to propagate the transgene in the culture, resulting in stable integration of plasmovirus proviral DNA into the host genome of infected cells. Nonintegrated plasmovirus DNA was not toxic for the cells. Plasmoviruses have been used for the propagation of the HSV-tk gene in cell culture resulting in a major improvement in therapeutic efficacy after ganciclovir treatment, when compared to that of plasmovirus constructs that cannot propagate (Morozov et al, 1997).
G. Particle-mediated gene transfer (PMGT) or gene gun
The particle-mediated gene transfer (PMGT) technique, unlike retroviral transfection, does not require tumor cell proliferation in vitro for gene transfer; instead, tumor tissue can be dissociated into small tissue clumps or cell aggregates and then immediately transfected using the gene gun; plasmid-coated gold particles are delivered to tumor cells using helium pressure with a hand-held gene delivery device overcoming the cumbersome exposure of the patient to viral antigens. PMGT with gold particles coated with human GM-CSF plasmid DNA is being used to transfect melanoma or renal carcinoma tissue from patients; tumor cells are then lethally-irradiated and patients are intradermally vaccinated to elicit anti-tumor immune responses (Mahvi et al, 1997).
Gene gun-mediated DNA delivery into the epidermis overlying an established intradermal murine tumor was used to compare the antitumor effect of several transgene expression plasmids encoding the cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF; IL-12 was superior (see IL-12) (Rakhmilevich et al, 1997).
X. Direct injection of naked plasmid DNA
Naked plasmid has been injected to various tissues and has shown transfection efficiency. Muscle has been the classical tissue in a number of studies. Intramuscular (i.m.) administration of expression plasmids may directly deliver the plasmid to the cytoplasm by damaging the myofibril along the injected area. Direct i.m. injection of naked VEGF plasmid DNA was used in rabbits to optimize treatment of acute limb ischemia; after ligation of distal external iliac artery in New Zealand White rabbits, direct injection of 500 mg of a VEGF165 expression vector into the ischemic thigh muscles resulted in more angiographically recognizable collateral vessels at 30 days posttransfection (Tsurumi et al, 1996, 1997). Injection, guided by intense illumination along the longitudinal axis of the mouse quadriceps muscle and parallel to the myofibers, yielded 200-fold higher levels of luciferase expression than perpendicular injection (Levy et al, 1996).
Other tissues including skin, liver, brain and the gastric submucosa have been successfully transduced with reporter gene cDNA using naked plasmid delivery. Skin from transglutaminase 1 (TGase1)-deficient patients suffering with lamellar ichthyosis was regenerated on nude mice; repeated in vivo direct injections of naked DNA using a TGase1 expression plasmid showed restoration of TGase1 expression in the correct tissue location (Choate and Khavari, 1997).
A naked luciferase expression vector injected intracerebrally in mice provided expression of the luciferase transgene, in both neurons and glia cells (Schwartz et al, 1996). Naked plasmid DNA in hypertonic solutions, injected intraportally in mice whose hepatic veins were transiently occluded, resulted in high levels of luciferase and b-galactosidase expression in 1% of the hepatocytes throughout the entire liver using 100 mg DNA (Budker et al, 1996).
A single injection through the tail vein of a naked endothelium-derived nitric oxide cDNA plasmid caused a significant reduction of systemic blood pressure for 5 to 6 weeks in spontaneously hypertensive rats (Lin et al, 1997). In vivo delivery of a luciferase gene under control of the human cytomegalovirus immediate early gene promoter after intravenous injection (50 mg DNA) via the tail vein into ICR mice has shown that the DNA was degraded with a half-life of less than 5 min from the blood; plasmid DNA was differentially retained in the lung, spleen, liver, heart, kidney, bone morrow, and muscle up to 24 h postinjection; femtogram levels of plasmid were detected only in muscle at 6 months post infection (Lew et al, 1995). pCAT was rapidly degraded after incubation with mouse whole blood in vitro with a half-life of approximately 10 min and much faster after intravenous injection; i.v. injection of radioactively-labeled pCAT showed rapid elimination from the plasma due to extensive uptake by non-parenchymal cells in the liver, a process thought to be mediated via scavenger receptors on these cells (Kawabata et al, 1995).
Direct injection of plasmids carrying reporter genes
into the gastric submucosa of adult rats resulted in transient expression (1-3 days and in exceptional cases for up to 21 days) in smooth muscle cells of the muscularis mucosae and the muscular layer and mesenchymal cells in the lamina propria. These studies indicate that the gastrointestinal nonepithelial tissue, a useful target for in vivo gene transfer, can be transfected with naked DNA (Takehara et al, 1996).
Clinical protocols #158-161 use naked plasmid DNA. Protocol #158 proposes transferring the carcinoembryonic antigen to autologous tumor cells in patients with metastatic colorectal cancer for cancer immunotherapy (Appendix 1, page 170). Protocols 159 and 160 use an intraarterial angioplasty catheter to deliver VEGF cDNA plasmid to patients with peripheral artery disease or restenosis. Plasmid DNA coding for tumor idiotype is being used for intramuscular injection for immumotherapy of non-Hodgkin’s B-cell lymphoma (protocol #161).
Table 1 summarizes the advantages and disadvantages of the principal gene delivery methods.
Table 1. Advantages and drawbacks of delivery systems
|
Gene deliv. system |
Advantages |
Drawbacks |
|
Murine retroviral vectors |
Very safe; may achieve high efficiency of transduction; infects only dividing cells; integrates into host DNA. |
Loss in expression soon after infection; low efficiency in vivo; up to 8 kb of DNA; high titers required for in vivo gene delivery; immunogenicity. |
|
Recombinant adenoviruses |
Infect nondividing cells; rarity of recombination events between adenoviral vectors and the host chromosomes; high efficiency of transduction; adenovirus vectors efficiently escape from the endosome and enter the nucleus; episomaly-replicating virus. |
Induction of immune responses that eliminates therapeutic cells; may induce unwanted infections to humans; only up to 7.5 kb of exogenous DNA can be inserted; loss of adenoviral episomes in progeny cells. |
|
AAV |
Does not stimulate inflammation or immune reaction; enters nondividing cells and does not replicate; nonpathogenic virus. |
Low efficiency of gene transfer; only up to 4.1 and 4.9 kb can be incorporated; wt AAV integrates on chromosome 19 but recombinant AAV integrates at different sites (e.g. chromosome 2); integration may cause inactivation of the transgene by chromatin effects. |
|
HSV-1 |
Can take up to 30 kb of exogenous DNA; high titer viral stocks; wide range; can infect nonreplicating cells |
Infection with HSV-1 is cytotoxic. |
|
Baculovirus |
Specificity for hepatocytes; high efficiency of infection |
Not applicable in vivo at present. |
|
EBV |
Episomaly-replicating virus |
wt EBV infects human cells causing mononucleosis. |
|
HIV-1 |
Transduces non-dividing cells; broad range of tissues and cell types; no inflammation; sustains expression of GFP for 8-22 weeks in muscle and liver after injection to animals |
Start up technology, not broadly tested. |
|
Hybrid HSV/EBV |
High efficiency of infection (95-99% after intratumoral liver injection) |
Not broadly tested. |
|
Cationic lipids |
High efficiency of transfection via membrane destabilization (cell membrane and endosomal); destabilize lysosomal membranes and promote release of plasmid in the cytoplasm. |
Toxic, not suited for i.v. injection; can interact with negatively charged serum proteins in vivo causing transgene inactivation; gene expression is transient; i.v. injection targets mainly the lung |
|
Stealth liposomes |
Non toxic, escape immune surveillance and concentrate into solid tumors by extravasation. |
Not taken up by tumor cells but remain in the extracellular space. |
|
Naked plasmid DNA |
Suited for intramuscular injection and DNA vaccination; easy to use; no viral antigens. |
Low transfection; not widely applicable method; naked plasmid is cleared from blood rapidly. |
|
Gene gun |
Easy to use (plasmid-coated gold particles are delivered to tumor cells using helium pressure); rapid, suited for gene transfer to tumor specimens from patients for immunotherapy. |
Not broadly tested. |
XI. Promoters and enhancers for transgene expression
A. Viral promoters
After escaping serum components and immune cells, crossing the cell membrane, released from endosomes to the cytoplasm and transported through the nuclear pores to the nucleus the transgene has to accomplish two additional tasks: (i) to be efficiently transcribed and (ii) its expression to last for long periods. These two very important factors depend on the DNA regulatory elements that drive the expression of the therapeutic gene. The use of mammalian gene expression vectors has revolutionized the field of direct gene delivery. The proper choice of promoter and enhancer elements linked to the gene of interest is decisive for the successful expression of the gene in the desired tissue or cell type in gene therapy.
The majority of mammalian expression vectors make use of promoter/enhancer elements from pathogenic viruses including the immediately early promoter of the human cytomegalovirus (CMV), the Rous sarcoma virus (RSV) promoter, the enhancer/origin of replication of SV40, the adenovirus type 2 major late promoter (Ad-MLP), as well as promoters from the mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV), herpes simplex virus (HSV), Epstein-Barr virus (EBV), and others.
Many studies have compared the strength of different promoters in driving a therapeutic gene both in cell culture and in vivo. I will mention a few sample studies here. Recombinant adenoviruses carrying the HSV-tk gene under control of the human cytomegalovirus (CMV) immediate early gene promoter or the adenovirus type 2 major late promoter (Ad-MLP) were compared for their killing efficiency in combination with GCV treatment; the rat 9L model for brain tumor and leptomeningeal metastases was used; the adenovirus containing the CMV promoter showed greater cell killing efficiency compared to the Ad-MLP promoter; animals with brain tumors showed significantly longer survival time and animals with leptomeningeal metastases had symptom-free periods (Vincent et al, 1997).
Doll et al (1996) have compared the efficiency of expression of the b-galactosidase gene flanked by the AAV ITRs in brain tumors and primary brain cell cultures driven by four different promoters. The human CMV immediate-early enhancer/promoter was always the strongest, generally by at least one order of magnitude, compared with the SV40 early enhancer/promoter, the JC polymovirus promoter, and the chicken b-actin promoter coupled to the CMV enhancer. High level of expression was usually seen within 24 h of transgene delivery by either transfection or infection, but dropped dramatically within days; all four promoters showed the same decline in sustaining gene expression of b-galactosidase with time (Doll et al, 1996).
The type of regulatory elements on plasmid vectors, including promoter, enhancer, intron, and polyadenylation signals, were systematically evaluated by Yew et al (1997) by constructing a series of plasmids. Figure 10 shows the effect of different introns (panel A) and different poly(A) signals (panel B) on CAT expression. A hybrid intron (HI) appeared to be the most effective. There was a 4-fold increase in CAT expression from the bovine growth hormone (BGH) poly(A) signal vector compared to the SV40 poly(A) signal vector.
Figure 10. Effect of different introns (A) and polyadenylation signals (B) on CAT expression. ELM cells were co-transfected with equimolar amounts of each plasmid using DMRIE:DOPE and CAT protein levels in cell lysates were assayed 48 h after transfection; pCMVb was used as an internal control. SVI is the SV40 19S/16S intron; HI, hybrid intron, SV40 pA, SV40 late polyadenylation signal; BGH, bovine growth hormone polyadenylation signal; b-Glo, rabbit b-globin polyadenylation signal. The data are expressed as mean ±SD (n=3). From Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.

Figure 11. Comparison of CAT expression from different promoters in vitro. ELM cells (solid bars) or CFT1 cells (stippled bars), a human airway epithelial cell line derived from a CF patient, were transfected as described in Figure 10. CAT ELISA assays were carried out 48 h after transfection (an average of 6 assays). CAT protein levels were normalized to pCF1-CAT (in A) or pCMVHICAT (in B). A. Expression from plasmids containing the BGH poly(A) signal. SPC, Surfactant protein C promoter; NOS, nitric oxide synthase promoter; UbB, ubiquitin B promoter; MUC1, mucin 1 promoter; IL8, interleukin 1 promoter; CE, CMV enhancer; pCAT control is a promoterless CAT plasmid. B. Expression from plasmids containing the SV40 poly(A) signal. CC10, Clara cell 10 kDa protein promoter; E1a, adenovirus E1a promoter. The data are expressed as mean ±SD (n=3-12). From Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.

Figure 11 compares the strength of different promoters from CAT constructs containing the bovine growth hormone (BGH) poly(A) signal (panel A) or the SV40 poly(A) signal (panel B) and the hybrid intron. The promoters were chosen for lung targeting. CMV yielded the highest expression in vitro. To determine whether or not incorporating two CMV enhancers could produce higher levels of CAT expression than one, a second CMV enhancer (from -118 to -522 relative to the transcription start site) was inserted 186 bp upstream of the CMV promoter and its associated enhancer; in the context of the SV40 poly(A) signal the second CMV enhancer (CE in Figure 11) increased expression 3-fold; however, when the BGH poly(A) signal was present, the second copy of CMV did not increase CAT expression (Figure 12).
B. Transcription factor binding sites within the CMV promoter
Because of its wide use and the more potent effect, the CMV IE enhancer/promoter deserves some special attention. In order to understand the potent effect of the CMV promoter in the expression of foreign genes we need to understand the transcription factors (TFs) that activate this regulatory region; TFs in the transfected cell will be responsible for binding to the CMV promoter leading to the activation of the transgene. At present not all TF regulatory circuits leading to activation of CMV have been deciphered. Figure 13 shows two CMV promoters retrieved from Genbank which are being used in expression vectors.
The CMV IE promoter includes the 10-bp palindromic sequence CCATATATGG (Figure 13) which resembles the core motif of serum response elements and proved to bind specifically to the cellular nuclear protein serum response factor (SRF). Reporter gene constructs containing four tandem copies of these elements displayed up to 13-fold increased basal enhancer activity and 18-fold tetradecanoyl phorbol acetate responsiveness in U937 cells (Chang et al, 1993).

Figure 12. Effect of a second CMV enhancer region on CAT expression from the CMV promoter. Plasmids were transfected into ELM cells and the cells were harvested 48 h after transfection. Expression was normalized to pCMVHICAT (in B). A. CAT protein levels in cell lysates. RE, RSV LTR enhancer. B. Levels of CAT RNA. Total RNA was isolated from the transfected cells and a quantitative RNA protection assay was performed. The data are expressed as mean ±SD (n=3-9). From Yew NS, Wysokenski DM, Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Two multicopy basal enhancer motifs within the simian CMV IE enhancer, namely, 11 copies of the 16-bp cyclic AMP response element (CRE) and 3 copies of novel 17-bp serum response factor (SRF) binding sites referred to as the SNE (SRF/NF-kB-like element), as well as four classical NF-kB sites within the human CMV promoter, contributed to TPA responsiveness; the SNE sites of the simian CMV promoter contain potential overlapping core recognition binding motifs for SRF, Rel/ NF-kB, ETS, and YY1 class transcription factors but fail to respond to either serum or tumor necrosis factor a; the TPA responsiveness of both human and simian CMV elements proved to involve synergistic interactions between the core SRF binding site (CCATATATGG) and the adjacent inverted ETS binding motifs (TTCC), which correlated directly with formation of a bound tripartite complex containing both the cellular SRF and ELK-1 proteins. This protein complex was more abundant in U-937, K-562, and HeLa cell extracts than in Raji, HF, BALB/c 3T3, or HL-60 cells. A 40-fold stimulation of chloramphenicol acetyltransferase activity mediated by four tandem repeats of the SNE could be induced within 2 h (and up to 250-fold within 6 h) after addition of TPA in DNA-transfected U-937 cells, indicating that the stimulation appeared likely to be a true protein kinase C-mediated signal transduction event rather than a differentiation response (Chan et al, 1996). These studies demonstrate that different cell types are expected to sustain different levels of expression from CMV and that, for cell culture transfections, PKC transduction pathways are likely to stimulate transgene expression from CMV promoters. These findings have important implications for promoter choice in gene therapy.
7TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTAttgacgtcaaTGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTG803
Figure 13A. The CMV promoter sequence from plasmid pRL-CMV, 4079 bp (nucleotides 7-803, Promega) (LOCUS AF025843)
37TCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTAATGTTGGACATGAGCCAATATAAATGTACATATTATGATATGGATACAACGTATGCAATGGGCCAA695
Figure 13B. The CMV IE promoter (nucleotides 37-695, 658 bp) from the expression vector pCMVtkLUC+ (ACCESSION AF027129). ttgacgtcaa is the binding site of HB16; GGGACTTTCC is the binding site for HIVEN 86A (two sites); CCATATATGG is the SRF binding site; TTCC is the ETS core motif; three CATTGACG motifs in each sequence are in bold-face (see Boulikas, 1994 for more references).
A closely related family of ubiquitous DNA binding proteins, called MDBP, binds with high affinity to two 14 base pair (bp) sites within the human cytomegalovirus immediate early gene 1 (CMV IE1) enhancer; these MDBP sites did not require cytosine methylation for optimal binding; mutation of one of the enhancer MDBP sites to prevent MDBP recognition modestly increased the function of a neighboring CREB binding site in a transient transfection assay (Zhang et al, 1995). Furthermore, the CMV promoter competed with the Egr1 promoter for transcription factors or co-factors which might be required for activation by WT1; WT1 was converted from an activator to a repressor by co-transfection of an excess of the parental CMV-based vector (Reddy et al, 1995).
C. Tissue-specific promoters in gene therapy
A number of studies have used tissue-specific promoters and enhancers from mammalian genes in order to attain a cell type-specific expression of the transgene. The discovery of genes which are expressed at high levels in specific tumor cell types has prompted the idea of the use of their promoter or enhancer DNA sequences to express in this particular cancer cell type therapeutically important genes (Venkatesh et al, 1990; Brady et al, 1994; Dimaio et al, 1994; Osaki et al, 1994; Pang et al, 1995).
Examples include the expression of the suicidal CD gene under control of the regulatory regions of the tumor marker gene carcinoembryonic antigen (Richards et al, 1995), the expression of HSV-tk gene, under control of a-fetoprotein enhancer and albumin promoter, into adult liver cells in transgenic animals (Su et al, 1996), the expression of b-galactosidase in tyrosine hydroxylase-expressing neurons in the substantia nigra midbrain of adult rats using the tyrosine hydroxylase promoter (Song et al, 1997), and the expression of the lacZ marker gene under control of the murine pancreatic amylase promoter in the pancreas in neonatal and adult mice (Dematteo et al, 1997). Transduction of the human LDL-R cDNA under the transcriptional control of the liver-type pyruvate kinase promoter allowed high and tissue specific expression of the gene in primary hepatocytes (Pages et al, 1996b).
Fibroblasts, infected with recombinant retroviruses and selected with G418 for the expression of the vector carrying the therapeutic gene, have been used for the ex vivo treatment in animal models; when the therapeutic gene was either under control of the viral LTR or an heterologous internal promoter, expression of the transgene from the integrated retrovirus was shut off (Scharfmann et al, 1991). The use of the dihydrofolate reductase housekeeping gene promoter which is expressed in all cell types, led to sustained expression, albeit at very low levels (Scharfmann et al, 1991); it appears that the combination of a suitable enhancer and promoter for a particular cell type and the method of introduction of the transgene is crucial for sustained expression.
Combination of the mouse muscle creatine kinase enhancer with the human cytomegalovirus promoter to drive the expression of the canine factor IX gene in ex vivo infected mouse primary myoblasts led to the expression of factor IX and its secretion in the blood of mice transplanted with these myoblasts for over 6 months; however, the levels of factor IX protein secreted into the plasma (10 ng/ml for 107 injected cells) were not sufficient to be of therapeutic value (Dai et al, 1992).
Joki and coworkers (1995) have used the promoter of the early growth response gene 1 (EGR-1, also known as Zif/268, TIS-8, NFGI-A, or Krox-24) to confer selective expression of the luciferase gene in glioma cell lines exposed to ionizing radiation; a 10-fold higher activity in luciferase activity was found after irradiation of the cells which was detectable at 1-3 h after stimulation with 20 Gy (stereotactic radiosurgery during treatment of isolated brain metastases, arteriovenous malformations, meningiomas, craniopharyngiomas, and glioblastomas uses a single dose of 20-30 Gy). Transfection of the HSV-tk gene under control of the EGF-1 promoter rendered irradiated, but not nonirradiated, cells sensitive to GCV. Irradiation induces DNA repair, cell cycle arrest, and reinitiation of DNA synthesis in surviving cells; g-radiation also induces higher levels of a number of proteins including p53, AP-1, NF-kB, TNF, IL-1, and EGF-1. Therefore, use of the EGF-1 promoter can activate gene expression selectively in radiation fields and could be used to drive the expression of cytotoxic genes (HSV-tk) for the killing of cancer cells.
Peptides containing the three zinc fingers of Zif268 could efficiently repress activated transcription from promoter constructs prepared with Zif268 binding sites inserted at various positions with respect to the TATA box (Kim and Pabo, 1997); such strategies could find important applications in gene therapy leading to construction of artificial promoters able to activate or repress transcription of transferred genes. A potent hybrid CAG promoter was used to drive the HSV-tk gene and showed effective eradication of pancreatic tumors in animal xenografts (Aoki et al, 1997).
D. Molecular switch systems
The ability to regulate gene expression via exogenous stimuli will facilitate the study of gene functions in mammalian cells. Molecular switch systems have been devised (Wang et al, 1994) allowing the researcher to turn on or off individual genes; the switch used by Delort and Capecchi (1996) is composed of three elements: (i) the inducible UAS promoter, a synthetic promoter containing five GAL4 response elements, normally absent from mammalian genomes; (ii) the synthetic hybrid steroid receptor (TAXI), composed of the GAL4 DNA -binding domain, a truncated human progesterone receptor, and the acidic region from VP16 protein of HSV; the hybrid molecule activates transcription from the UAS promoter when bound to an inducer drug, and (iii) the synthetic nontoxic drug inducer RU486 which is permeable to blood-brain and placental barriers; this model allows up to 100-fold induction of a gene linked to this system and can be finely tuned to lower levels of induction (Delort and Capecchi, 1996).
Transient cotransfection of HeLa cells with the UAS-CAT and the hybrid receptor expression vector showed that the hybrid TAXI protein bound to the UAS promoter only after treatment with RU486 but not progesterone; the TAXI/UAS system was successfully used in transgenic mice to regulate the expression of a human growth hormone gene; the ex vivo approach, however, did not sustain long-term expression of the transgene. This system might allow physicians to alter the level of expression of foreign genes during somatic cell transfer in response to the clinical state of the patient (Delort and Capecchi, 1996).
Iida et al (1996) have modified the tetracycline-controlled inducible system by the addition of the ligand-binding domain of the estrogen receptor to the carboxy terminus of the tTA transactivator; a single retroviral vector could transduce both the transactivator gene and the gene of interest controlled by the tTA-inducible promoter into mammalian cells; cell lines expressing the transactivator were established where the expression of a gene (the toxic G protein of vesicular stomatitis virus) depended on the removal of tetracycline and the addition of estrogen.
A different genetic switch used consisted of the cytochrome P450 1A1 promoter driving the expression of the human apolipoprotein E (apoE) gene in transgenic mice; this switch system was induced by b-naphthoflavone; the inducer could pass transplacentally and via breast milk from an injected mother to her suckling neonatal pups, giving rise to the induction of human apoE in neonate plasma and lowering the cholesterol levels in hypercholesterolemic pups (Smith et al, 1995).
XII. DNA recombination in gene therapy
A. Mechanisms of DNA recombination
Genetic recombination, i.e., exchange of segments of DNA between two molecules of DNA, is a very frequent event. It often occurs during meiosis and also between homologous chromosomes in mitosis. Homologous recombination involving double-strand DNA breaks (DSBs), has similarities to mechanisms of repair of DSB lesions by cells. Specific recombinases have played and continue to play an important role in molecular evolution and genome shuffling; deregulation in recombination procecess is connected to chromosomal aberrations (inversions, translocations) in cancer. The double-strand-break repair model was put forward by Szostak and collaborators (1983) to explain genetic recombination in yeast. Recent studies (reviewed by Stahl, 1996) have isolated the recombination intermediate molecules predicted by the DSB repair model; in this model, a 5’-3’ exonuclease is responsible for the removal of segments of single strands starting bidirectionally from the DSB followed by invasion, repair synthesis and ligation to give the joint molecule which is then reduced to a pair of duplexes by a Holliday junction resolvase.
The development of mature lymphocytes in mammals results from a complex combination of genetically preprogrammed events and interactions with antigens. Shared in its general mechanisms by both B (bone marrow) and T (thymus) lymphocytes this developmental program involves a series of cell migration gene rearrangements, cell-to-cell contacts, as well as positive and negative selection processes; recombination mechanisms take place at the immunoglobulin and the T cell receptor genes to generate a large number of immunoglobulin genes in different lymphocyte clones. One site-specific recombination event brings together the V and the J segments of the light chain immunoglobulin genes. In the case of the heavy chain genes, one recombination event joins a V to a D segment, sequentially followed in a time frame by the joining of the recombined V-D segment to a J segment. Recent studies have shown that the mechanism of V(D)J recombination is a two-step process involving: (i) site-specific DNA cleavage at the 7mer sequence and at the first nucleotide of the coding sequence, implicating the RAG-1 and RAG-2 proteins which are necessary and sufficient for this step (van Gent et al, 1996); (ii) joining of broken ends in a mechanism similar to the repair of double strand breaks. The murine SCID locus has provided crucial information in the elucidation of the second step in V(D)J recombination: thymocytes in SCID mice are able to catalyze joining of signal ends but display an accumulation of hairpin coding ends (Zhu et al, 1996). The murine SCID locus has been mapped to the gene encoding the catalytic subunit of DNA-dependent protein kinase (DNA-PK) (Kirchgessner et al, 1995).
Group I introns from a variety of organisms contain long open reading frames (ORFs) that encode site-specific DNA endonucleases which promote integration of their DNA into cognate sites via homologous recombination. These endonucleases typically cleave intron-lacking DNA near the site of intron insertion (exon-exon junction) creating a staggered DSB which facilitates intron invasion (intron homing). This mechanism has been demonstrated in mitochondria, chloroplasts and nuclei of eukaryotic cells. I-CreI is a member of this class of molecules that promotes homing of the chloroplast 23S rRNA intron in Chlamydomonas reinhardtii ; I-CreI contains once the LAGLI-DADG motif (whereas other members of the family contain two copies of this motif separated by 90-120 amino acids); this motif is important for the endonuclease activity of the molecule. DNA cleavage by I-CreI requires Mg2+ or Mn2+ and is inhibited by monovalent cations, has an optimum for catalytic activity of 50-55oC, is stabilized by DNA and binds to 12 nt on each target strand (Wang et al, 1997).
B. Aberrant recombinations can result in human disease
Mammals carry about 1,000,000 copies of Alu sequences and 10,000 to 100,000 copies of complete and truncated versions of the L1 class of LINEs. Such sequences promote homologous recombination causing translocations of genes and have been hold responsible for a number of human disorders. Alu sequences are found in introns. One type of mutation in the LDL receptor gene responsible for familial hypercholesterolemia has incurred by Alu-Alu recombination deleting several exons and thus producing a truncated receptor molecule with loss of function (Lehrman et al, 1987). De novo insertions of an L1 element into the factor VIII gene can cause hemophilia A in humans (Kazazian et al, 1988).
Foreign DNA transferred to host cells may be rejected (degraded), integrated at random sites by illegitimate recombination, integrated at homologous sites by legitimate recombination, or remain extrachromosomal and replicate autonomously. The homologous recombination between chromosomal DNA and transfected DNA sequences, an event termed "gene targeting," can be used to correct mutated genes in cultured cells.
It has been known for a long time that the translocation of an active gene to the neighborhood of heterochromatin (transcriptionally inert part of the genome) results in silencing of the translocated gene, a process known as "position effect variegation", first described in Drosophila (Lewis, 1950; Wilson et al, 1990).
Chromosomal translocations seem to contribute to tumorigenesis either by activating proto-oncogenes to oncogenes or by inactivating tumor suppressor genes. Mammalian chromosomes contain a number of break-susceptible or fragile sites where breakage can be induced reproducibly by experimental manipulations. Such fragile sites might lie in the neighborhood of transposable elements, hypervariable minisatellites or other DNA structural peculiarities such as Z-DNA, and other hotspots of recombination (reviewed by Haluska et al., 1987).
Nonrandom chromosome rearrangements, observed in a variety of human and animal tumors are associated with the enhanced expression or deregulation of cellular oncogenes. For example, the human c-myc oncogene becomes active following its translocation close to the enhancer sequence within the immunoglobulin heavy chain gene locus (Hayday et al., 1984). The chromosomal translocation (17;19) in acute lymphoblastic leukemia produces a chimeric transcription factor consisting of the amino-terminal portion of the helix-loop-helix proteins E12/E47 fused to the DNA binding and leucine zipper dimerization motifs of the liver-specific protein factor Hlf (Hepatic leukemia factor), normally not expressed in lymphoid cells (Hunger et al., 1992). In pre-B cell acute lymphoblastic leukemia (ALL) the t(1;19) translocation brings together two gene fragments encoding for transcription factors and results in the synthesis of a chimeric transcription factor composed of truncated E2A and Pbx1 (Kamps et al., 1991).
C. Exploitation of recombinases in gene therapy: the Cre/LoxP system
A strategy has recently been developed which facilitates culturing of human cells derived from primary tumors. This method is based on the transient expression of T antigen of SV40 which has been shown to immortalize primary cells of human and murine origin and on the use of bacteriophage recombinase Cre which catalyzes sequence-specific recombination at the LoxP sequence inducing permanent deletion of T antigen cDNA; indeed, if two LoxP sequences were provided as direct repeats the intervening sequence could be deleted during Cre recombination and lost from cells. This is an advantage for primary cell cultures because the continuous expression of SV40 large T antigen may alter the antigenicity of the cells and induce other type of mutations not associated with the original tumor; according to this strategy large T antigen can be expressed in a time-dependent way (Li et al, 1997).
Figure 14 shows the structure of the two retroviral vectors used by Li et al (1997) to facilitate culturing of primary tumor cells and Figure 15 the change in morphology as a result of Cre-Puro retrovirus-induced loss of expression of T antigen in T antigen-immortalized primary cell cultures of mouse breast cancer cells.

Figure 14. Structure of retroviral vectors LoxP-HyTK-large T and Cre-puro allowing expression of T antigen and Cre/LoxP-catalyzed deletion of T antigen cDNA. The 4 small arrows indicate the primers used for PCR analysis; the large arrow above the NLS-CRE box indicates the Cre recombinase mediating LoxP specific deletion. LTR are the long terminal repeats of Moloney Murine Leukemia virus; LOX is the 34 bp sequence identical to the recognition site of Cre recombinase; HyTK is the hygromycin/thymidine kinase fusion gene; NLS-CRE is the Cre recombinase gene targeted to the nucleus by a nuclear localization signal (NLS); SV40 is the SV40 promoter; Puro is a puromycin selection marker. From Li LP, Schlag PM, Blankenstein T (1997) Transient expression of SV 40 large T antigen by Cre/LoxP-mediated site-specific deletion in primary human tumor cells. Hum Gene Ther 8, 1695-1700. Reproduced with the kind permission of the authors and Mary Ann Liebert, Inc.

Figure 15. Large T antigen-immortalized breast cancer cells change morphology and lose expression of T antigen after infection with Cre-Puro retrovirus: after prolonged culture the cells were infected with Cre-Puro retrovirus (B, D) or mock-infected (A, C), selected for Puromycin resistance (A, B, C, D) and resistance to ganciclovir (B, D) and analyzed by light microscopy (A, B) and staining with a large T-antibody (C, D). From Li LP, Schlag PM, Blankenstein T (1997) Transient expression of SV 40 large T antigen by Cre/LoxP-mediated site-specific deletion in primary human tumor cells. Hum Gene Ther 8, 1695-1700. Reproduced with the kind permission of the authors and Mary Ann Liebert, Inc.
Reversible immortalization of primary cells was achieved by Westerman and Leboulch (1996) using retrovirus-mediated transfer of an oncogene that could be subsequently excised by site-specific Cre/LoxP recombination; the FLP/FRT recombination was not efficient in primary cells. Pure populations of cells in which the oncogene was permanently excised were obtained which reverted to their preimmortalized state. Using the Cre/LoxP recombination strategy primary cells could be cultured and expanded; the method was proposed to be applicable for facilitating gene transfer to cells unresponsive to exogenous growth factors.
A retroviral vector, containing both a neomycin resistance expression unit flanked by loxP sites and GM-CSF cDNA, was used to transduce the human hematopoietic K-562 cell line. Superinfection of K562 cell clones with a retrovirus containing a Cre recombinase expression unit and molecular analyses of 30 doubly transduced subclones showed a strict correlation between Cre expression and LoxP-flanked selectable cassette excision; excision of the selectable cassette resulted in a significant increase of GM-CSF transcription driven by the retroviral promoter (Fernex et al, 1997).
Novel retroviral vectors for gene transfer were developed by Bergemann et al (1995) by inserting two LoxP sites into a retroviral vector also containing the HSV-tk gene; Cre expression in cells infected with this vector was followed by BrdU selection for cells in which site-specific recombination took place. Furthermore, replacement of the enhancer/promoter elements in both LTRs by Lox sequences led to the development of retroviral suicide vectors for gene therapy. Vanin et al (1997) have used the Cre/LoxP recombinase system to generate high-titer retroviral producer cell lines; incorporation of LoxP sites at the flanks of a NeoR-HSV-tk cassette in the proviral DNA allowed excision of these selectable markers through expression of Cre recombinase and the production of a high-titer producer cell line containing a single LoxP site flanked by the viral LTRs. Retransfection of this cell line with a plasmid containing a gene of interest flanked by LoxP sites and the Cre expression vector allowed insertional LoxP/LoxP recombination of the gene into the favorable preexisting site in the genome and the generation of a new line with a titer equivalent to that of the parental producer cell line. The Cre/LoxP recombinase strategy has been used to generate retroviral vectors with the ability to excise themselves after inserting a gene into the genome (Russ et al, 1996).
Bushman and Miller (1997) fused retroviral integrase enzymes to sequence-specific DNA-binding domains and investigated target site selection by the resulting proteins. A fusion protein composed of HIV integrase linked to the DNA-binding domain of l repressor was able to direct selective integration of retroviral cDNA in vitro into target DNA containing l repressor binding sites. A fusion of HIV integrase to the DNA binding domain of the zinc finger protein Zif268 also directed increased integration near Zif268 recognition sites.
Introduction of foreign DNA into cell nuclei with recombinase cDNA and appropriate sequences to promote recombination may promote nor only insertion of a therapeutic gene into a specific chromosomal site but also chromosomal rearrangements that could convert therapeutically transduced cells into malignant. There is a great deal of knowledge to be derived from these very promising strategies of gene therapy before they can be successfully applied to humans.
XIII. Fate of the transgene in the nucleus
A. How to sustain transgene expression?
A major drawback in gene therapy applications is loss in gene activity within a few days from gene transfer although all previous steps were successful. In other words, the transferred gene is transiently expressed for 1-4 days and its expression thereafter declines dramatically. This is due (i) to the degradation of the gene in the nucleus; (ii) the dilution of the plasmid during replication of the cells from its inability to replicate; (iii) its inactivation by position effects from chromatin surroundings after its integration into the chromosomal DNA; (iv) the elimination of the therapeutic cells expressing the transgene by the immune system of the organism either because of the antigenicity of the expressed protein or because of the antigenicity of viral proteins, an effect often associated with adenoviral and retroviral gene delivery.
A number of strategies are being pursued to solve these problems. Sustaining the expression of a transgene into somatic cells for, lets say, 6 months would mean than a gene therapy treatment would need to be repeated twice a year, for example to a hemophilia patient or to a patient who has undergone balloon treatment after coronary heart disease and is being treated via arterial gene transfer.
An approach to sustain expression of the transgene is via episomal replication of the plasmid carrying the transgene for long periods of time, maintaining the plasmid in high copy numbers, and in a form replicating in synchrony with the cell cycle; even better a plasmid can be replicated continuously independently of the cell cycle, an approach to find application in the transfection of nondividing cells by plasmids (which to date is a virtue of adenoviruses, AAV, and HIV-1 vectors; see Table 1).
A way to sustain expression of the transgene could be achieved via targeted integration into one or several different chromosomal locations and the insulation of the transgene from neighboring chromatin domains using special classes of DNA sequences able to act as insulators and maintain independent realms of gene activity (such as matrix-attached regions, MARs). In this case flanking of the foreign gene by two MAR sequences is expected to insulate it against position effect variegation and prevent inactivation of the gene at the chromatin level by chromatin condensation or other mechanisms propagated from the neighboring domains at the integration site (Boulikas, 1995b).
Several studies have shown that linearization of plasmids with restriction enzymes favor highly their integration into the host's genome compared with supercoiled, covalently-closed plasmid DNA. Free ends of DNA are known to promote recombination and a number of nuclear proteins including p53, poly(ADP-ribose) polymerase, ligases I and II, Ku antigen, DNA-dependent protein kinase are known to bind to free ends of DNA, whereas other molecules such as helicases and endonucleases are known to function during repair of lesions in DNA inducing the appearance of strand breaks; especially important in this aspect are members of the RAD50-57 family of proteins involved in recombination and in repair of double-strand breaks.
B. Episomal plasmids for gene transfer
Integration or replication of a foreign gene introduced as a plasmid into mammalian cells is a very rare event; plasmid DNA resides transiently in the nucleus as an episomal, extrachromosomal element for short periods of time after transfection of cells in culture (usually up to one or very few days) during which transcription can take place; after that the episomal DNA is degraded and lost permanently from the cells.
Viral origins of replication have been introduced into the same plasmid as the reporter gene and found to increase the persistence of expression. A polyoma virus-based plasmid containing the polyoma virus origin of replication and the T antigen gene, as well as the neoR gene was maintained extrachromosomally in mouse embryonic stem (ES) cells at 10-30 copies per cell for at least 74 cell generations in the presence of G418 (Gassmann et al, 1995).
Prolonged episomal persistence may be an advantage for gene therapy of nondividing cells. A limited number of studies in gene transfer have used plasmids able to replicate episomally. Most of the plasmids used contain viral origins of replication but also the gene of the replication initiator protein that after its expression in the host will interact with the origin of the plasmid to maintain a relatively high copy number of plasmids which will persist for some time. The advantage using episomal replication of plasmids is enormous in somatic human gene therapy as it can sustain expression of a transgene for a few months after a single injection of the plasmid as compared to the loss of expression after about 1-10 days (maximum at day 2) following injection of nonepisomal plasmids (Zhu et al, 1993). Thierry and coworkers (1995) have succeeded in sustaining the expression of the luciferase reporter gene in mice for up to 3 months after a single intravenous injection of a plasmid including the human papovavirus BKV early region and origin of replication, the large tumor antigen (T antigen) as the replication initiator protein, and the late viral capsid proteins in the same construct harboring the luciferase gene; this plasmid was shown to be replicated extrachromosomally for 2 weeks in the lung.
Episomal replication of a hybrid HSV-1/EBV vector was achieved when the latent oriP of EBV and the EBNA-1 cDNA, which encodes for the replication initiator protein of EBV, were included in the vector (Wang and Vos, 1996).
Expression of viral replication initiator proteins (e.g. T antigen) is oncogenic. Of special interest in human gene therapy is to determine human DNA sequences able to sustain the extrachromosomal replication of plasmids into permissive human cells for longer periods. Such DNA sequences known to act as origins of replication, although poorly understood, have been found in human, monkey, and other mammalian genomes and could be used to sustain the replication of the plasmid thus increasing its copy number in the cell and the time of its persistence (see page 122-123).
To this end, a technology has been developed in our laboratory that permits us to isolate human origins of replication (ORIs) and to include selected ORIs together with the cDNA of the replication initiator protein responsible for activating this particular ORI, in plasmids with therapeutic genes (Boulikas et al, in preparation).
C. Considerations of chromatin structure of plasmids during gene delivery
Almost all supercoiled plasmids used in gene transfer, as produced in bacteria, are under negative supercoiling. Immediately after their import into nuclei plasmids are packaged into nucleosomes that absorb and constrain part or most likely all of the negative supercoils. This is true assuming that no cuts on the DNA are introduced during its passage through the cell membrane barrier to cytoplasmic lysosomes before entering nuclei; if DNA is cut the supercoils on the plasmid will be relaxed. Nicked DNA might be repaired and ligated in nuclei by DNA ligases and be subject to the same constrains as chromosomal DNA. Use of linear plasmids is expected to stimulate recombination during repair of double strand breaks (also would increase degradation of the plasmid in the nucleus and loss of the transgene) ultimately resulting in plasmid integration at variable chromosomal loci, determined to some extend by the nature of the free ends of DNA and the short terminal sequence of the DNA at the ends as well as the type of recombinase molecules in the cell type used.
Treatment of cell cultures with sodium butyrate inducing hyperacetylation of core histones would reverse in part the relieving of the negative torsional strain by the wrapping of the plasmid around histone octamers and will provide DNA in a negatively superhelical of underwound form able to sustain transcription of the template (Schlake et al, 1994).
D. Overcoming the influences of chromosomal surroundings at plasmid integration sites
Use of two MARs each flanking the reporter gene on either side is expected to form a minidomain after integration of the foreign gene into a chromosomal site. MARs potentiate the effect of promoters and enhancers when two MAR elements are placed one upstream and the other downstream from control elements but not between them. MARs will (i) shield reporter genes from the influences of chromosomal surroundings that most often cause inactivation of foreign genes. This effect of chromatin structure on neighboring sequences is known as position effect variegation. Indeed about 85% of the chromosomal sites are transcriptionally inactive assuming that 15% of the genomic DNA is transcribed; however, even integration of a foreign gene into an active chromatin locus may not warrantee its transcriptional activation as other parameters, such as proximity of the integration site to the natural promoter and enhancer elements of the active chromatin domain, or orientation of the integrated gene with respect to the active gene in the chromosomal DNA may determine its level of expression. (ii) MARs will maintain a supercoiled DNA topology within the domain thus increasing the negative supercoiling at local promoter and enhancer sites, a prerequisite for efficient transcription (see Boulikas, 1995b).
XIV. Transfer of reporter genes
A. Transfer of the b-galactosidase (lacZ) reporter gene
Before a gene therapy preclinical study or even gene transfer to cells in culture begins it is essential to test the variables and pinpoint the conditions leading to the success of the operation using reporter gene transfer. LacZ, encoding the b-galactosidase (b-Gal) from E. coli is one of the most commonly used reporter genes. A staining procedure for this enzymatic activity can result in the generation of blue color using X-Gal as a substrate leading to the direct visualization of its activity, for example, in thin sections through animal tissues.
Transfer of the reporter b-galactosidase gene to human liver tumors in nude mice was performed by Wang and Vos (1996) using a hybrid HSV-1/EBV vector which replicates episomally when the latent oriP of EBV and the EBNA-1 cDNA were included.
Many mammalian tissues, especially intestine, kidney,
epididymis, and lung contain endogenous b-Gal, a lysosomal enzyme participating biochemically in glycolipid digestion. Weiss et al (1997) were able to detect mammalian b-Gal activity on histochemical preparations of mouse, rat and baboon lung tissue (Figure 16) and also to distinguish between the endogenous and bacterial b-Gal activity in airway epithelial cells in the transgenic Rosa-26 mouse in based upon the differences in pH optima between the mammalian and bacterial enzymes (Figure 17). Time and temperature of exposure to X-Gal could not be used to distinguish between endogenous and exogenous b-Gal activity; thus, exposure of tissue preparation to pH 8.0-8.5, which minimized detection of the endogenous activity allowed unambiguous discrimination and was the method of choice to detect reporter b-Gal activity.

Figure 16. Endogenous mammalian b-Gal activity was detected in minced lung preparations from a variety of species following incubation with X-Gal in PBS. Representative fields from paraffin-embedded sections are shown. Original magnification 400X. Airway epithelium, alveolar macrophages and several unidentified cell types are stained blue and are, therefore, positive for b-Gal activity. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection of b-galactosidase activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene expression and endogenous b-galactosidase activity. Hum Gene Ther 8, 1545-1554. With the kind permission of the authors (Daniel Weiss, Fred Hutchinson Cancer Research Center) and Mary Ann Liebert, Inc.

Figure 17. Endogenous mammalian b-Gal activity was not detected following incubation with X-Gal at pH>7.5 whereas bacterial b-Gal activity was detected at pH 8.0-8.5 in airway epithelial cells in the transgenic Rosa-26 mouse. Original magnification 250X. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection of b-galactosidase activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene expression and endogenous b-galactosidase activity. Hum Gene Ther 8, 1545-1554. With the kind permission of the authors (Daniel Weiss, Fred Hutchinson Cancer Research Center) and Mary Ann Liebert, Inc.
Table 2. Reporter gene transfer in vivo
|
Gene delivered |
Human disease |
Vector |
Method/Goal |
Results |
Reference |
|
CAT and luciferase |
none |
DOTMA: DOPE |
Expression of reporter genes in mouse tissues after a single intravenous injection. |
CMV promoter was most effective; expression in vascular endothelia, extravascular and parenchymal cells present in lung, spleen, and heart; lower expression in all other tissues; persisted for 9 weeks. |
Zhu et al, 1993 |
|
Luciferase/CMV construct and lacZ |
none |
Transfectam (DOGS:DOPE) |
To show effectiveness in gene transfer after intracranial injection of liposome-plasmid complexes into the newborn mouse. |
Transient expression of luciferase in striatal parenchymal cells; lipospermine:DNA charge ratio of 2 or smaller was most effective in vivo. |
Schwartz et al, 1995 |
|
Luciferase/CMV |
none |
Cationic liposomes |
Distribution of luciferase gene expression among tissues and persistence of expression after systemic injection. |
Use of viral origins of replication and T antigen cDNA in vector sustained expression up to 3 months primarily in the lung in mice. |
Thierry et al, 1995 |
|
lacZ and HSV-tk/IL-2 |
glioma |
AAV |
Direct injection of tumors induced from human glioma cells into the brains of nude mice. |
30-40% of the cells along the needle track expressed b-galactosidase; administration of GCV to the HSV-tk/IL-2 treated animals for 6 days, resulted in a 35-fold reduction in the mean volume of tumors compared with controls. |
Okada et al,. 1996 |
|
lacZ and human erythropoietin |
none |
AAV |
Single intramuscular injection into adult BALB/c mice. |
Protein expression was detected in myofibers for at least 32 weeks; dose-dependent secretion of erythropoietin and corresponding increases in red blood cell production in mice persisted for up to 40 weeks. |
Kessler et al, 1996 |
|
lacZ |
Retinal degeneration; retinitis pigmentosa |
AAV |
Subretinal injection of recombinant AAV particles encoding lacZ. |
Successful transduction of all layers of the neuroretina as well as the retinal pigment epithelium; the efficiency of transduction of photoreceptors was significantly higher than that achieved with an equivalent adenoviral vector. |
Ali et al, 1996 |
|
lacZ |
Inherited hearing disorders |
AAV |
To assess the feasibility of introducing genetic material directly into the peripheral auditory system; infusion into the cochlea of guinea pigs. |
Thin sections of cochleae showed intense immunohistochemical reactivity in the spiral limbus, spiral ligament, spiral ganglion cells and the organ of Corti but much weaker staining in the contralateral ear. |
Lalwani et al, 1996 |
|
lacZ |
Parkinson’s disease |
HSV-1 |
Stereotactic injection into the midbrain of adult rats. |
A 6.8-kb fragment of the rat tyrosine hydroxylase promoter supported a 7- to 20-fold increase in reporter gene expression in catecholaminergic tyrosine hydroxylase-expressing neurons in the substantia nigra. |
Song et al, 1997 |
|
lacZ |
Leptomeningeal cancer |
AAV |
To test the feasibility of AAV-mediated gene therapy. |
Successful transduction of medulloblastoma (DAOY) cells in a nude rat model of leptomeningeal disease. |
Rosenfeld et al, 1997 |
|
lacZ |
vascular disorders |
AAV |
To develop gene therapies for vascular disorders by gene transfer into isolated segments of normal and balloon-injured rat carotid arteries. |
Comparable gene transfer into medial and adventitial cells, with significantly higher efficiency of transduction in injured compared with normal vessels. |
Rolling et al, 1997 |
|
human placental alkaline phosphatase (AP) |
lung disease |
AAV |
To assess the ability of AAV vectors to transduce airway cells; AP gene was delivered to one lobe of the rabbit lung using a balloon catheter. |
AP staining was almost exclusively in the epithelial and smooth muscle cells in the bronchus at the region of balloon placement; staining was in ciliated cells but was also in basal cells and airway smooth muscle cells. |
Halbert et al, 1997 |
A phase I study involving six patients with inoperable lung cancer and an endobronchial lesion accessible by bronchoscopy was initiated to evaluate the feasibility, tolerance, and clinical effects using adenoviral delivery of the Escherichia coli lacZ marker gene driven by the RSV promoter; biopsy specimens of the tumor and surrounding mucosa in 5 patients were tested positive for b-galactosidase expression (Tursz et al, 1996).
B. Transfer of the luciferase and green fluorescent protein (GFP) reporter genes
A synthetic polyamino derivative was used by Goldman and coworkers (1997) to transfer the luciferase and b-galactosidase reporter genes in animal models bearing stereotactically implanted human glioma cell xenografts. The luciferase reporter gene was transferred in both newborn and adult rabbit lungs using polyethylenimine (Ferrari et al, 1997).
Thierry and coworkers (1995) have succeeded in sustaining the expression of the luciferase reporter gene in mice for up to three months using episomal vectors (Table 2).
GFP has been used as a reporter molecule for gene expression because it fluoresces green after blue-light excitation. However, many attempts by Hanazono et al (1997) to isolate stable retroviral producer cell clones secreting vectors containing GFP (after transfer of the neoR gene and selection in G418) have failed because stable GFP-clones were undergoing major rearrangements or other mutations which abrogated GFP expression and prevented vector production.
Additional studies using reporter gene transfer are summarized on Table 2.
DIVISION TWO: GENE THERAPY OF CANCER
XV. Cancer immunotherapy and tumor vaccines
A. The molecular basis of cancer immunotherapy
Many human tumors are nonimmunogenic or weakly immunogenic. The immune system, evolved to rid the body of unwanted intruders, could be instructed and reinforced to eliminate cancer cells. Increasing the immunogenicity of tumors by causing local cytokine production or by increase in the expression in MHC antigen can lead to local antitumor effect (Tepper et al, 1989; Fearon et al, 1990). Indeed, immune surveillance is of the major defense mechanisms against cancer; immunosuppressed individuals are more prone to cancer and nude mice, lacking immune response, are exploited in the lab to elicit tumors after injection of tumorigenic cells, a response that, in many cases, cannot be elicited in normal mice.
Cells undergoing malignant transformation are believed to be eliminated from the body by white blood cells including natural killer cells (NK), lymphokine-activated killer cells (LAK), cytotoxic T lymphocytes (CTL), tumor-infiltrating lymphocytes (TIL), and activated macrophages; since established cancers in the human body may escape this potential defense mechanism of immunologic surveillance, cancer patients have been treated with IL-2 to stimulate their cellular immune mechanisms to kill cancer cells; lengthy and complete remissions, however, were at a low rate and complications were encountered by the toxicity caused by the systemic administration of IL-2 (Rosenberg, 1992).
Transfection of the IL-2 gene into human melanoma cells increased cellular immune response (Uchiyama et al, 1993). This and similar approaches have established the foundation of the ex vivo cancer immunotherapy by transfer of autologous (cancer patient’s) cells after transduction in vitro with cytokine genes (see below). The ultimate goal is the activation of tumour-specific T lymphocytes capable of rejecting tumour cells from patients.
B. Cancer immunotherapy with tumor infiltrating lymphocytes (TILs)
Ex vivo approaches in immunotherapy have been aimed at isolating T cells directly from tumors (known as tumor infiltrating lymphocytes or TILs), stimulate TILs to proliferate in cell culture with IL-2 followed by their reintroduction into the blood stream of advanced cancer patients (Rosenberg et al, 1988). The adoptive transfer of TILs was 50-100 times more potent than that of lymphokine-activated killer (LAK) cells isolated from the patient's tumors. Treatment of 20 patients with TILs after their expansion in vitro, plus IL-2, resulted in objective regression of metastatic melanomas in lungs, liver, bone, skin, and subcutaneous sites which lasted for several months (Rosenberg et al, 1988).
TILs were also transfected in vitro with the bacterial neomycin-resistance gene and were reintroduced into patients with advanced cancer in order to follow their persistence in blood circulation with PCR methods (Aebersold et al, 1990). Such “gene marking” clinical protocols using TILs are numbers 1, 3, 9. 13, 57, and 169 in Appendix 1, pages 159-172. Having shown safety in the NeoR-modified TIL protocol, the gene for tumor necrosis factor (TNF) was added to the vector for therapy of malignant melanoma in advanced cancer patients; the first patient began treatment in January 1991. TNF, however, is effective as an anticancer agent in mice at 400 mg/kg body weight, but in humans, TNF is toxic at 8 mg/Kg and so far of no proven therapeutic value at this low concentration (reviewed by Anderson, 1992). In a similar approach, the TNF gene was replaced by the gene of interleukin-2 (IL-2) in order to develop locally high doses of IL-2 at the tumor site by immunization with TIL cells
from the patient producing systemic antitumor immunity (Rosenberg et al, 1992).
TNF-a, (also IL-1b, IFN-g, and vitamin D3) after binding to their transmembrane receptors stimulate the production of the second messager ceramide from sphingomyelin in the plasma membrane by activating sphingomyelinase; this results in a cascade of signal transduction events that result in down regulation of c-myc and induction of apoptosis, to terminal differentiation, or to RB-mediated cell cycle arrest (see apoptosis further below).
IL-2 stimulates the differentiation of precursor lymphocytes into LAK cells and further stimulates LAK cell proliferation; LAK cells are probably produced by activation of NK cells or from activated T cells by IL-2. Administration of IL-2 plus amplified LAK cells into mice models led to marked regression of disseminated cancers and leukemia. LAK cells are able to destroy tumor cells that express only weakly histocompatibility antigens. IL-2, however, has several pleiotropic effects: stimulation of B cell proliferation; activation of HLA class II antigen expression on endothelial cells, TILs, and melanoma cells; and enhanced production and release of TNF-a, and IFN-g (see Cassileth et al, 1995 and the references cited therein).
However, the use of large numbers of adoptively transferred, broadly cytotoxic LAK cells in combination with IL-2 has been effective for only small subsets of cancer patients (reviewed by Wiltrout et al, 1995).
TILs, which could potentially kill tumor cells, are found in many tumors but remain suppressed or anergic; this anergy may arise from the absence of lymphokines which provide signals for TIL cell activation and stimulation to proliferation although ligands may be bound to the variable region of the T cell receptor; indeed, nonimmunogenic tumors are rejected by syngeneic mice upon transfection by IL-2 or IL-4 genes; IL-2 lymphokine production by the tumor cells bypasses T helper function in the generation of an antitumor response rendering the tumor cells immunogenic; nontransfected tumors are not rejected by the animal and grow causing its death (Tepper et al, 1989; Fearon et al, 1990).
Ex vivo gene therapy trials using cytokine gene transfer (see below) circumvent the problem of toxicity of IL-2 administration; for non-gene transfer therapies, white blood cells drawn from patients are fractionated, cultured, stimulated with IL-2 or other cytokines, and reintroduced in much higher numbers into the blood of the patient.
C. Cancer immunotherapy with cytokine genes
The combination of immunotherapy with conventional treatments such as radio- and chemotherapy may be necessary to eradicate minimal residual disease. Advanced therapies involve the transfection of lymphocytes in culture with cytokine genes followed by selection of the successfully transfected cells with a selectable marker such as the bacterial neomycin-resistance gene (Cassileth et al, 1995). Numerous phase I clinical trials employing either syngeneic genetically modified or allogenic tumor vaccines are in progress (see immunotherapy in Appendix 1, page 159-172). The development of tumor cells transduced with cytokine genes and their exploitation as tumor vaccines in patients with cancer is a very promising field (reviewed by Jaffee and Pardoll, 1997).
Cytokine genes used for cancer immunotherapy include those of IL-2, IL-4, IL-7, IL-12, IFNs, GM-CSF, TNF-a in combination with genes encoding co-stimulatory molecules, such as B7-I. The major goal of the use of immunostimulatory cytokines is the activation of tumour-specific T lymphocytes capable of rejecting tumour cells from patients with low tumour burden or to protect patients from a recurrence of the disease. As distant metastasis is the major cause for therapeutic failures in clinical oncology, treatment of patients having a low tumor volume with immunotherapy could protect the patient from recurrence of disease. Treatment of rodent tumor models with little or no intrinsic immunogenicity with this approach resulted in regression of preexisting tumors and cure of the animals from their disease; furthermore, in some instances cured animals had retained immunological memory and resisted a second challenge with the parental tumor cells (reviewed by Gilboa, 1996; Mackensen et al, 1997).
The transduction of the tumor cells of the patient with cytokine genes ex vivo and the development of tumor vaccines depends on the establishment of primary cell culture from the solid tumor. Although malignant melanomas are easy to culture, it is difficult to establish cell lines from most other primary human tumors using convenient methods; primary tumor cultures are being used (i) for the transduction of autologous cells from the cancer patient with cytokine genes to develop cancer vaccines after intradermal implantation to the patient; (ii) for characterization of tumor-specific cytotoxic T lymphocytes in order to identify specific antigens on the human primary culture; (iii) for extensive phenotypic characterization of the tumor in cell culture. The Cre/LoxP system (see recombinases in gene therapy) has been used to facilitate the establishment of primary cell lines from human tumors (Li et al, 1997).
Human gene therapy protocols 3 and 10 (Appendix 1) use immunization of cancer patients with autologous cancer cells transduced with the gene for tumor necrosis factor (TNF).
D. Cancer immunotherapy with the IL-2 gene
Active immunization with pancreatic tumor cells genetically engineered to secrete IL-2 were shown to inhibit pancreatic tumor growth in vivo; this was shown using a poorly immunogenic subcutaneous model of murine ductal pancreatic cancer by implanting tumor Panc02 cells in C57BL/6 mice; whereas 90% of animals vaccinated with irradiated parental Panc02 and subsequently challenged with parental Panc02 cells developed tumors by 48 days only 40% of animals vaccinated with irradiated Panc02 cells engineered to secrete IL-2 and challenged with parental Panc02 cells developed tumors by 48 days (Clary et al, 1997).
According to a RAC-approved clinical protocol the gene for human interleukin-2 (IL-2) was transduced into a cell line established from the neoplastic cells of a patient with malignant melanoma; this procedure established an IL-2-secreting cell line with integration of the IL-2 gene into genomic DNA. The IL-2-secreting cells were irradiated, in a manner sufficient to inactivate 100% of the cells but insufficient to completely inhibit IL-2 synthesis, and administered to 12 patients with metastatic malignant melanoma in a Phase I toxicity study. These cells have the capacity to induce an antimelanoma response as shown in animal studies (Das Gupta et al, 1997).
A significant number of RAC-approved clinical protocols use IL-2 cDNA transfer. These include protocols 11, 16, 19, 20, 46, 48, 50, 61, 71, 102, and 135, in Appendix 1 and protocols 190, 197, 198, 200, 204, 211, 213, 215, and 219 using cationic lipids for gene transfer (Table 4 in Martin and Boulikas, 1998, this volume, pages 203-206).
E. Cancer immunotherapy with the IL-3 gene
IL-3 was found to enhance the development of cytotoxic T lymphocytes; during antitumor response, macrophages could ingest whole tumor cells, cell fragments, or heat shock proteins complexed to antigenic peptides and then process the tumor antigens for presentation; IL-3 stimulated antigen-presenting cells (APCs), which are macrophage-like, within the tumor leading to generation of cytotoxic T lymphocytes (CTLs). This constitutes a plausible pathway for enhancement in tumor rejection by IL-3 stimulation (Pulaski et al, 1996).
IL-3 signaling proceeding either via the JAK-STAT or the Ras-Raf pathways, stimulates a number of genes such as the DUB-1 encoding a deubiquitinating enzyme the overexpression of which leads to G1 arrest (Zhu et al, 1996); deubiquitination might be an additional mechanism to couple extracellular signaling to cell growth. IL-3 signaling leads to stimulation in myeloid cell proliferation.
F. Cancer immunotherapy with the IL-7 gene
Primary cell cultures from 45 patients with malignant melanoma were transfected via electroporation with the gene encoding for human interleukin-7 (IL-7) resulting in the production of biologically active IL-7 without altering the expression of HLA class I and II, ICAM-1, and of a melanoma-associated antigen. Irradiation of the transfected cells with 10,000 cGy, which arrested tumor cell growth in vitro, did not affect the ability of the cells to secrete IL-7 in the culture medium; this approach, which does not use retroviruses, could be applicable in vaccination protocols for melanoma patients (Finke et al, 1997).
Transfer of the IL-7 cDNA for cancer immunotherapy is being used in a human clinical trial (protocol 70, Appendix 1).
G. Cancer immunotherapy with the IL-12 gene
IL-12 gene therapy is one of the more novel and promising approaches in cancer therapy. IL-12 is a heterodimeric cytokine composed of two subunits, p40 and p35, that requires the simultaneous expression of both the p35 and p40 chain genes from the same cell for production of biologically active IL-12. Coordinate expression of the IL-12 p40 and p35 genes in several solid tumor models has been found to induce strong and specific antitumor immune responses. A variety of biological functions have been attributed to IL-12 including the induction of IFN-g and the promotion of predominantly Th1-type immune responses to antigens (Tahara et al, 1996).
The local secretion of IL-12 achieved by gene transduction suppressed tumor growth and promoted the acquisition of specific antitumor immunity in mice. This was shown by intradermal inoculation of mice with NIH3T3 cells transduced with expression plasmids or a retroviral vector expressing the murine IL-12 gene admixed with murine melanoma BL-6 cells; CD4+ and CD8+ T cells, as well as NK cells, were responsible for the observed antitumor effects resulting from IL-12 paracrine secretion. Transduction of tumor cells with B7.1 gene enhanced the antitumor immune response (Tahara et al, 1996).
The antitumor effect of several transgene expression plasmids encoding the cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF was tested using the gene gun-mediated DNA delivery into the epidermis overlying an established intradermal murine tumor; this study showed that IL-12 gene therapy was much more effective than treatment with any other tested cytokine gene for induction of tumor regression as determined from the increased CD8+ T cell-mediated cytolytic activity in the draining lymph nodes of tumor-bearing mice; treated animals were able to eradicate not only the treated but also the untreated solid tumors at distant sites; elevated systemic levels of IFN-g, were found after IL-12 gene therapy. This approach is providing a safer alternative to IL-12 protein therapy for clinical treatment of cancers (Rakhmilevich et al, 1997).
Lieu et al (1997) have evaluated three IL-12 retroviral vector designs for their level of IL-12 expression in leukemia/lymphoma cells; these retroviral vectors were based on the murine stem cell virus (MSCV) which efficiently transduces functional genes into normal hematopoietic cells. MSCVpac-mlL-12 and MIPV-mIL-12 contained an encephalomyocarditis virus internal ribosome entry site for internal translation of bicistronic mRNA transcripts, while MDCVpac-mIL-12 carried an expression cassette in the U3 region of the 3' LTR. The MSCVpac-mIL-12 vector was more efficient and directed robust expression of both p40 and p35 IL-12 genes in several murine tumor cell lines of hematopoietic origin, including a T-cell lymphoma, a B-cell lymphoma, and a plasmacytoma/myeloma.
Adenoviral delivery of the IL-12 gene was effective against breast tumors (Bramson et al, 1996) or metastatic colon carcinoma (Caruso et al, 1996) in animal models: mice bearing breast tumors, injected intratumorally with a single dose of an adenovirus expressing IL-12 showed regressions in greater than 75% of the treated tumors; this effect was accompanied with a maximum expression of IL-12 within the tumor between 24 and 72 hr post-injection which lasted for 9 days and an elevation in IFN-g within the tumor; local production of IL-12 also stimulated IFN-g production in tumor-draining lymph node cells (Bramson et al, 1996). Whereas intratumoral adenoviral transfer of the HSV-tk and the murine IL-2 genes resulted in substantial hepatic tumor regression, induced an effective systemic antitumoral immunity in the host and prolonged the median survival time of the treated animals from 22 to 35 days a recombinant adenovirus expressing the murine IL-12 gene was much more effective: intratumoral administration of the IL-12 vector alone increased significantly survival time of the animals; 25% of the treated animals lived over 70 days (Caruso et al, 1996).
The immunological host response to syngeneic murine mammary carcinoma cell line variants, genetically modified to express B7-1 or secrete GM-CSF and IL-12, was examined by Aruga et al (1997). The mammary adenocarcinoma MT-901 subline was weakly immunogenic by immunization/challenge experiments and induced tumor-specific T-cell responses in lymph nodes draining progressive subcutaneous tumors; however, tumor clones from this cell line expressing B7-1 or secreting GM-CSF exhibited reduced tumorigenicity and resulted in significantly enhanced T-cell reactivity to tumor-draining lymph node (TDLN) cells as compared to wild-type TDLN cells. In contrast, transduction with the IL-12 gene led to complete tumor growth inhibition.
An adenovirus vector, AdIL12-B7-1, encoding the two IL-12 subunits in early region 1 (E1) and the B7-1 gene in E3 of adenovirus under control of the murine CMV promoter was used to treat mice tumors derived from a transgenic mouse mammary adenocarcinoma. A single intratumoral injection with a low dose (2.5 x107 pfu/mouse) mediated complete regression in 70% of treated animals whereas a similar dose of recombinant virus encoding IL-12 or B7-1 alone resulted in only a delay in tumor growth. Coinjection of two different viruses expressing either IL-12 or B7-1 induced complete tumor regression in only 30% of animals treated (Putzer et al, 1997).
Human peripheral blood lymphocytes (HuPBLs), injected s.c. in mixture with human lung tumor cells into severe combined immunodeficient (SCID) mice, engrafted and displayed antitumor cytotoxic activity; this antitumor activity was dependent upon both CD8+ T cells and CD56+ natural killer cells in the donor HuPBLs. IL-12 enhanced the human peripheral blood lymphocyte-mediated tumor suppression; this implies that transfer of the IL-12 gene has a prospect in this type of immunotherapy. This could be significant under the light of studies showing that PBLs isolated from a lung cancer patient also suppressed the growth of the patient's (autologous) tumor when coinjected s.c. with the tumor cells into SCID mice (Iwanuma et al, 1997).
Tumor cell vaccines were transduced with IL-12 or IL-2 genes and the antitumor response induced in mice bearing lung metastases of the BALB/c colon carcinoma C51 were compared by Rodolfo et al (1996). The cells used for transduction with the IL-12 or IL-2 genes were the histologically related, and antigenically cross-reacting C26 tumor cells which were irradiated and injected s.c. Vaccination with C26/IL12 cells cured 40% of mice, while vaccination with C26/IL2 cells reduced the number of metastatic nodules without affecting survival; both cell vaccination regimens showed similar antitumor CTL activation in mice. Both treatments induced antibodies directed against tumor-associated antigens, but only sera from mice treated with C26/IL12 contained antibodies that lysed tumor cells. The better therapeutic efficacy of vaccination with C26/IL12 was found to be associated, among other factors, with an early infiltration of the metastatic lungs by activated T lymphocytes (Rodolfo et al, 1996).
Transfer of the IL-12 cDNA for cancer immunotherapy is being used in human clinical trials (protocols 62, 111, 180, and 183, Appendix 1).
H. Adoptive immunotherapy with GM-CSF
1. Cell culture experiments
The human hematopoietic growth factor, granulocyte-macrophage colony-stimulating factor (GM-CSF), is important in the management and gene therapy of a variety of malignant disorders of the human hematopoietic system. Infection of COS-1 monkey kidney cells with a recombinant AAV vector containing the GM-CSF gene resulted in the release of recombinant GM-CSF protein into the supernatant; the released GM-CSF was able to sustain the active proliferation of the GM-CSF-dependent human megakaryocytic leukemia cell line, M07e, (Luo et al, 1995).
2. Animal studies
The Dunning rat R3327-MatLyLu prostate tumor model (an anaplastic androgen-dependent, nonimmunogenic tumor that metastasizes to the lymph nodes and the lung) has been used for GM-CSF therapy; IL-2- or GM-CSF-secreting human tumor cell preparations (tumor vaccines) were used for the treatment of advanced human prostate cancer in rats. All animals with subcutaneously established tumors were cured; the cancer vaccine induced immunological memory that protected the animals from subsequent tumor challenge; GM-CSF was less effective than IL-2 (Vieweg et al, 1994). Using the Dunning rat prostate carcinoma model, animals with hormone refractory prostate cancer treated with irradiated prostate cancer cells genetically engineered to secrete human GM-CSF showed longer disease-free survival compared to untreated control rats.
To further test the clinical feasibility of the prostate cancer cell vaccine, cancer cells from patients with stage T2 prostate cancer undergoing radical prostatectomy were successfully transduced with MFG-GM-CSF, achieving a significant human GM-CSF secretion in each of 10 consecutive cases (Sanda et al, 1994).
Continuous secretion of GM-CSF and activation of macrophages may contribute to the antitumor effects of a recombinant vaccinia virus expressing the gene for murine GM-CSF injected to solid melanoma tumors twice weekly for 3 weeks; this injection regimen resulted in growth inhibition of the subcutaneous tumor and enhanced the survival of the animals (Ju et al, 1997).
A recent effort has been toward potentiation of T-lymphocyte-mediated antitumor effects. T-lymphocyte response incapacitation in the murine renal cancer model could arise from an impairment of critical nuclear transcription factors. A vaccine-oriented gene therapy approach used T cells and antigen-presenting dendritic cells which were recruited through the use of antigen, chemokines and GM-CSF and further potentiated by fibroblasts expressing IL-2, IL-4, IL-7, or IL-12; the goal of this approach was to optimize MHC class I- and class II-dependent pathways for induction of T-lymphocyte-mediated responses to cancer in animal models (Wiltrout et al, 1995).
Chen et al (1996) found that adenoviral delivery of a combination of HSV-tk, mouse IL-2, and mouse GM-CSF is much more effective for the treatment of metastatic colon carcinoma in the mouse liver than HSV-tk alone or HSV-tk combined only with IL-2; a fraction of the animals developed long-term antitumor immunity and survived for more than 4 months without tumor recurrence in the three gene combination regimen; thus, local expression of GM-CSF in the hepatic tumors and prolonged IL-2 expression were necessary to generate persistent antitumor immunity.
A gene gun device was used to accelerate and introduce gold particles coated with GM-CSF cDNA plasmids into mouse and human tumor cells. Transfected and irradiated murine B16 melanoma cells produced about 100 ng/ml murine GM-CSF/million cells per 24 hr in vitro for at least 10 days. Toward development of a tumor vaccine, irradiated B16 tumor cells expressing murine GM-CSF cDNA were then injected into mice. Subsequent challenge of these mice with nonirradiated, nontransfected B16 tumor cells showed that 58% of the animals were protected from the tumor by the prior vaccine treatment compared to only 2% of control animals inoculated with irradiated B16 cells transfected with the luciferase gene (Mahvi et al, 1996).
Human tumor tissue transfected within 4 hr of surgery produced significant levels of transgenic human GM-CSF protein in vitro. Human GM-CSF was readily detectable in serum and at the injection site following subcutaneous implantation of these transfected tumor cells into nude mice (Mahvi et al, 1996).
The autocrine secretion of GM-CSF by transduced tumor cells was found to serve as an effective immune adjuvant in the host response to a weakly immunogenic murine mammary carcinoma tumor: transfer of activated lymph node cells derived from mice inoculated with GM-CSF-secreting (240 ng/million cells/24 hours) murine mammary carcinoma cells resulted in the prolonged survival of animals with macroscopic metastatic disease; this was not evident utilizing lymph node cells from mice inoculated with wild-type tumor (Aruga et al, 1997).
3. Clinical trials
Autologous cells (sensitized T cells) genetically-modified to secrete GM-CSF have been used for adoptive immunotherapy on humans. GM-CSF has been used for the treatment of advanced melanoma or renal cell cancers (Chang et al, 1996). The steps included retrieval of tumor from the patient for use as a vaccine; the tumor cell line was transduced with a retroviral/GM-CSF vector; cells were reintroduced into the patient (tumor vaccination). Removal of draining lymph nodes after 7-10 days and activation of lymph node cells with a monoclonal antibody directed against CD3 and expansion of the cell population with IL-2 gave anti-CD3+/IL2-activated cells which were exquisitely tumor-specific and mediated the regression of established tumors in animal models (Figure 18).
According to a phase I clinical trial cancer patients are intradermally vaccinated with lethally-irradiated tumor cells that have been transfected by particle-mediated gene transfer with gold particles coated with human GM-CSF plasmid DNA; this is based on preclinical studies showing that vaccination of mice with irradiated, GM-CSF-transfected melanoma cells provided protection from subsequent challenges with non-irradiated, non-transfected tumor cells. Human tumor immunotherapy studies in course use patients' fresh specimens of melanoma or renal carcinoma; cells are dissociated, lethally-irradiated and transfected with GM-CSF plasmid DNA-coated gold particles resulting in the subsequent production of biologically active GM-CSF protein by the patient’s cells. Patient’s cells are used intradermally as a vaccine to elicit anti-tumor immune responses. Surgical excision of the vaccination sites will assess GM-CSF production and infiltration of immune effector cells; patients are being subjected to an intradermal injection in their opposite extremity of 5 million irradiated cryopreserved tumor cells taken from the patient at the time of vaccine preparation to asses immune reactions (DTH testing); if a positive reaction is noted on day 28 the DTH site will be surgically removed (Mahvi et al, 1997).

Figure 18. A clinical protocol for adoptive immunotherapy of advanced melanoma patients. Adapted from Chang et al (1996).
A number of RAC-approved human gene therapy protocols use GM-CSF cDNA transfer. These are protocols 35, 53, 63, 113, 149, 150, 162, and 181 in Appendix 1.
I. Cancer immunotherapy with the IFN-g gene
Solid tumors in nude mice have been successfully eradicated with treatment with tumor cell lines stably transfected with an IFN gene. A number of human tumor cell lines including 293, HeLa, K562, and Eskol (a malignant immunoblastic lymphoma) were infected with a rAAV carrying a synthetic type I interferon gene and the bacterial neomycin-resistant gene and geneticin-resistant cells were selected; when injected into nude mice, 293, K562, and Eskol cells failed to form tumors for a duration of up to 3 months; on the contrary, mice receiving nontransduced cells developed tumors within 7 to 10 days; in addition, treatment of an established Eskol tumor with transduced 293 cells resulted in tumor regression (Zhang et al, 1996).
Three RAC-approved human gene therapy protocols use IFN-g cDNA transfer. These are protocols 36, 54, and
71 in Appendix 1.
J. Immunotherapy with synthetic tumor peptide vaccines
Progress in the identification of tumor-specific antigens, that is proteins expressed at high levels by a specific tumor cell type such as prostate or breast cancer, most of which are surface glycoproteins easily recognizable by the immune system, as well as the deciphering of the mechanisms for enhancing the response of cytotoxic T cell lymphocytes have advanced the potential for developing cancer vaccines.
Cancer immunotherapies based on synthetic tumor peptide vaccines have been developed. Tumor-specific CD8+ cytotoxic T lymphocytes (CTLs) recognize short peptide epitopes presented by MHC class I molecules that are expressed on the surface of cancer cells. Bone marrow-derived dendritic cells, grown in vitro in media containing combinations of GM-CSF + IL-4, when pulsed with synthetic tumor peptides (which are loaded on the surface of the dendritic cells) became potent antigen-presenting cells (APCs) capable of generating a protective antitumor immune response. Injection of these cells into naive mice protected the mice against a subsequent lethal tumor challenge; in addition, treatment of mice bearing C3 sarcoma or 3LL lung carcinoma tumors with the same type of cells resulted in sustained tumor regression in over 80% of the animals (Mayordomo et al, 1995).
One of the obstacles of this method has been the difficulty in obtaining sufficient numbers of APCs; dendritic APCs have been isolated from CD34+ hematopoietic progenitor cells drawn from cord blood and expanded in cell culture in the presence of GM-CSF and TNF-a; TNF-a inhibits the differentiation of dendritic cells into granulocytes. Human peripheral blood mononuclear cells or mouse bone marrow cells depleted of lymphocytes could also yield dendritic cells when cultured in the presence of GM-CSF + IL-4 (Mayordomo et al, 1995).
K. DNA vaccines
Vaccines may be one of the first successful applications of foreign genes into mammalian cells under control of heterologous promoters and enhancers (Felgner and Rhodes, 1991; Thompson, 1992; Gilboa and Smith, 1994). Vaccination with DNA has been shown to be a promising approach for immunization against a variety of infectious diseases (Wang et al, 1993; Michel et al, 1995; Huygen et al, 1996; Kuhober et al, 1996). The method consists in introducing the gene of a viral or bacterial antigen which is uptaken and expressed by the host’s cells to elicit an antigen-specific immune response. DNA coding for an antigen can be directly injected into muscle or skin and stimulate an immune response against the expressed antigen; the gene can either code for surface molecules, which are often used for conventional peptide vaccines, or from internal microbial proteins.
During this approach the antigens are produced intracellularly where they are correctly folded and can be presented to the immune system to stimulate cytotoxic T cells; the method is safe and simple and has shown promising results on animals (reviewed by Moelling, 1997). For example, mice injected intramuscularly with an HIV-1 envelope DNA construct developed anti-HIV envelope immune responses (Wang et al, 1993); intramuscular injection of plasmid DNA expression vectors encoding the three envelope proteins of the hepatitis B virus (HBV) induced humoral responses in C57BL/6 mice specific to several antigenic determinants of the viral envelope (Michel et al, 1995). Immunization of mice with plasmid DNA constructs encoding one of the secreted components of Mycobacterium tuberculosis, antigen 85 gene induced substantial humoral and cell-mediated immune responses (Huygen et al, 1996).
Because immunization of cancer patients with tumor antigen proteins is a very promising approach used extensively in cancer therapy (e.g. Karanikas et al, 1997) many of these approaches could be transferred to the DNA level using the gene encoding the tumor antigen.
As an extension, this method could find application using human tumor antigen genes rather than bacterial/viral antigen genes, that is genes encoding for proteins expressed in tumor but not in normal cells leading to development of tumor vaccines (Graham et al, 1996; Okamoto et al, 1997); this method mimics the infection of the cell in the host by a pathogenic virus resulting in the intracellular processing of the viral proteins and their presentation on the cell surface. Human tumor antigens are, however, weakly immunogenic compared to microbial antigens a problem connected with polymorphism in the major histocompatibility complex proteins of the host and in antigen presentation.
Development of a fusigenic viral liposome vector was made possible using the HVJ (hemagglutinating virus of Japan, a Sendai virus) renowned for its cell fusion ability; plasmid DNA containing the human tumor antigen genes MAGE-1 and MAGE-3 was mixed with HMG-1 nonhistone protein (to increase nuclear import and expression of the plasmid after transfection) and was encapsulated into anionic liposomes (phosphatidylserine, phosphatidylcholine, cholesterol) followed by the addition of inactivated HVJ; intramuscular injection into mice resulted in production of MAGE-1 and -3 IgG antibodies (Okamoto et al, 1997).
XVI. Gene therapy of cancer and candidate genes
A. Mechanisms of carcinogenesis
Whereas for inborn errors of metabolism transfer of a single gene can correct the disorder, cancer is a complex disease involving mutations in a number of proto-oncogenes and tumor suppressor genes as well as an imbalance and disarray in phosphorylation events and regulatory circuits of the cell cycle. As a result of transformation, tumor cells acquire a proliferation advantage compared with normal cells, most of which are quiescent in the adult organism; cancer cells acquire partial independence from regulatory signals from neighboring cells for restricted cell growth. A crucial step in cancer development is the nonelimination of pre-cancer cells by apoptosis (usually a subsequence of a mutation in the p53 gene); such cells acquire a number of unrepaired damage in their DNA, such as strand breaks, which induce chromosomal translocations and result in clonal expansion of this cell population.
Tumor cells are able to survive after DNA damage, and display an increase in mutation rate; cancer cell populations are heterogenous with respect to translocations, loss of heterozygosity, point mutations and transpositions in various genes. Whenever the mutated cell acquires an advantage for rapid growth over other cells in the tumor mass, escaping cell cycle checkpoints, it may replace the original population, a phenomenon known as tumor progression; this may lead to appearance of a more malignant phenotype. As a result, tumor cells are of different genotypes and clones obtained from the same solid tumor may differ in the level of malignancy.
A number of candidate genes, when become mutated or overexpressed, may lead to tumor phenotype: p53, RB, and p21 appear to be the most important. The deregulation of other genes is connected to tumor progression whereas different groups of genes are associated with tumor cell metastasis. These facts make a single gene transfer approach to tumor cell mass to inhibit its growth or change its phenotype from malignant to normal very challenging.
B. Human clinical trials
The genes used for cancer gene therapy in human clinical trials include a number of tumor suppressor genes (p53, RB, BRCA1, E1A), antisense oncogenes (antisense c-fos, c-myc, K-ras), suicide genes (HSV-tk, in combination with ganciclovir, cytosine deaminase in combination with 5-fluorocytosine) which have been very effective in eradicating solid tumors in animals. Also the cytokine genes (IL-2, IL-7, IFN-g, GM-CSF) are being used for the ex vivo treatment of cancer cells isolated from human patients and are able to elicit an immunologic regression especially on immunoresponsive malignancies (melanomas, colorectal carcinomas, renal cell carcinomas) (Culver, 1996). Future directions might be toward use of genes involved in the control of tumor progression and metastasis. Discovery of new genes which are over- or under-expressed during transformation and metastasis is a promising approach for the identification of novel gene targets in cancer gene therapy (Georgiev et al, 1998, this volume).
Diseases amenable to therapy with gene transfer in clinical trials (Appendix 1 and Table 4 in Martin and Boulikas, this volume) include cancer (melanoma, breast, lymphoma, head and neck, ovarian, colon, prostate, brain, chronic myelogenous leukemia, non-small cell lung, lung adenocarcinoma, colorectal, neuroblastoma, glioma, glioblastoma, astrocytoma, and others), AIDS, cystic fibrosis, adenosine deaminase deficiency, cardiovascular diseases (restenosis, familial hypercholesterolemia, peripheral artery disease), Gaucher disease, Hunter syndrome, chronic granulomatous disease, PNP deficiency, a1-antitrypsin deficiency, leukocyte adherence deficiency, partial ornithine transcarbamylase deficiency, Cubital Tunnel syndrome, Canavan disease and rheumatoid arthritis. Several RAC-approved protocols use gene marking rather than gene therapy . An important number of protocols in cancer use ex vivo immunotherapy (Appendix 1, pages 159-172 & 203-206).
XVII. Gene therapy strategies based on p53
A. p53 as a tumor suppressor protein
The p53 has been a fascinating subject in cancer biology since its discovery (Lane and Crawford, 1979; Linzer and Levine, 1979). Originally assigned in the constellation of oncogenes was later shown to exert suppressive effects on cell growth (Finlay et al, 1989); indeed, the mutated p53 has many characteristics of an oncogene (Will and Deppert, 1998, this volume). Mutations in the p53 gene contribute to the emergence of the malignant phenotype (Diller et al., 1990; Baker et al., 1990). Alterations in the p53 tumor suppressor gene appear to be involved, directly or indirectly, in the majority of human malignancies (Vogelstein, 1990). For example, human lung cancer cell lines and specimens showed allelic loss for chromosome regions 3p and 17p (p53 is assigned to 17p13); these specimens displayed homozygous deletions of p53, DNA rearrangements involving the p53 gene, or expression of truncated p53 transcripts suggesting abnormal splicing, initiation, and termination arising from point or other mutations (Takahashi et al, 1989; Nigro et al, 1989).
An interesting approach to unravel the molecular mechanism of action of p53 in restricting cell growth and in inducing apoptosis was the cloning of genes induced by p53 before the onset of apoptosis; this led to the identification of a group of 14 genes (out of 7,202 transcripts examined) which were markedly increased in p53-expressing cells compared with control cells many of which were predicted to encode proteins that could generate oxidative stress or respond to oxidative stress (Polyak et al, 1997). Additional studies in this line have suggested that the induction of the apoptotic pathway by p53 involves (i) transcriptional induction of redox-related genes; (ii) formation of reactive oxygen species; and (iii) the oxidative degradation of mitochondrial components (Polyak et al, 1997).
p53 can inhibit transformation of rat embryo fibroblasts mediated by adenovirus E1A plus activated ras and can also suppress focus formation mediated by myc plus activated ras (Finlay et al, 1989; Eliyahu et al, 1989). Both alleles of p53 need to be mutated or altered for transformation. Introduction of a null mutation by homologous recombination in murine embryonic stem cells gave mice which appeared normal but were susceptible to a variety of neoplasms by 6 months of age (Donehower et al, 1992).
The tumor suppressive activity of p53 seems to involve at least six independent pathways: (i) induction by p53 of the p21/Waf-1/Cip-1 gene which causes growth arrest both via inhibition of cyclin-dependent kinases and via inactivation of PCNA; PCNA is the accessory molecule to DNA polymerases a and d and its absence causes arrest of DNA synthesis at the replication fork; (ii) induction of the death-promoting bax gene by p53 as a mechanism which eliminates oncogenic virus-infected and transformed cells; (iii) by a direct interaction of p53 with origins or replication preventing firing and initiation of DNA replication; (iv) via binding of p53 to a number of important molecules involved in transcription (TATA box-binding protein or TBP, TFIIH); (v) by the role of p53 in DNA repair via its patrolling the genome for small insertion deletion mismatches or free ends of DNA; (vi) p53 is able to attract RPA, an accessory to DNA polymerases a and d as well as TFIIH and RAD51 at the damaged DNA sites; TFIIH, RAD51, and RPA have a demonstrated role in DNA repair (Figure 19). Additional properties of p53 include the induction of Gadd45 involved in the arrest of the cell cycle and induction of Mdm2 which, after exceeding a threshold value in the cell associates with p53 to restrict its regulatory functions; thus, Mdm2 acts as a feedback loop for p53 to moderate its apoptotic and cell cycle restrictive functions (Figure 20).
B. Genes regulated by wild-type p53
Protein p53 appears to be a transcription factor able to recognize specific regulatory regions in a number of genes via its central DNA-binding domain; the DNA sequence-specific binding of wt p53 is regulated by the C-terminal domain of p53 and is activated by a variety of posttranslational modifications (Hupp et al, 1992). p53 is phosphorylated and is constitutively expressed at low levels in most normal tissues (Lane and Crawford, 1979; Linzer and Levine, 1979).
The sequence specificity of p53 has been determined using random synthetic oligonucleotides followed by selection by wtp53 and cloning; these studies revealed the 10 bp motif RRRCGYYY (where R is purine and Y pyrimidine) as the binding and recognition site of wtp53 recognition (El-Deiry et al., 1992); two such 10 bp motifs are required for p53 binding separated by up to 13 bp of random sequence. Since the 10 bp motif is a palindrome, the binding site of p53 comprises 4 copies of the half binding sites GYYY oriented in opposite directions, which suggested that p53 binds either as a dimer to two cruciforms or as a tetramer with each subunit interacting with one half site. The second possibility is favored since
by T lymphocytes thus eliminating the therapeutic effect after reimplantation (e.g. Yang et al, 1994). It was thought that this antigenicity arises from the adenoviral proteins expressed in transduced cells; however, recent data have demonstrated that antigenicity could also arise from the expression of the therapeutic recombinant protein (see above).
Ex vivo approaches have concentrated on correction of mutated genes involved in purine metabolism including adenosine deaminase (ADA) deficiency in severe combined immunodeficiency (SCID) patients, PNP (purine nucleoside phosphorylase) deficiency, and the therapy of Lesh-Nyhan syndrome caused by a deficiency in hypoxanthine-guanine phosphoribosyltransferase (HG-PRT). The first human trial to be approved for ex vivo gene therapy was for the treatment of ADA deficiency which began in 1990 (Karlsson, 1991; Ferrari et al, 1991). Ex vivo studies include transfer of factor IX gene in skin fibroblasts from hemophilia B patients in China followed by subcutaneous injection of the cells to the patient (Wilson et al, 1992; reviewed by Anderson, 1992). From 1990-1992, a clinical trial was initiated using retrovirus mediated transfer of the 1.5 kb ADA gene cDNA to T cells from two children with severe combined immunodeficiency following multiple transplantations of ex vivo modified blood cells; the vector was integrated and the ADA gene was expressed for long periods (Blaese et al, 1995; Bordignon et al, 1995).
A clinical protocol for the therapy of amyotrophic lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells; the membrane is implanted intrathecally to provide human ciliary neurotrophic factor (Deglon et al, 1996; Pochon et al, 1996). An ex vivo clinical trial on humans, homozygous for mutations in the LDL receptor gene, is performed using cultured hepatocytes from the patient which are transduced ex vivo with the LDL receptor gene and transplanted by infusion into the portal vein of the patient (Wilson et al, 1992; Grossman et al, 1994).
Cancer immunotherapy uses transfer of cytokine genes (IL-2, IL-7, IFN-g, GM-CSF) to autologous (cancer patient’s) cells followed by immunization of the patient to elicit activation of tumour-specific T lymphocytes capable of rejecting tumour cells from the patient, especially on immunoresponsive malignancies such as melanomas, colorectal carcinomas, and renal cell carcinomas (Uchiyama et al, 1993; Chang et al, 1996; Finke et al, 1997; Das Gupta et al, 1997; Mahvi et al, 1997).
Table 5. Ex vivo studies on animal models
Gene target |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
ADA |
SCID (severe combined immunodeficiency) |
Retrovirus |
Immunodeficiient mice were injected with peripheral blood lymphocytes from ADA- patients transduced with a retroviral vector for human ADA |
Restoration of immune functions (presence of human immunoglobulin and antigen-specific T cells) |
Ferrari et al, 1991 |
bcl-2 |
prostate cancer |
|
bcl-2 expressing LNCaP human prostate cancer cells are rendered highly resistant to apoptotic stimuli |
LNCaP-bcl-2 cells induced earlier, larger, and hormone-refractory prostate tumors in nude mice |
Rafo et al, 1995 |
Factor IX |
hemophilia B |
|
Injection of transduced primary myoblasts into the muscle |
Factor IX was being synthesized and delivered to the circulation for over 6 months |
Dai et al, 1992 |
Factor IX |
hemophilia B |
retr |
Transplantation of retrovirus-transduced keratinocytes |
Human factor IX was detected in the bloodstream of nude mice in small quantities for one week |
Gerrard et al, 1993, |
Factor IX |
hemophilia B |
retrovirus |
Mouse primary myoblasts were infected with retrovirus expressing the canine factor IX under control of mouse muscle creatine kinase and human CMV promoter; myoblasts were injected into the hindlegs of recipient mice; secreted canine factor IX was monitored in the plasma |
Sustained expression of factor IX for over six months without any apparent adverse effects on the recipient mice; however, the levels of the factor IX protein secreted into the plasma (10 ng/ml for 107 injected cells) were not sufficient to be of therapeutic value; 100 times higher amounts of factor IX were needed |
Dai et al, 1992; Yao et al, 1994 |
Factor VIII |
Hemophilia A |
transferrin |
Transfection of fibroblasts and myoblasts with B-domain-deleted factor VIII gene followed by implantation into mice |
Therapeutic levels of factor VIII in the blood of the animals for 24 hours |
Zatloukal et al, 1994 |
Factor VIII |
Hemophilia A |
Retrovirus |
Mouse primary fibroblasts infected with a recombinant retrovirus containing factor VIII gene deleted at the B domain |
Therapeutic levels of factor VIII in blood of animals for 1 week after surgical implantation into the peritoneal cavity in SCID mice of 15 million cells in the form of neo-organs |
Dwarki et al, 1995 |
Growth hormone (human) |
none |
mice electroporation |
Ex vivo modified C2C12 cells with the hGH gene under control of the inducible UAS promoter and a synthetic hybrid steroid receptor (TAXI), activating transcription from the inducible promoter after treatment with the synthetic nontoxic drug inducer RU486; transplanted in mouse muscle |
This model allows up to 100-fold induction of the hGH gene and can be finely tuned to lower levels of induction |
Delort and Capecchi, 1996 |
Growth hormone (human, hGH) |
general |
retr |
Injection of genetically engineered myoblasts into mouse muscle |
hGH could be detected in serum for 3 months; myoblasts were fused into preexisting multinucleated myofibers that were vascularized and innervated |
Dhawan et al, 1991 |
HSV-tk |
glioma |
Retr |
To directly transfer HSV TK gene and kill transduced proliferating brain tumor cells with ganciclovir without affecting nondividing normal cells |
Murine fibroblasts transduced ex vivo with HSV TK retroviral vectors caused complete regression of gliomas in rat brain after intratumor injection |
Culver et al, 1992 |
HSV-tk |
pancreatic cancer |
retrovirus |
BXPC3 primary human pancreatic adenocarcinoma cells were transduced with retroviral vector carrying the HSV-tk gene driven by the CEA promoter; engrafted subcutaneously into nude mice eliciting pancreatic tumors |
Animals treated with 0.1 mg/Kg ganciclovir exhibited a significant reduction in tumor growth |
DiMaio et al, 1994 |
HSV-tk |
proliferative vitreoretinopathy (PVR) |
retrovirus-transduced rabbit dermal fibroblasts |
Traction retinal detachment results from proliferation of retinal pigment cells in the vitreous cavity of the eye; PVR may ensue after retinal surgery or trauma and can be induced in rabbit models by surgical vitrectomy. |
Significant inhibition of PVR (killing of proliferating cells in the retina) was observed in rabbit PVR models after injection into the vitreous cavity of rabbit dermal fibroblasts transduced in vitro; all eyes received 0.2 mg GCV on the following day and on day 4; |
Kimura et al, 1996 |
IL-1 -receptor antagonist protein gene |
Rheumatoid arthritis (RA) |
Retr |
Synovial cells were surgically removed from joints of animals with experimental arthritis, cultured, transduced with the IL-1 -receptor antagonist protein gene and reimplanted into the respective donors by intraarticular injection |
Improvement in RA symptoms |
Bandara et al, 1993 |
IL-1 receptor antagonist (IL-1Ra) |
Rheumatoid arthritis (RA) |
Retr |
Degradation of cartilage in RA is stimulated by IL-1; to inhibit IL-1; RA synovial fibroblasts transfected with the IL-1Ra gene were coimplanted with normal human cartilage in SCID mice |
IL-1Ra expression protected the cartilage from chondrocyte-mediated degradation. |
Otani et al, 1996; Makarov et al, 1996; Muller-Ladner et al, 1997b |
IL-2; GM-CSF |
prostate cancer |
|
Dunning rat R3327-MatLyLu prostate tumor model (an anplastic androgen-dependent, nonimmunogenic tumor that metastasizes to the lymph nodes and the lung); cytokine (IL-2)-secreting human tumor cell preparations (tumor vaccines) were used for the treatment of advanced human prostate cancer in rats |
All animals with subcutaneously established tumors were cured; the cancer vaccine induced immunological memory that protected the animals from subsequent tumor challenge; GM-CSF was less effective than IL-2. |
Vieweg et al, 1994 |
LDL receptor |
Familial hypercholesterolemia (FH) |
Retr |
Watanabe heritable hyperlipidemic rabbit (deficient in both alleles of LDL receptor gene); establish hepatocyte culture from animal liver; transduce with LDL receptor gene responsible for LDL internalization into hepatocytes to reduce blood serum cholesterol; transplant hepatocytes into the animal |
30-40% decrease in serum cholesterol that persisted for 4 months |
Chowdhury et al, 1991 |
Nerve Growth Factor (NGF) |
Alzheimer's disease |
rat and primate |
Delivery of NGF by ex vivo-modified allogeneic cells surrounded by a semipermeable membrane and implanted intrathecally |
Release of NGF by the implant which is not subject to immunologic rejection due to the membrane |
Kordower et al, 1994 |
XPD (ERCC2) |
xeroderma pigmentosum (XP) |
Retr |
To transduce ex vivo human keratinocytes and produce skin grafts on immunodeficient mice; use it on XP patients as reconstructive surgery to alleviate cancers in UV-exposed areas |
The retroviral vector carrying the XPD gene and neoR under control of SV40 enhancer fully complemented the DNA repair deficiency of primary skin fibroblasts |
Gözükara et al, 1994; Carreau et al, 1995 |
TH (Tyrosine hydroxylase) |
Parkinson's disease (PD) |
Retrovirus |
Rat fibroblasts transduced with tyrosine hydroxylase (TH) produced and released L-dopa to the culture medium; |
When grafted to the striatum of Fischer rats with a prior 6-hydroxydopamine lesion, primary fibroblasts containing the TH transgene survived for 10 weeks, continued to express the transgene, and reduced rotational asymmetry. |
Wolff et al, 1989 |
TH |
Parkinson disease (PD) |
|
Overexpress TH that converts tyrosine to L-DOPA to alleviate degeneration of dopaminergic nigrostriatal neurons (DNN) in PD rat models; unilateral destruction of DNN in animals with 6-hydroxydopamine and administration of apomorphine caused PD rats to turn contralaterally (7 or more rotations/min). |
Implantation of transgenic immortalized fibroblasts and myoblasts intracerebrally improved rotational behavior |
Fischer et al, 1991
|
TH |
Parkinson's disease (PD) |
HSV |
Infection of 6-hydroxydopamine-lesioned rats, used as a model of PD, with a defective herpes simplex virus type 1 vector expressing TH |
Conversion of endogenous striatal cells into L-dopa-producing cells |
During et al, 1994 |
TH |
Parkinson's disease (PD) |
Lipofectin |
To alleviate the symptoms of PD in TH-deficient rats (PD animal models; perform colateral rotations at 15 rounds/min upon administration of apomorphine) |
Primary muscle cells were transduced with TH cDNA under control of CMV promoter; 10 million cells were injected into brains of TH-deficient rats; this resulted in 75% decrease in the number of rotations/min for more than 6 months |
Jiao et al, 1993 |
Table 6. In vivo somatic gene transfer strategies to animal models
Gene target or delivered |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
HSV TK and ganciclovir |
hepatocellular carcinoma |
AAV mice |
To preferentially kill hepatocellular carcinoma cells by the suicadal gene HSV TK (driven by the a-fetal protein (AFP) enhancer and albumin promoter) with ganciclovir |
Selective killing of AFP-positive cells in culture; transgenic mice were established by injection of AAV ITRs, neoR, and HSV TK genes as a linear DNA fragment; HSV TK was expressed predominantly in adult liver. |
Su et al, 1996 |
Prostaglandin G/H synthase |
acute lung injury |
Cat lipid rabbit |
Rabbits intravenously transfected with the PGH synthase gene |
Increased plasma levels of prostacyclin and PGE2; protection of lungs in rabbits against endotoxin-induced inflammation, pulmonary edema, release of thromboxane B2, and pulmonary hypertension |
Conary et al 1994 |
Ornithine transcarbamylase (OTC) |
OTC-deficiency |
Adenovirus |
iv injection of recombinant adenovirus to spf-ash mice (OTC-deficient) |
Correction of enzyme deficiency in OTC-deficient mice for over 1 year. |
Stratford-Perricaudet et al, 1990 |
a1-antitrypsin |
a1-antitrypsin-deficiency in lung |
Adenovirus |
The adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia of cotton rat respiratory pathway |
Both in vitro and in vivo infections have shown production and secretion of a1-antitrypsin by the lung cells for over 1 week |
Rosenfeld et al, 1991 |
a1-antitrypsin |
a1-antitrypsin-deficiency in liver |
Cat lipid mice |
Protect connective tissue from the lytic action of the leukocyte neutrophil elastase; plasmid was encapsulated into negatively-charged liposomes containing phoshpatidylcholine |
Small liposomes were much more effective in delivering the a1-antitrypsin gene to mouse hepatocytes in vivo. |
Aliño et al, 1996 |
a1-antitrypsin (AT, human) |
acute and chronic lung diseases. |
Cat lipid |
Aerosol and intravenous transfection to lungs of rabbits |
Human a1AT mRNA and protein were detected for at least 7 days; immunohistochemical staining showed a1AT protein in the pulmonary endothelium following intravenous administration, in alveolar epithelial cells following aerosol administration, and in the airway epithelium by either route |
Canonico et al, 1994 |
CFTR |
Cystic fibrosis (CF) |
Adenovirus |
To alleviate the symptoms of CF |
Expression of CFTR after intratracheal instillation into lungs of cotton rats; expression between days 2-10 |
Rosenfeld et al, 1992 |
CFTR (cystic fibrosis transmembrane conductance regulator) |
Cystic fibrosis (CF) |
Cat lipid |
To express the normal CFTR gene in lungs of Edinburgh insertional mutant mouse (cf/cf) after delivering CFTR cDNA-liposome complexes into the airways by nebulization. |
Full restoration of cAMP related chloride responses in some animals; human CFTR cDNA expression in the same tissues |
Alton et al, 1993
|
CFTR |
Cystic fibrosis (CF) |
Lipofectin |
To express the human CFTR gene in lungs in CFTR-deficient transgenic mice by tracheal instillation of lipofectin-plasmid |
Successful transfer of the CFTR gene to epithelia and to alveoli deep in the lung leading to correction of the ion conductance defects found in the trachea of transgenic mice |
Hyde et al, 1993.
|
CFTR |
CF |
Lipofectin |
Transduction of airway epithelial cells in normal mice by intratracheal instillation of a plasmid carrying the CFTR gene under control of the Rous sarcoma virus promoter |
Airway epithelial cells were the major target and site of expression of CFTR |
Yoshimura et al, 1992 |
CFTR cDNA (human) |
Cystic fibrosis (CF) |
AAV |
Intratracheal instillation into neonatal New Zealand white rabbits |
Epithelial expression of the human CFTR fusion protein was detected using antisera to both the human CFTR R domain and the amino-terminal epitope at up to 6 weeks after vector inoculation, a time coinciding with the completion of the alveolar phase of lagomorph lung development |
Rubenstein et al, 1997 |
p53 |
lung cancer |
retrovirus |
Lung tumors were elicited in nu/nu mice after intratracheal inoculation with human lung cancer H226Br cells whose p53 gene has a homozygous mutation at codon 254
|
Intratracheal injection of a recombinant retrovirus containing the wt p53 gene was shown to inhibit the growth of the tumor |
Fujiwara et al, 1994 |
MHC class I HLA-B7 heavy chain gene plus b2-microglobulin |
|
Cat lipid:DNA 1:5 mice |
To give a complete Class I molecule with heavy and light chains; MHC class I HLA-B7 heavy chain gene has an internal ribosome entry site; the b2-microglobulin was driven by RSV promoter |
Experiments in mice showed rapid (1 day) destruction of the plasmid in tissues; femtogram amounts only in muscle at 6 months postinjection |
Lew et al, 1995 |
CCK (cholecystokinin) |
congenital audiogenic epileptic seizures (AS) |
Lipofectin (DOTMA:DOPE) |
To suppress audiogenic epileptic seizures by cholecystokinin octapeptide (CCK-8) injected intracerebroventricularly (i.c.v.) |
AS in rats was markedly reduced between day 3 and 4. |
Zhang et al, 1992 |
hirudin |
restenosis; arterial injury |
adenovirus |
Virus-injured rat carotid arteries; hirudin (from medicinal leech) is a potent protein inhibitor of thrombin; thrombin converts fibrinogen to fibrin and also stimulates smooth muscle cell proliferation during neointima formation in the arterial walls |
35% reduction in neointima formation in hirudin cDNA-transduced arterial wall cells in vivo |
Rade et al, 1996 |
HSV-tk |
arterial injury; restenosis |
Adenovirus |
To kill preferentially the smooth muscle cells and reduce neointima formation in the arterial wall |
47% reduction in I/M area ratio following local delivery of HSV-tk and systemic ganciclovir therapy |
Ohno et al, 1994; Guzman et al, 1994 |
RB |
atherosclerosis, restenosis, arterial injury |
Adenovirus |
To inhibit vascular smooth muscle cell (VSMC) proliferation after arterial injury |
42% reduction in I/M area ratio |
Chang et al, 1995a |
p21 |
atherosclerosis, restenosis, arterial injury |
Adenovirus |
To inhibit vascular smooth muscle cell (VSMC) proliferation after arterial injury; p21 protein functions both by inhibiting cyclin dependent kinases (CDKs) required for the initiation of S phase and by binding to and inhibiting PCNA |
Over-expression of human p21 inhibited growth factor-stimulated VSMC proliferation and neointima formation in the rat carotid artery model of balloon angioplasty in vitro by arresting VSMCs in the G1 phase of the cell cycle |
Chang et al, 1995b |
ras |
arterial injury |
|
Transfer of ras transdominant negative mutants to rats in which the common carotid artery was subjected to balloon injury |
Reduced neointimal formation |
Indolfi et al, 1995 |
TGF-b |
arterial injury |
|
TGF-b accelerates wound healing and inhibits epithelial and smooth cell proliferation; loss of functional TGF-b receptors in cancer cells |
Inhibition in epithelial and smooth cell proliferation |
Grainger et al, 1995 |
TGF-b1 |
Rheumatoid arthritis (RA) |
Retr |
Mice with induced arthritis |
Effective in lowering inflammation of joints with already established arthritis and inhibiting the spreading of the disease to other joints in mice
|
Chernajovsky et al, 1997 |
Gene target or delivered |
Human disease
|
Method |
Goal/rationale |
Results |
Reference |
LDL receptor |
Familial hypercholesterolemia (FH) |
Adeno |
Infusion of adenovirus human LDL-R cDNA into the portal vein of rabbits deficient in LDL receptor |
Human LDL receptor protein was produced in the majority of hepatocytes that exceeded the levels found in human liver by at least 10-fold |
Kozarsky et al, 1994 |
Very low density lipoprotein receptor (VLDL-R) |
Familial hypercholesterolemia (FH) |
Adeno |
LDL-R knockout mice |
A single intravenous injection resulted in reduction in total cholesterol by approximately 50% at days 4 and 9; marked reduction in the intermediate density lipoprotein/low density lipoprotein (IDL/LDL) |
Kobayashi et al, 1996; Kozarsky et al, 1996 |
HSV TK+ganciclovir (GCV) |
Gliomas |
Retr |
Treatment of rats with cerebral glioma; intratumoral stereotaxic injection of murine fibroblasts (G418-selected) producing a retroviral vector with the HSV TK gene |
Tretament with GCV 5 days postinjection resulted in complete regression of gliomas |
Culver et al, 1992 |
HSV TK plus ganciclovir |
prostate cancer |
Adenovirus mouse |
Ganciclovir is converted by HSV TK into its triphosphate form which is then incorporated into the DNA of replicating mammalian cells leading to inhibition in DNA replication and cell death; it is only viral TK, not the mammalian enzyme, that can use efficiently phosphorylated ganciclovir as a substrate |
Subcutaneous tumors induced by injection of RM-1 (mouse prostate cancer) cells followed by injection of HSV TK and treatment with ganciclovir for 6 days showed reduction in tumor volume (16% of control) and higher apoptotic index in tumor cells |
Eastham et al, 1996 |
HSV TK plus ganciclovir |
adenocarcinoma |
|
Carcinoembryonic antigen-producing human lung cancer cells |
Cell type-specific expression of herpes simplex virus thymidine kinase gene |
Osaki et al, 1994 |
TH |
PD |
Cat lipos rat |
Overexpress TH to alleviate degeneration of dopaminergic nigrostriatal neurons (DNN) in PD rat models |
Direct injection of lipofectin-TH expression plasmid on nigra-lesioned side generated L-DOPA locally and decreased contralateral rotations. |
Cao et al, 1995 |
rat glial cell line-derived neurotrophic factor (rGDNF), |
PD |
AAV |
To protect nigral dopaminergic neurons in the progressive Sauer and Oertel 6-hydroxydopamine (6-OHDA) lesion model of Parkinson's disease (back-labeled fluorogold-positive neurons in the substantia nigra) |
94% cell protection; 85% of tyrosine hydroxylase-positive cells |
Mandel et al, 1997 |
|
|
|
|
|
|
Factor IX |
Hemophilia B |
Adenovirus mice |
Correction of FIX defect by injection of recombinant adenovirus hosting the canine FIX gene into hind leg muscle of mice |
Establishment of factor IX levels in the blood in nude mice for 300 days; only for 10 days in normal mice; transduced cells were removed by cell-mediated as well as humoral immune responses; cyclophosphamide or cyclosporin A immunosuppression maintained FIX protein for 5 months |
Dai et al, 1995 |
Factor IX |
Hemophilia B |
Adenovirus mice in vivo |
Correction of the factor IX gene |
Therapeutic plasma levels of factor IX in mice |
Smith et al, 1993 |
Factor IX |
Hemophilia B |
Retrovirus dogs in vivo |
Expression of factor IX gene in liver in hemophilia B dogs |
1% of hepatocytes were transduced with a retroviral vector carrying the canine factor IX gene injected into the portal vein (2/3 hepatectomy was required); low therapeutic levels of factor IX |
Kay et al, 1993 |
Factor IX |
Hemophilia B |
Adenovirus dogs in vivo |
Establishment of the blood serum factor IX levels in hemophilic B dogs by infection with recombinant adenovirus vectors delivering the Factor IX gene and treatment with cyclosporin A |
Treatment with cyclosporin A suppressed T cell activation; T cells attack the adenovirus-transduced cells eliminating them from the body; Cycl A tretment led to prolonged Factor IX levels in the blood of hemophilic dogs |
Kay et al, 1994; Fang et al, 1995 |
Factor IX |
Hemophilia B |
AAV |
|
Successful transduction of the mouse liver in vivo after a single administration; persistent, curative concentrations of functional human factor IX can be achieved
|
Snyder et al, 1997 |
Gene target or delivered |
Human disease
|
Method |
Goal/rationale |
Results |
Reference |
Factor IX |
Hemophilia B |
AAV |
Intramuscular injection into hindlimb muscles of C57BL/6 mice and Rag 1 mice |
Presence of hF.IX protein by immunofluorescence staining of muscles harvested 3 months after injection in both strains of mice; no plasma FIX in immunocompetent mice; Rag 1 mice which lack functional B and T cells, displayed therapeutic levels (200-350 ng/ml) of F. IX in the plasma in addition to F.IX in muscle cells |
Herzog et al, 1997 |
Factor X |
Hemophilia B |
Retr |
Delivery to rat hepatocytes in vivo during liver regeneration; under control of a1-antitrypsin promoter |
10% to 43% of normal human factor X levels in 4 rats; expression remained stable for more than 10 months in two rats |
Le et al, 1997 |
p53 |
breast carcinoma MDA-MB-435 cells |
DOTMA:DOPE |
Nude mice inoculated with breast carcinoma cells (have mutated p53) |
Iv injection of p53 gene under control of b-actin promoter and intron every 10-12 days resulted in more than 60% reduction in tumor volume |
Lesoon-Wood et al, 1995 |
Cdc2 kinase and PCNA |
Restenosis |
liposome-Sendai virus |
Delivery to rat carotids after balloon injury; inhibition of Cdc2 kinase and PCNA with antisense oligonucleotides using PS:PC:Chol liposomes |
Whereas antisense cdc2 kinase or PCNA alone failed to have an effect, combination of the two antisense oligos significantly reduced neointima formation and smooth muscle cell proliferation after balloon injury |
Morishita et al, 1993 |
vascular endothelial growth factor (VEGF) |
restenosis |
naked plasmid |
VEGF promotes endothelial cell proliferation to accelerate re-endothelialization of the artery reducing intimal thickening |
VEGF gene expression using ELISA or RT-PCR was detected for 3-14 days after a single transfer using a hydrogel/polymer-coated ballon angioplasty catheter to induce simultaneous injury and delivery of plasmid to the femoral artery in rabbits. |
Isner et al, 1996 |
Kallikrein |
hypertension |
naked plasmid |
Tissue kallikrein is a serine proteinase cleaving the kininogen to produce the vasoactive kinin peptide; kinin causes smooth muscle contraction and relaxation, increase in vascular permeability, and vasodilatation |
Significant reduction in blood pressure in spontaneously hypersensitive rats after a single delivery of naked DNA to portal vein which lasted for 5-6 weeks. |
Chao et al, 1996 |
Kallikrein |
hypertension |
Adeno |
|
Sustained delay in the increase in blood pressure from day 2 to day 41 post injection (iv) into spontaneously hypertensive rats; human tissue kallikrein mRNA was detected in the liver, kidney, spleen, adrenal gland, and aorta. |
Jin et al, 1997 |
Tissue kallikrein-binding protein (HKBP) or kallistatin |
hypertension |
Adeno |
Kallistatin, a serine proteinase inhibitor, may function as a vasodilator in vivo |
Delivery of the human kallistatin cDNA/CMV by portal vein injection resulted in a significant reduction of blood pressure of hypertensive rats for 4 weeks. |
Chen et al, 1997 |
Human endothelial NO synthase (eNOS) gene |
hypertension |
|
Blood pressure is controled by the endothelium-derived nitric oxide (NO) in peripheral vessels |
Significant reduction of systemic blood pressure for 5 to 6 weeks. |
Lin et al, 1997 |
Antisense oligonucleotides to AT1-receptor mRNA and to angiotensinogen mRNA |
hypertension |
Liposomes |
Angiotensinogen, produces angiotensin I in the liver (component of the renin-angiotensin system); mutations in the angiotensinogen (AT) gene are associated with hypertension |
Antisense oligonucleotides delivered to rat liver via the portal vein diminished the expression of hepatic angiotensinogen mRNA and reduced blood pressure. |
Tomita et al, 1995; Phillips, 1997; Phillips et al, 1997 |
Endothelial basic FGF (bFGF) |
hypertension |
|
Subphysiological amounts in blood vessels of spontaneously hypertensive rats |
Restored the physiological levels levels of bFGF in the vascular wall and corrected hypertension |
Cuevas et al, 1996 |
Atrial natriuretic peptide (ANP) gene |
hypertension |
|
Chronic infusion of ANP causes natriuresis, diuresis, and hypotension |
Significant reduction of systemic blood pressure in young hypertensive rats (4 weeks old); the effect continued for 7 weeks. |
Lin et al, 1995 |
IL-2 |
prostate cancer |
liposomes |
Direct transfer of the IL-2 gene under control of the CMV promoter with or without the AAV inverted terminal repeats |
Plasmid DNA containing the AAV inverted terminal repeats showed 3-10 fold higher levels of gene transfer and IL-2 expression compared with constructs lacking the AAV sequences. |
Vieweg et al, 1995 |
mouse leptin cDNA |
obesity |
Adeno |
ob/ob mouse (which is genetically deficient in leptin and exhibits both an obese and a mild non-insulin-dependent diabetic phenotype) |
Dramatic reductions in both food intake and body weight, as well as in normalization of serum insulin levels and glucose tolerance |
Muzzin et al, 1996 |
rat leptin cDNA/CMV |
obesity |
Adeno |
Wistar rats infused with 8 ng/ml adeno/leptin cDNA for 28 days |
Animals became hyperleptinemic; 30-50% reduction in food intake; gained only 22 g over the experimental period versus 115-132 gained by control animals |
Chen et al, 1996 |
VEGF165 |
cancer (vascularization) |
calcium phosphate |
Expression of VEGF165 in rat C6 glioma cells and subcutaneous injection of the transduced cells in athymic mice. |
Tumors from cells expressing VEGF grew slower than tumors developed from nontransduced C6 cells, were highly vascularized, and contained varying degrees of necrosis and eosinophilic infiltrate |
Saleh, 1996 |
cGMP phosphodiesterase-b (PDE-b) gene |
retinal degeneration |
AAV |
To treat retinal degeneration due to recessive mutation in the endogenous gene |
Intraocular injection of AAV-PDE-b cDNA increased retinal expression of immunoreactive PDE protein; treated eyes showed increased numbers of photoreceptors and a two-fold increase in sensitivity to light |
Jomary et al, 1997 |
XXIX. Gene therapy of HIV
A. Mechanism of HIV-1 entry into T cells and macrophages
Targets of human immunodeficiency virus (HIV) are helper T cells and macrophages; macrophage-tropic HIV-1 isolates represent the most prevalent phenotype isolated from individuals shortly after seroconversion during the asymptomatic period of the disease; tropism is determined by specific sequences in the third variable loop (V3 domain) of gp120 coat protein of HIV-1. The CD4 receptor on both macrophages and T cells is the primary receptor mediating HIV-1 entry into the cell; however, HIV-1 was unable to infect CD4+ T cells of mice engineered to express human CD4 (reviewed by D’Souza and Harden, 1996). Thus, a second chemokine receptor was thought to be necessary for HIV entry into immortalized T cell lines.
The second receptor for entry of HIV-1 into T cells and macrophages is CCR-5, a b-chemokine receptor; CCR-5 is a seven transmembrane-domain glycoprotein of the chemokine superfamily of receptors related to the receptor of IL-8 (G protein-coupled proteins that transduce signals from the cell surface to the interior of cells). The b-chemokines RANTES, MIP-1a, and MIP-1b inhibited replication of M-tropic isolates of HIV-1 and were found to be major HIV-suppressive factors produced by CD8+ T cells. The V3 loop of gp120 determines interaction with the chemokine receptor. CD4, in addition to providing a docking surface for the gp120 glycoprotein of HIV-1 promotes exposure of the V3 domain on gp120 that can interact with the chemokine receptor CCR-5 (Scarlatti et al, 1997; reviewed by D’Souza and Harden, 1996).
A small number of individuals (1% in populations of European descent but much lower in non-Caucasian populations) remain uninfected despite multiple high risk exposures; such individuals have a homozygous defect in the CCR-5 receptor gene which consists of a 32-bp deletion in the region encoding the second extracellular loop of the receptor; the defective protein is not detected at the cell surface; this defect prevents the proper interaction and entry of HIV-1 into their T cells and macrophages (Liu et al, 1996). This defect precludes infection from HIV-1 from all routes. The disease progresses much slower in heterozygotes for the 32-bp deletion (18% in populations of European descent) who are not protected from HIV-1 infections. This finding offers the hope of reconstituting the immune system of HIV-infected individuals with CD34+ stem cells from fetal cord blood or stem cells and lymphoid tissue from individuals who carry the homozygous deletion in the CCR-5 gene, an approach to deal with the immune rejection problems in patients with heart and kidney transplants.
The identification of chemokine receptors and their role in HIV-1 infections has closed a major gap in AIDS research; transgenic animals can now be produced expressing both human CD4 and chemokine receptors to evaluate the efficacy of AIDS therapeutics and testing vaccines; new prophylactic or therapeutic vaccines can be designed by immunization with portions or the entirety of CCR-5 and/or gp120 to generate appropriate antibodies (D’Souza and Harden, 1996). Inactivation of the CCR-5 co-receptor to mimic the natural resistance of the CCR-5-defective individuals, in cultured lymphocytes, rendered them viable and resistant to macrophage-tropic HIV-1 infection (Yang et at, 1997).
B. Therapeutic strategies against HIV
A number of therapy strategies emerged soon after identification of HIV as the etiologic agent of AIDS. Virtually every stage in the viral life cycle and every viral gene product is a potential target. Albeit major efforts for the combat of HIV have focused on the development of antiviral drugs and preventive vaccines, a number of studies have been aimed at eliminating HIV with gene therapy. The intracellular immunization approach (Baltimore, 1988) has prompted the advent of molecular tactics for inhibiting replication and infection of HIV (Trono et al, 1989; Malim et al, 1989). Four main targets have been defined in HIV therapeutics: (i) viral RNAs using ribozymes and antisense RNAs; (ii) viral proteins using RNA decoys, trans-dominant viral proteins, intracellular single-chain antibodies, and soluble CD4; (iii) infected cells aimed at eliminating those with transfer and expression of suicide genes; and (iv) the immune system by in vivo immunization (see Corbeau et al, 1996). Such gene therapeutic approaches can be combined with potent antiretroviral drugs especially the potent reverse transcriptase and protease inhibitors (Junker et al, 1997).
The elucidation of the chemokine receptor mechanisms for entry of HIV-1 into T cells and macrophages provides new tactics for intervention at the level of interaction of gp120 with CCR-5. Inactivation of the CCR-5 gene might be achieved (i) with triplex oligonucleotide technologies once critical transcription factor binding sites in the regulatory region of the gene have been determined; (ii) with saturation of the blood of infected individuals with ligands, selected from peptide libraries, that block the extracellular domains of the CCR-5 receptor and preclude interaction with gp120; (iii) with antagonists of RANTES (see above) that lack chemotactic activity but can block HIV infections (Arenzana-Seisdedos et al, 1996).
Specificity for the ablation of HIV Tat-expressing cells has been achieved through the use of the promoter element from the long terminal repeat (LTR) of HIV (Venkatesh et al, 1990; Caruso et al, 1992).
C. Gene therapy against HIV in cell culture
Strategies for HIV gene therapy include the inactivation of the CCR-5 coreceptor which is accomplished by targeting a modified CC-chemokine to the endoplasmic reticulum to block the surface expression of newly synthesized CCR-5 (Yang et al, 1997). A different gene therapy strategy proposed is targeting Tat, an early regulatory protein that is critical for viral gene expression and replication and which transactivates the LTR of HIV-1 via its binding to the transactivation response element (TAR); Tat also superactivates the HIV-1 promoter via activation of NF-kB in a pathway involving protein kinase C and TNF-a; combinations of the NF-kB inhibitors, pentoxifylline and Go-6976, with a stably expressed anti-Tat single-chain intracellular antibody suppressed HIV-1 replication and LTR-driven gene expression (Mhashilkar et al, 1997). Production of recombinant retrovirus containing the HSV-tk gene coupled to the HIV-2 promoter and Tat responsive region (TAR) has been used on human and mouse cells in culture for the specific elimination of HIV Tat-expressing cells; since the HIV-2 promoter can sustain a considerable level of basal expression in the absence of its activator, Tat, a number of modifications were made to the HIV-2 promoter in order to minimize toxicity to non-infected cells.
Retroviruses export unspliced, intron-containing RNA to the cytoplasm of infected cells despite the fact that intron-containing cellular RNAs cannot be exported; this export pathway is a critical step in the HIV-1 life-cycle. In HIV-1 this is accomplished through an interaction between the viral regulatory Rev protein and the Rev response element (RRE) RNA. In the absence of Rev, these intron-containing HIV-1 RNAs are retained in the nucleus. The nuclear export sequence (NES) LQLPPLERLTL has been identified on Rev that is responsible for its export to the cytoplasm (see Boulikas, 1998, this volume for more details). Targeting of Rev has provided a framework for novel interventions to reduce virus production in the infected host. Because disruption of either Rev or the RRE will completely inhibit HIV-1 replication, an anti-HIV-1 intracellular immunization strategy was developed based on RRE region-specific hammerhead ribozymes and on the intracellular expression of an anti-HIV-1 Rev single chain variable fragment (Sfv), which specifically targets the Rev activation domain. This combination resulted in a potent inhibition of HIV-1 replication in cell culture that holds promise as a future therapeutic regimen (Duan et al, 1997). To disable Rev function, primary T cells or macrophages were transduced with a recombinant AAV carrying an anti-Rev single-chain immunoglobulin (SFv) gene or an RRE decoy gene or with combinations of the two genes to disrupt the interaction between Rev and the RRE; when the transfected cells were then challenged by either clinical or laboratory HIV-1 isolates, this genetic antiviral strategy effectively inhibited infection (Inouye et al, 1997).
A synergic effect of anti-Tat and anti-Rev molecules was found when the RRE sequence was cloned 3' to a tat transdominant negative mutant (tat22/37) gene; for this strategy Jurkat cells were transduced with the recombinant retroviruses containing the tat22/37 gene and an RRE decoy in different positions or the tat22/37 and the RevM10 transdominant negative mutant genes to produce monoclonal and polyclonal cultures expressing the integrated genes; none of these recombinant constructs inhibited virus replication at a high multiplicity of infection (MOI) and combination of tat and rev mutants was ineffective in inhibiting HIV-1 replication at both low and high MOIs; however, at a low MOI, two cell clones containing tat22/37 and the RRE decoy in 3' position showed a long lasting protection against virus replication and in two cell clones, expressing the RevM10 mutant alone, the HIV-1 replication was efficiently blocked (Caputo et al, 1997).
IL-16 is secreted by activated CD8+ T lymphocytes and acts on CD4+ T lymphocytes, monocytes and eosinophils. Recently, the C-terminal 130-amino acid portion of IL-16 was shown to suppress HIV-1 replication in vitro. HIV replication was inhibited by as much as 99% in HIV-1-susceptible CD4+ Jurkat cells following transfection and expression of the C-terminal 130-amino acid portion of IL-16; the mechanism of HIV-1 inhibition by IL-16 was not at the level of viral entry or reverse transcription, but at the expression of mRNA (Zhou et al, 1997).
The in vitro antiviral efficacy of two gene therapy strategies (trans-dominant RevM10 and Gag antisense RNA) were tested in combination with the clinically relevant reverse transcriptase inhibitors AZT and ddC or the protease inhibitor indinavir by Junker et al (1997). The combination of RevM10 or Gag antisense RNA with antiviral drugs inhibited HIV-1 replication 10-fold more effectively than the single antiviral drug regimen alone in retrovirally transduced human T cell lines after inoculation with high doses of HIV-1HXB3 in the presence or absence of inhibitors. The level of anti-HIV-1 activity of the psi-gag antisense sequence correlated with the length of the antisense transcript and maximal anti-HIV efficacy was observed with complementary sequence more than 1,000 nucleotides long, whereas transcripts less than 400 nucleotides long failed to inhibit HIV-1 replication in a T-cell line and in primary peripheral blood lymphocytes (Veres et al, 1996).
The HSV-1 and HSV-2 virion host shutoff gene (vhs), each of which encodes a protein that accelerates the degradation of mRNA molecules leading to inhibition of protein synthesis, was used as a suicide gene for HIV gene therapy to inhibit replication of HIV; an infectious HIV proviral clone was cotransfected into HeLa cells together with the vhs gene under control of the CMV IE promoter; HSV-1 vhs gene driven by the HIV LTR inhibited HIV replication more than 44,000-fold in comparison to a mutant vhs gene (Hamouda et al, 1997).
The specificity of the Vpr protein for the HIV-1 virus particle was exploited to develop an anti-HIV strategy targeting the events associated with virus maturation; nine cleavage sites of the Gag and Gag-Pol precursors were added to the C terminus of Vpr and the chimeric Vpr genes were introduced into HIV-1 proviral DNA to assess their effect on virus infectivity; the chimeric Vpr containing the cleavage sequences from the junction of p24 and p2 completely abolished virus infectivity (Serio et al, 1997).
D. Gene therapeutic strategies for AIDS
A gene therapy strategy to combat acquired immunodeficiency syndrome (AIDS) in individuals already infected with HIV-1 has been directed toward GM-CSF mobilized peripheral blood CD34+ cells isolated from HIV-1-infected individuals and transduced with retroviral vectors containing three different anti-HIV-1-genes: (i) the Rev binding domain of the RRE (RRE decoy) carrying also the NeoR gene, (ii) a double hammerhead ribozyme vector targeted to cleave the tat and rev transcripts (L-TR/TAT-neo), and (iii) the RevM10 transdominant negative mutant gene. After selection with G418, transduced cultures displayed up to 1,000-fold inhibition of HIV-1 replication following challenge with HIV-1 (Bauer et al, 1997).
A safe strategy to gene therapy of AIDS aimed at reducing the virus load in HIV-1-infected individuals was developed by Nakaya et al (1997). The Rev protein shifts RNA synthesis to viral transcripts by binding to the RRE within the env gene. Anti-Rev chimeric RNA-DNA oligonucleotides, consisting of 29 or 31 nucleotides, were designed to inhibit the Rev regulatory function and as decoys on HIV-1 replication; anti-Rev oligonucleotides containing an RNA "bubble" structure of 13 oligonucleotides (that bound to Rev with high affinity) were found to reduce more than 90% of the HIV-1 production from infected human T-cell lines and from healthy donor-derived peripheral blood mononuclear cells; control oligonucleotides without the bubble structure, that bound to Rev with considerably less affinity, did not reduce HIV-1 production (Nakaya et al, 1997).
E. Gene therapy of HIV with ribozymes
Antisense, ribozyme, or RNA aptamers, must be efficiently transcribed, stabilized against rapid degradation, folded correctly, and directed to the part of the cell where they can be most effective. Among (i) antisense RNA, (ii) hairpin and hammerhead ribozymes, and (iii) RNA ligands (aptamers) for Tat and Rev RNA binding proteins, Rev-binding RNAs but not the others, efficiently blocked HIV-1 gene expression when tested in expression cassettes based on the human tRNA(met) and U6 snRNA promoters. In situ localization of both tRNA and U6 promoter transcripts revealed primarily punctate nuclear patterns (Good et al, 1997).
Isolation of an RNA aptamer that can bind with high affinity to Tat protein, including two TAR-like RNA motifs for higher-affinity binding to Tat peptides provided a novel therapeutic strategy against HIV (Yamamoto et al, 1998, this volume).
A hairpin ribozyme specific for simian immuno-deficiency virus (SIV) and HIV-2 was used to inhibit viral replication in T lymphocytes derived from transduced CD34+ progenitor cells. Retroviral transduction of rhesus macaque CD34+ progenitor cells with the SIV-specific ribozyme “gene” and the selectable marker neomycin phosphotransferase (NeoR) gene, followed by expansion and selection with the neomycin analog G418, rendered CD4+ T cells (derived from the transduced CD34+ hematopoietic cells) highly resistant to challenge with SIV; CD4+ T cells exhibited up to a 500-fold decrease in SIV replication, even after high multiplicities of infection (Rosenzweig et al, 1997).
Monomeric (targeting one site) and multimeric (targeting nine highly conserved sites) hammerhead ribozyme genes both directed against the HIV-1 envelope (Env) mRNA were stably expressed in a human CD4+ T lymphocyte cell line; whereas the monomeric ribozyme caused a delay in HIV-1 replication, the multimeric ribozyme caused complete inhibition in HIV-1 replication for up to 60 days after infection (Ramezani et al, 1997).
A multitarget ribozyme of an unusually large size (3.7 kb) had a notable antiviral potential which may lead to a gene therapy approach; this ribozyme, directed against multiple sites within the gp120 coding region of HIV-1 RNA, co-localized with unspliced HIV-1 pre-mRNA and/or genomic HIV-1 RNA in the nucleus catalyzing the reduction of all spliced and unspliced HIV-1 RNAs; the same ribozyme functioned as a mRNA for a chimeric CD4/Env protein in the cytoplasm (Paik et al, 1997).
Antisense oligonucleotides for HIV (anti-TAT) coupled with the influenza HA-2 protein-derived N-terminal fusogenic peptide have improved 5- to 10-fold their antiviral potency (Bongartz et al, 1994).
F. Novel therapies based on HIV vectors
A major drawback in the gene therapy of HIV has been the poor efficiency of gene transfer in vivo; especially important for HIV, most recombinant retroviruses transduce poorly cells harboring HIV, such as monocytes and macrophages, which are nondividing. Transfection of a fibroblast cell line with a HIV vector, bearing a deletion of the major packaging sequence has provided an HIV-1 packaging cell line which produced a large amount of HIV-1 structural proteins and non-infectious mature particles with normal reverse transcriptase activity but lacked RNA. When this cell line was stably transfected with an HIV-1-based retroviral vector virions were produced capable of transducing CD4-positive cells with efficiencies up to 105 cells per ml (Corbeau et al, 1996).
For more details see VI. HIV vectors for gene transfer.
E. Clinical trials involving HIV
Gene therapy approaches directed against viral targets have been successful at inhibiting HIV-1 replication in cultured human cells; however, clinical trials involving gene therapy directed at HIV-1 are still in their infancy (reviewed by Gottfredsson and Bohjanen, 1997). Treatment of HIV-1 infections using gene therapy for intracellular immunization strategies is currently being tested in clinical trials. The first RAC-approved phase I study on HIV was to evaluate the safety of cellular adoptive immunotherapy using genetically modified CD8+ HIV-specific T cells in HIV seropositive individuals (protocol #15, Appendix 1). The significant number of ongoing clinical trials directed against HIV can be found on protocols 24, 40, 47, 52, 55, 73, 78, 79, 81, 85, 86, 88, 91, 94, 105, 108, 116, 117, and 168 in Appendix 1.
XXX. Familial hypercholesterolemia (FH)
A. Molecular mechanisms for FH
FH is an autosomal dominant disorder caused by a defect in the low density lipoprotein (LDL) receptor gene. LDL receptor on hepatocytes clears LDL from the serum; patients with one abnormal LDL receptor allele suffer premature coronary disease and myocardial infarction whereas patients with two abnormal alleles have extraordinarily high levels of cholesterol and accelerated atherosclerosis developing life-threatening coronary artery disease in early childhood. One type of mutation in the LDL receptor gene has incurred by Alu-Alu recombination deleting several exons and thus producing a truncated receptor molecule with loss of function (Lehrman et al, 1987).
Treatment of patients with FH is accomplished through the administration of drugs that stimulate the expression of LDL receptor from the normal allele in order to lower the plasma level of LDL; however this regimen is not effective for the treatment of homozygous deficient patients, especially those that retain less than 2% of residual LDL-R activity. A more direct approach has been to correct the deficiency of hepatic LDL receptor by transplanting a liver that expresses normal levels of LDL receptor; three patients that survived this procedure normalized their serum LDL-cholesterol (see Wilson et al, 1992 for references).
B. Gene therapy of FH: experiments in cell culture
A transmissible retroviral vector containing a full-length human cDNA for the LDL-R was used to infect fibroblasts from the Watanabe heritable hyperlipidemic (WHHL) rabbit which expressed the human receptor efficiently, as indicated by RNA and ligand blotting studies (Miyanohara et al, 1988). The number of hepatocytes that could be transduced by retroviruses bearing the therapeutic gene was one of the limiting steps that could impair the success of this strategy; addition of human hepatocyte growth factor (HGF) to hepatocytes allowed marked increase in the transduction efficiency in mouse (up to 80%) and human (40%) hepatocytes (Pages et al, 1995). Transduction of the human LDL-R cDNA under the transcriptional control of the liver-type pyruvate kinase promoter allowed high and tissue specific expression of the gene in primary hepatocytes; a second vector with a housekeeping promoter corrected the LDL-R deficiency in fibroblasts from a FH patient (Pages et al, 1996b).
C. Gene therapy of FH: experiments on animals
Liver is the preferred target organ for gene transfer-mediated treatment of FH. The presence of unique receptors at the cellular membrane of hepatocytes forms the basis for transfer strategies based on receptor targeting (reviewed by Sandig and Strauss, 1996). An authentic animal model used in FH gene therapy is the Watanabe heritable hyperlipidemic rabbit which is homozygous for FH and has a deletion in a cysteine-rich region of the LDL receptor gene; this renders the receptor completely dysfunctional (Yamamoto et al, 1986); these animals display high levels of serum cholesterol, diffuse atherosclerosis, and die prematurely. Liver tissue was removed from such animals and the cultured hepatocytes were transduced with retroviruses carrying the rabbit LDL receptor gene; the genetically corrected cells were transplanted into the animal from which they were derived. This treatment resulted in a 30-40% reduction in serum cholesterol that lasted for at least 4 months (Chowdhury et al, 1991).
The portal vein has been used for liver targeting in New Zealand White (NZW) rabbits. Expression of lacZ was obtained in virtually all hepatocytes within 3 days (but was undetectable by 3 weeks) after transfer of the lacZ reporter gene under the control of different promoters using recombinant, replication-defective adenoviruses which were infused into the portal circulation. An adenovirus human LDL-R cDNA was then infused into the portal vein of rabbits deficient in LDL receptor and demonstrated human LDL receptor protein in the majority of hepatocytes that exceeded the levels found in human liver by at least 10-fold. Transgene expression diminished to undetectable levels within 3 weeks (Kozarsky et al, 1994).
To demonstrate feasibility of the ex vivo FH therapy, three baboons underwent a partial hepatectomy, their hepatocytes were isolated, cultured, transduced with a retrovirus containing the human LDL-R gene, and infused via a catheter that had been placed into the inferior mesenteric vein at the time of liver resection (Grossman et al, 1992). Gene replacement therapy of human LDL receptor gene into the murine model of FH transiently corrected the dyslipidaemia; long-term expression of the therapeutic gene was extinguished by humoral and cellular immune responses to LDL receptor which developed and possibly contributed to the associated hepatitis (Kozarsky et al, 1996).
As an alternative strategy, expression in the liver of the very low density lipoprotein (VLDL) receptor, which is homologous to the LDL receptor but has a different pattern of expression, using recombinant adenoviruses corrected the dyslipidaemia in the FH mouse; transfer of the VLDL receptor gene circumvented immune responses to the transgene leading to a higher duration of metabolic correction (Kozarsky et al, 1996).
Replication-defective adenovirus-mediated gene transfer of the very low density lipoprotein receptor (VLDL-R) driven by a cytomegalovirus promoter in LDL-R knockout mice by a single intravenous injection resulted in reduction in total cholesterol by approximately 50% at days 4 and 9 and returned toward control values on day 21. Lowering in total cholesterol was mediated by a marked reduction in the intermediate density lipoprotein/low density lipoprotein (IDL/LDL) fraction. In treated animals, there was also an approximately 30% reduction in plasma apolipoprotein (apo) E accompanied by a 90% fall in apoB-100 on day 4 of treatment. Thus, adenovirus-mediated transfer of the VLDLR gene induced high-level hepatic expression of the VLDL-R, resulted in a reversal of the hypercho-lesterolemia, and enhanced the ability of these animals to clear IDL (Kobayashi et al, 1996).
The human apolipoprotein E (apoE) gene driven by the cytochrome P450 1A1 promoter produced transgenic mice where robust expression of apoE depended upon injection of the inducer b-naphthoflavone; a transgenic line exhibiting basal expression of apoE in the absence of the inducer upon breeding with hypercholesterolemic apoE-deficient mice produced animals which were as hypercholesterolemic as their nontransgenic apoE-deficient littermates in the basal state. When injected with the inducer, plasma cholesterol levels of the transgenic mice decreased dramatically. The inducer could pass transplacentally and via breast milk from an injected mother to her suckling neonatal pups, giving rise to the induction of human apoE in neonate plasma (Smith et al, 1995).
Other potential approaches for the treatment of FH include transfer of the apolipoprotein (apo) B mRNA editing protein which is an essential catalytic component of the apoB mRNA editing enzyme complex. This enzyme deaminates a cytidine residue at nucleotide position 6666 in apoB mRNA, converting it to uridine leading to the production of apoB-48 in place of apoB-100. The editing protein exists as a homodimer and can be used as a therapeutic agent to reduce apoB-100; somatic gene transfer of the editing protein cDNA was highly effective in lowering plasma low density lipoproteins (Chan et al, 1996).
D. Clinical trials on FH
The first clinical trial for gene therapy in the liver, based on ex vivo gene delivery, has shown both the feasibility and the limits of the current technology. According to this protocol, cultured hepatocytes from patients homozygous for mutations in the LDL receptor gene were proposed to be transduced ex vivo with the LDL receptor gene and transplanted by infusion into the portal vein of the patient (Wilson et al, 1992). A 29 year old woman, with homozygous FH, was transplanted with autologous hepatocytes that were genetically corrected with recombinant retroviruses carrying the LDL receptor gene. She tolerated the procedures well and in situ hybridization of liver tissue four months after therapy revealed evidence for engraftment of transgene-expressing cells. The patient's LDL/HDL ratio declined from 10-13 before gene therapy to 5-8 following gene therapy, an improvement which remained stable for the 18-month duration of the treatment (Grossman et al, 1994).
Five patients, ranging in age from 7 to 41 years, with homozygous FH, underwent hepatic resection and placement of a portal venous catheter; primary hepatocyte cultures from the resected liver were transduced with the human LDL-R gene with a retrovirus and the cells were then transplanted into the liver through the portal venous catheter. The liver-directed ex vivo gene therapy was accomplished safely and, in a child patient, normalization of cholesterol levels took place; LDL-R expression was detected in a limited number of hepatocytes of liver tissue four months after hepatocyte implantation from all five patients whereas significant and prolonged reductions in LDL cholesterol were demonstrated in three of five patients. The major obstacle in this first trial was the level and duration of LDL-R expression which “precluded a broader application of liver-directed gene therapy without modifications supporting substantially greater gene transfer” (Grossman et al, 1995; Raper et al, 1996).
XXXI. Angiogenesis and human disease
A. Formation of new blood vessels (angiogenesis)
Blood vessels, named in anatomy on the basis of their luminar diameter, branching, position and organ supplied, are formed with their proper diameter in the embryo before the heart starts beating. During a complex developmental program leading to formation of the cardiovascular system angioblasts are derived from mesoderm; this process requires the action of basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF). Angioblasts then differentiate into endothelial cells which undergo proliferation, migration, and morphologic organization in the context of their surrounding tissues to form the blood vessels (reviewed by Folkman and D’Amore, 1996).
Angiogenesis virtually never occurs physiologically in adult tissues except in the ovary, the endometrium and the placenta. During this process, which is also essential in pathological situations such as wound healing and inflammation, formation of new microvessels from parent microvessels takes place. The process involves remodeling of the basement membrane and interstitial extracellular matrix (ECM) using degrading proteases produced by the endothelial cells and other adjacent cells, and the synthesis of ECM. The endothelial cells are able to synthesize and secrete cytokines. The angiogenesis is strictly controlled by a redundancy of pro- and anti-angiogenic paracrine peptide molecules. The tumor suppressor p53 protein has been shown to control the expression and synthesis of two anti-angiogenic factors (reviewed by Norrby, 1997).
Blood vessels in embryogenesis are formed in two stages: (i) during vasculogenesis newly differentiated endothelial cells coassemble into tubules that further fuse forming the primary vasculature of the embryo; (ii)