I. Introduction
The human dystrophin gene is the
largest gene so far identified and characterized. It extends over 2 mb on the
short arm of the X-chromosome (Burmeister et al., 1988). This gene frequently
undergoes different rearrangements causing Duchenne or Becker muscular
dystrophy (Wapenaar et al., 1988; Den Dunnen et al., 1989; Blonden et al.,
1991). Analysis of the replication structure of the dystrophin gene may give
new insight into the mechanisms of this gene rearrangement as it seems probable
that at least some recombination events occur in connection with DNA
replication.
It has long been shown that the
genome of higher eukaryotes is replicated as a set of quazi-independent
replication units (replicons). Each replicon seems to possess a specific site
(or area) where the replication starts (for a review see Hamlin, 1992;
DePamphilis, 1993; Hamlin and Dijkwel, 1995). As far as the sites of
termination of DNA replication (i.e. replicon junctions) are concerned, the
situation seems to be less clear. Although these sites can be mapped using the
analysis of replication polarity (see below and also Handeli et al., 1989), it
is possible that their positions are determined simply by a distance from the
replication origins and by the speed of replication forks progression. Such is
indeed the case in the simian virus 40 circular genome, as the insertion in one
arm of the SV-40 replicon of a DNA sequence element retarding the progression
of the replication fork was found to cause a displacement of the replication
termination site in the direction of the more slowly moving replication fork
(Rao et al., 1988; Rao, 1994). In yeast cells the termination of replication
does not occur at specific places determined (at least in non-nucleolar
regions) by any specific DNA sequence element. It appears to be a consequence
of converging of the replicating forks within a relatively broad region (Zhu et
al., 1992). At the same time, some DNA sequences pausing the replication forks
progression (such as the transcription termination signal for RNA polymerase I)
were reported to serve as preferential sites of replication termination in
yeast and mammalian cells (Umek et al., 1989; Kobayashi et al., 1992; Little et
al., 1993).
One may be surprised to realise how
little we know about replication structure of DNA of higher eukaryotes. Even
the average size of replicons constitutes a matter of discussion. The common
view is based on the results of DNA fiber radioautography studies carried out
more then 20 years ago. These studies lead to a conclusion that DNA of higher
eukaryotes is organized in clusters of simultaneously working replicons. The
size of individual replicons within a cluster was estimated as 50 to 300
kb (Huberman and Riggs, 1966,
1968; Callan, 1974; Stubblefield, 1974; Edenberg and Huberman 1975; Painter,
1976). This common interpretation of the DNA fiber radioautography data was,
however, questioned by Liapunova and coauthors who presented arguments for the
much larger size of replicons (150-900 kb) in mammalian cells and for the absence of replicon clusters
(Yurov Yu. B. and Liapunova, 1977; Liapunova, 1994). Several procedures for
mapping replication origins in
Figure 1. A scheme illustrating the
experimental procedure used to determine the polarity of leading DNA strand
synthesis. The nascent DNA chains in a replication loop are shown by thick
arrows. Short arrows show ligated Okazaki fragments (synthesised before
addition of emetine). The scheme is based on the data of Burhans et all. (1991)
who have demonstrated that emetine induce imballanced DNA synthesis. Although
based on a wrong assumption, the protocol for determining the polarity of
leading DNA synthesis was developed two years earlier by Handeli et al. (1989).
mammalian genome have been developed
recently (for review see Hamlin, 1992; Vassilev and DePamhilis, 1992;
DePamphilis, 1993; Hamlin and Dijkwel, 1995). However, most of these procedures
are not suitable for the analyzis of replication structure of large genomic
areas. Only one modern protocol, namely that based on the determination of the
polarity of leading DNA strand synthesis (Handeli et al., 1989; Burhans et al.,
1991) may be used for this purpose as it is relatively simple and permits the
approximate positions of both replication origins and termination sites to be
mapped.
Here we are presenting a replicon
map of the dystrophin gene constructed using the replication direction assay.
It has been found that this gene is organized into at least six replicons
ranging in size from 170 to more than 500 kb. One of the replicon junctions
(sites of replication termination) was mapped in intron 44, i.e. roughly in the
same area where the major recombination hot spot is located (Wapenaar et al.,
1988; Den Dunnen et al., 1989; Blonden et al., 1991). The experimental approach
used in our study (utilization of oligonucleotide probes in the replication
direction assay) may be helpful for fast analysis of the replication structure
of other areas of the human genome provided that these areas are saturated with
STS markers.
II. Results
A. Mapping approach
Determination of the polarity of
leading DNA strands synthesis became possible due to the demonstration that the
inhibition of protein synthesis in proliferating cells preferentially
suppresses the synthesis of the discontinuous (lagging) DNA strand.
Hybridization of the nascent DNA synthesised under these condition with
strand-specific probes can thus be used to assay the polarity of leading DNA
strand synthesis (Handely et al., 1989; Burhans et al., 1991). The principle of
the above-described mapping protocol is illustrated in Fig. 1. Although the mechanism of
imbalanced synthesis of leading and lagging DNA strands in the presence of
protein synthesis inhibitors is still not known, the validity of the approach
has been verified in experiments with different genomic areas (Handely et al.,
1989; Burhans et al., 1991; Kitsberg et al., 1993) and can hardly be
questioned. It was originally proposed to use as strand-specific probes for the
replication direction assay the RNA chains transcribed in opposite directions
from the same DNA fragment (Handely et al., 1989). Naturally these probes could
be made only after cloning of the necessary DNA fragment in an appropriate
vector. In order to facilitate the mapping protocol we have developed
conditions for using 20-mer oligonucleotides as strand-specific probes. To test
the approach we have analysed the direction of replication forks movement
within the domain of chicken alpha-globin genes (Verbovaia and Razin, 1995).
The results obtained were in perfect agreement with the previously published
data on mapping the replication origin in this domain. Oligonucleotide probes
can be easily washed out from the filters and the same filters with immobilized
nascent and total DNA from cells treated with emetine or other inhibitor of
protein synthesis can be used sequentially in a number of hybridization
experiments. To study the replication structure of human dystrophin gene we
have used HEL 92.1.7 cells derived from a male patient as it was not clear whether
the replication structures of the active and non-active copies of the
X-chromosome in female cells were identical. The cells were cultivated for 18
h in presence of emetine and
5-bromo-2'-deoxy-uridine (BrdU) exactly as described by Handeli et al. (1989).
(See also Methods section in the end of this paper). The DNA was then isolated,
denatured, sheared to about 1 kb fragments and nascent DNA chains containing
BrdU were separated from the bulk DNA by double immunoprecipitation, as
described previously (Vassilev and Russev, 1988). Equal amounts (2 mg) of total DNA and nascent DNA from emetine-treated
cells were immobilised on nylon filters and hybridized with oligonucleotide
probes representing complementary DNA chains.
In order to exclude the possibility
of artefacts due to the uneven sorption of DNA on filters, each filter was
sequentially hybridized to probes derived from both strands and each pair of
probes was hybridized to at least two different filters. In all cases the
results of these four hybridization experiments confirmed each other. A typical
example is shown in Fig. 2. Two similarly prepared filters with immobilized nascent
and total DNA were hybridized to the "lower chain" and the
"upper chain" probes derived from the sequence of the brain promoter
of the dystrophin gene (here and further we use
Figure 2. Reciprocal hybridization of
"lower chain" and "upper chain" oligonucleotide probes from
the dystrophin gene brain promoter with nascent (nc) and total (tot) DNA
immobilized on two similarly prepared filters. The filter "a" was
first hybridized to the "lower chain" probe and then, after exposure
and dehybridization, to the "upper chain" probe. The filter
"b" was first hybridized to the "upper chain" probe and
then, after exposure and dehybridization, to the "lower chain" probe.
Note the preferential hybridization of the nascent DNA with the "upper
chain" probe in both cases.
the designation "upper
chain" for the chain which is transcribed into dystrophin pre-mRNA). This
experiment has demonstrated preferential hybridization of the "upper
chain" probe to the nascent DNA. After exposure, the probes were washed
off the filters and the "upper chain" probe was hybridized to the
filter previously hybridized to the "lover chain" probe and vise versa.
Again, preferential hybridization of the "upper chain" probe with the
nascent DNA was observed. The asymmetry of hybridization of the "lower
chain" and the "upper chain" probes to the nascent DNA remained
visible even after high-stringency wash (wash with 0.1X SSC-0.1%SDS for 15 min
at 420C instead of normally used wash with
1X SSC for 15 min at 420C).
B. Mapping of replication units within the
dystrophin gene
To assay the polarity of replication
of different parts of the dystrophin gene we prepared 36 pairs of
oligonucleotide probes (Table I). Some of these probes were made on the basis of the
previously described primers for STS markers (Coffey, et al., 1992). These
probes are referred to by their name in the original publication (Coffey, et
al., 1992) with the number of a corresponding exon indicated in parentheses.
Other oligonucleotide probes were designed on the basis of the known primary
structure of dystrophin mRNA (Koenig et al., 1987) and the exon-intron
structure of the dystrophin gene (Roberts et al., 1993). These probes are
referred to by the number of a corresponding exon. Approximate positions of the
probes on the physical map of the dystrophin gene are shown in Fig. 3A.
The results of hybridization of the
whole set of strand-specific probes with total DNA and nascent DNA samples
enriched in leading strands are shown in Fig. 3 B. The polarity of the leading DNA
strand synthesis was found to switch eleven times within the area under study.
Keeping in mind the fact that the replication forks meet at the termination
sites and move in opposite directions from the replication origins one can say
that the area under study contains 5 replication origins and 6 termination
sites. The first of the termination sites is located between the brain and muscle
promoters. Indeed, the brain promoter (R24 probes) is replicated in the
direction of dystrophin gene transcription, while the muscle promoter (R22(E1)
probes) and exons 2 to 7 (probes R12(E2), R13(E3) and R7(E7)) are replicated in
the direction opposite to the direction of transcription. This conclusion
follows from preferential hybridization of the nascent DNA leading strands with
the "upper chain" probe of the R24 pair and with the "lower
chain" probes of the R22(E1), R12(E2), R13(E3) and R7(E7) pairs, as shown
schematically in Fig. 4. The next switch in replication polarity occurs between exons 7 and 8.
This is a switch from the minus chain to the plus chain which is indicative of
the presence of a replication origin between probes R7(E7) and R2(E8) (see the
scheme in Fig.
4). Similar considerations make it possible to conclude that the replication
origins are located between exons 28 and 29, between exons 43 and 44, between
exons 46 and 48 and between exons 64 and 68. The replication termination sites
are located between probes 87-1 and 87-15, between exons 40 and 43, between
exons 44 and 45, between exons 48 and 49 and between exons 70 and 75.
Table I. Oligonucleotide probes used for
determination of the dystrophin gene replication structure.
____________________________________________________________________________________________
Names of Nucleotide
sequence of Nucleotide
sequence of
probes the
probe from the "upper" chain the
probe from the lower chain
____________________________________________________________________________________________
R24 CTTTCAGGAAGATGACAGAATC GATTCTGTCATCTTCCTGAAAG
R22(E1) CTTTCCCCCTACAGGACTCAG CTGAGTCCTGTAGGGGGAAAG
R12(E2) GAAAGAGAAGATGTTCAAAAG CTTTTGAACATCTTCTCTTTC
R13(E3) GGCAAGCAGCATATTGAGAAC GTTCTCAATATGCTGCTTGCC
R7(E7) CTATTTGACTGGAATAGTGTG CACACTATTCCAGTCAAATAG
R2(E8) CCTATCCAGATAAGAAGTCC GGACTTCTTATCTGGATAGG
R14(E11) GTACATGATGGATTTGACAGC GCTGTCAAATCCATCATGTAC
87-1 CTATCATGCCTTTGACATTCCA
TGGAATGTCAAAGGCATGATAG
87-15 ATAATTCTGAATAGTCACA TGTGACTATTCAGAATTAT
R21(E25) CAATTCAGCCCAGTCTAAAC GTTTAGACTGGGCTGAATTG
R25(E27) GCTAAAGAAGAGGCCCAAC GTTGGGCCTCTTCTTTAGC
E28 GTTTGGGCATGTTGGCATGAG CTCATGCCAACATGCCCAAAC
E29 TGCGACATTCAGAGGATAACC GGTTATCCTCTGAATGTCGCA
E31 GGCTGCCCAAAGAGTCCTGTC GACAGGACTCTTTGGGCAGCC
R16(E33) GTCTGAGTGAAGTGAAGTCTG CAGACTTCACTTCACTCAGAC
E35 GAAGGAGACGTTGGTGGAAGA TCTTCCACCAACGTCTCCTTC
R31(E39) CAACTTACAACAAAGAATCACA TGTGATTCTTTGTTGTAAGTTG
R8(E40) GGTATCAGTACAAGAGGCAG CTGCCTCTTGTACTGATACC
E43 GTCTACAACAAAGCTCAGGTCG CGACCTGAGCTTTGTTGTAGAC
E44 GACAGATCTGTTGAGAATTGC GCATTTCTCAACAGATCTGTC
R18(E45) CTCCAGGATGGCATTGGCAG CTGCCAATGCCATCCTGGAG
R4(E46) ATTTGTTTTATGGTTGGAGG CCTCCAACCATAAAACAAAT
E48 GTTTCCAGAGCTTTACCTGA TCAGGTAAAGCTCTGGAAAC
E49 ACTGAAATAGCAGTTCAAGC GCTTGAACTGCTATTTCAGT
E50 GAAGTTAGAAGATCTGAGCTC GAGCTCAGATCTTCTAACTTC
E53 CAGAATCAGTGGGATGAAGTA TACTTCATCCCACTGATTCTG
E54 CCAGTGGCAGACAAATGTAG CTACATTTGTCTGCCACTGG
E55 TGAGCGAGAGGCTGCTTTGG CCAAAGCAGCCTCTCGCTCA
R20(E56) GGTGAAATTGAAGCTCACAC GTGTGAGCTTCAATTTCACC
E60 ACTTCGAGGAGAAATTGCGC GCGCAATTTCTCCTCGAAGT
E61 GCCGTCGAGGACCGAGTCAG CTGACTCGGTCCTCGACGGC
E64 ACTCCGAAGACTGCAGAAGG CCTTCTGCAGTCTTCGGAGT
E68 TAAGCCAGAGATTGAAGCGG CCGCTTCGATCTCTGGCTTA
E70 ACATCAGGAGAAGATGTTCG CGAACATCTTCTCCTGATGT
E75 CTGCAAGCAGAATATGACCG CGGTCATATTCTGCTTGCAG
R5(E79) CAGAGTGAGTAATCGGTTGG CCAACCGATTACTCACTCTG
Figure 3 (CLICK TO ENLARGE). Determining replication polarity
within the dystrophin gene. (A) A scheme illustrating the exon-intron structure
of the dystrophin gene and the results of determination of replication
polarity. On the map of the dystrophin gene the exons are shown by vertical
dark bars. Each tenth exon is indicated by the number. Positions of the brain
and muscle promoters are shown by arrows above the map. The results of the
analysis of replication direction are shown below the map. The vertical bars
indicate the positions of the probe pairs used to assay the replication
polarity. The direction of replication determined by hybridization of nascent
DNA with each of the probe pairs is shown by horizontal arrows. Approximate
positions of the origins (ori) and termination sites (t) are
indicated above the arrows. (B) Hybridization of strand-specific probes with
total DNA (tot) and nascent DNA (nc) from emetine-treated cells. The names of
the probe pairs are indicated above the autoradiographs. "-" and
"+" indicate the results of hybridization with probes derived from
the lower and the upper chains, respectively.
Figure 4. A scheme illustrating the
interpretation of the results of hybridization of strand-specific probes with
DNA samples enriched in nascent DNA leading strands. The upper chain and the
lower chain probes are designated correspondingly by "+" and
"-".
III. Discussion
A. The size of replicons
The present study has demonstrated
for the first time that a single gene may be organized into several replicons.
The average size of replicons mapped within the area under study constitutes
500 kb (with variations from 170 to 1000 kb). This finding contradicts to the
common view that the average sizes of replicons in mammalian cells are from 50
to 300 kb. However our observations are in perfect agreement with the
estimations of replicon sizes made by Liapunova and Yurov (reviewed by
Liapunova, 1994). Furthermore, analysis of the temporal order of DNA
replication in the H-2 mouse majour histocompactibility complex also suggested
that mammalian replicons are larger then 300 kb (Spack et al., 1992). Similar conclusion follows
from the results published by Bickmore and Oghene (1996).
B. Asymmetrical replicons and replication
barriers.
The results of the present study
demonstrate that in the human genome the replicons may be asymmetrical. Indeed,
an extended (500 kb) region
including exons 49 - 64 seems to be replicated unidirectionally. The
opposite arm of the same replicon is relatively small (less than 100 kb). It is
possible that the left end of the dystrophin gene (500 kb DNA stretch) is also
replicated unidirectionally. At least all exons scattered along this region are
replicated in the same direction. Some of the replication termination sites
mapped in the present study are not located at the middle of the distance
between two neighbouring origins. This suggests that there should be some
specific signals determining positions of termination sites. Up to now the replication
barriers of this kind were observed only in yeast and mammalian ribosomal genes
clusters (Umek et al., 1989; Kobayashi et al., 1992; Little et al., 1993).
C. The replication structure of the dystrophin
gene and recombination hot-spots
It may be of interest that one of
the replication junctions (termination sites) identified in the present study
is located in intron 44, i. e. roughly colocalizes with the main recombination
hot-spot in the dystrophin gene (Wapenaar et al., 1988; Den Dunnen et al., 1989;
Blonden et al., 1991). Although the significance of this colocalization (if
any) is not presently clear, it is worth mentioning that in prokaryotic cells
the sites of replication termination have long been known to constitute
recombination hotspots (Bierne et al., 1991; Horiuchi et al., 1994; Horiuchi et al., 1995). According to one of the
models, the replication fork posed at a termination site is a weak point on DNA
where a double-stranded-break may occur with a high probability (Horiuchi et
al., 1995; Michel
et al., 1997). Some data suggest that a similar mechanism may account for the
formation of recombination hot-spots also in eukaryotic cells (Horiuchi et
al., 1995). In
agreement with this idea it was demonstrated that pausing of the replication machinery
by certain DNA secondary structures, DNA damage or DNA-protein interaction
cause an increase in the rate of DNA rearrangements (Bierne and Michel, 1994).
It is known that in eukaryotic cells finalization of DNA replication (juncture
of neighbouring replicons) is a relatively slow process. During this step the
replication forks retain single-stranded regions which can be relatively easy
converted into double-stranded breaks. Furthermore, merging of replicons
depends on the reactions catalysed by DNA topoisomerases which seem to be able
under certain conditions to carry out illegitimate recombination of DNA strands
and hence to introduce deletions and insertions into DNA (Gale and Osheroff,
1992; Shibuya et al., 1994; Henningfeld and Hecht, 1995; Bierne et al., 1997).
An interesting feature of the
replication structure of dystrophin gene is that the central part of the gene
(exons 8 - 48) is organized into relatively short symmetrical replicons which
are surrounded by two extended regions of apparently unidirectional replication
(exons 1 - 8 and exons 49 - 64). Assuming that the rate of replication forks
progression is the same in all replicons, it may be concluded that the
replication of the central part of the gene must be completed much faster than the
replication of its ends. This may cause some topological stresses resulting in
an increased rate of chromosomal rearrangements within the dystrophin gene.
IV. Methods
A. Cell culture.
Human erythroleukemia cells HEL
92.1.7 were purchased from the American Type Culture Collection. The cells were
grown in RPMI 1640 medium supplemented with 10% fetal bovine serum.
B. Isolation of DNA samples
enriched in nascent DNA leading strands.
To induce imbalanced synthesis of
nascent DNA strands, exponentially growing cells were treated with emetine, as
described previously (Handeli et al., 1989; Burhans et al., 1991). Emetine was
added to the conditional medium up to a concentration of 2 mM. This was followed (after 15 min incubation) by the
addition of 5-bromo-2'-deoxy-uridine (10 mg/ml)
and 3H deoxy-cytidine (2 mCi/ml). The cells were cultured in this medium for 16 h.
Then they were collected and their DNA was isolated. After shearing (to give
fragments with an average size of 1 kb) and denaturation of the DNA, the
BrdU-labelled nascent DNA chains were separated from the bulk DNA by double
immunoprecipitation, as described previously (Vassilev and Russev, 1988).
C. Immobilization of DNA on nylon
filters and hybridization experiments.
Equal amounts (2 mg) of the nascent and bulk DNA were immobilized on Hybond-N+
nylon filters (Amersham) using a Bio-Dot SF microfiltration unit (Bio-Rad). The
equivalency of immobilization of all probes was verified by hybridization with 32P-labelled human repeated sequence of
alu type. The oligonucleotides
were labelled with g32P-ATP using T4 phage polynucleotide
kinase, as described previously (Maniatis et al., 1982). Hybridization was
carried out in a Rapid Hyb solution (Amersham) for 1 h at 42 0C. After hybridization, the filters were
washed one time in 5XSSC - 0.1% (w/v) SDS solution for 20 min at room
temperature and two times (15 min each) in 1X SSC - 0.1% (w/v) SDS solution at
42 0C. Then the filters were exposed
to the Kodak film at -75 0C with an
intensifying screen (Dupont). For dehybridization of the radioactive probes the
filters were incubated in 0.4 M NaOH solution for 30 min at 45 0C. Then they were neutralized (15 min at
room temperature) in the following solution: 0.1X SSC - 0.1%(w/v)SDS - 0.2M
Tris-HCl (pH 7.5).
Acknowledgements
This work was supported by grant N
097 from the Russian State Program "Frontiers in Genetics", by the
grant 96-04-49120 from the Russian Foundation for Support of Fundamental
Science and by the ICGEB grant CRP/RUS 93-06 to S.V.R.
References
Bickmore WA
and Oghene K (1996)
Visualizing the spatial relationships between defined DNA sequences and the
axial region of extracted metaphase chromosomes. Cell 84, 95-104.
Bierne H,
Ehrlich SD and Michel B (1991) The replication termination signal terB of the Escherichia
coli chromosome is a deletion hot spot.
EMBO J.
10, 2699-2705.
Bierne H and
Michel B (1994)
When replication forks stop. Mol. Microbiol. 13, 17-23.
Bierne H,
Ehrlich SD and Michel B (1997) Deletions at stalled replication forks occur by two
different pathways. EMBO J. 16, 3332-3340.
Blonden LAJ,
Grooyscholten PM, Den Dunnen JT, Bakker E., Abbs S, Bobrow M, Boehm C, van
Broeckhoven C, Baumbach L, Chamberlain J, Caskey CT, Denton M, Felicetti L,
Gallusi G, Fischbeck KH, Francke U, Darras B, Gilgenkrantz H, Kaplan J-C,
Hermann FN, Junien C, Boileau C, Liechti-Gallati S, Lindlof M, Matsumoto T,
Niikawa N, Muller CR, Poncin J, Malcolm S, Robertson E, Romeo G, Colone AE,
Scheffer H, Schroder E, Schwartz M, Verellen C, Walker A, Worton R, Gillard E
and Van Ommen GJB (1991) 242 Breakpoints in the 200-kb deletion-prone P20 region of the DMD
gene are widely spread. Genomics 10, 631-639.
Burhans WC, Vassilev LT, Wu J, Sogo
JM, Nallaseth F and DePamphilis ML (1991) Emetine allows identification of origins of
mammalian DNA replication by imbalanced DNA synthesis, not through conservative
nucleosome segregation. EMBO J. 10, 4351-4360.
Burmeister M, Monaco AP, Gillard EF,
Van Ommen G-F, Affara NA, Ferguson-Smith MA, Kunkel LM and Lehrach H (1988) A 10-megabase map of human Xp21
including the Duchenne muscular dystrophy gene. Genomics 2, 189-202.
Callan HG (1974) DNA replication in the chromosomes
of eukaryotes. Cold Spring Harb. Symp. Quant. Biol. 38, 195-204.
Coffey AJ,
Roberts RG, Green ED, Cole CG, Butler R, Anand R, Giannelli F and Bentley DR (1992) Construction of a 2.6-mb contig in
yeast artificial chromosomes spanning the human dystrophin gene using an
STS-based approach. Genomics 12, 474-484.
DePamphilis ML (1993) Eukaryotic DNA replication: anatomy
of an origin. Annu. Rev. Biochem. 62, 29-63.
Den Dunnen
JT, Grootscholten PM, Bakker E, Blonden LAJ, Ginjaar HB, Wapenaar MC, van
Paassen HMB, van Broeckhoven C, Pearson PL and Van Ommen GJB (1989) Topography of the Duchenne muscular
dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions
and 13 duplications. Am. J. Hum. Genet. 45, 835-847.
Edenberg HJ and Huberman JA (1975) Eukaryotic chromosome replication. Annu.
Rev. Genet. 9,
245-284.
Gale KC and Osheroff N (1992) Intrinsic intermolecular DNA
ligation activity of eukaryotic topoisomerase II. Potential roles in
recombination. J. Biol. Chem. 267, 12090-12097.
Gorecki DC, Monako AP, Derry JML,
Walker AP, Bernard EA and Bernard PJ (1992) Expression of four alternative dystrophin
transcripts in brain regions regulated by different promoters. Hum. Mol.
Genet. 1, 505-510.
Hamlin JL (1992) Mammalian origins of replication. BioEssays 14, 651-659.
Hamlin JL and Dijkwel PA (1995) On the nature of replication
origins in higher eukaryotes. Current Opin. Genet and Dev. 5, 153-161.
Handeli S, Klar A, Meuth M and Cedar
H (1989) Mapping
replication units in animal cells. Cell 57, 909-920.
Henningfeld KA and Hecht SM (1995) A model for topoisomerase
I-mediated insertions and deletions with duplex DNA substrates containing
branches, nicks, and gaps. Biochemistry 34, 6120-6129.
Horiuchi T, Fujimura Y, Nishitani H,
Kobayashi T and Hidaka M (1994) The DNA replication fork blocked at the Ter site may be an
entrance for the RecBCD enzyme into duplex DNA. J. Bacteriol. 176, 4656-4663.
Horiuchi T, Nishitani H and Kobayashi
T (1995) A new
type of E. coli recombination hotspot which requires for the activity both DNA
replication termination events and the Chi sequence. Adv. Bioph. 31, 133-147.
Huberman JA and Riggs AD (1966) Autoradiography of chromosomal DNA
fibers from Chinese hamster cells. Proc. Natl. Acad. Sci. USA 55, 599-606.
Huberman JA and Riggs AD (1968) On the mechanism of DNA replication
in mammalian chromosomes. J. Mol. Biol. 32, 327-341.
Kitsberg D, Selig S, Keshet I and
Cedar H (1993) Replication
structure of the human b-globin gene domain. Nature 366, 588-590.
Kobayashi T, Hidaka M, Nishizawa M
and Horiuchi N (1992) Identification of a site required for DNA replication fork blocking
activity in the rRNA gene cluster in Saccharomyces cerevisiae. Mol. Gen. Genet. 233, 355-362.
Koenig M, Hoffman EP, Bertelson CJ,
Monaco AP, Feener C and Kunkel LM (1987) Complete cloning of Duchenne muscular dystrophy
(DMD) cDNA and preliminary genomic organization of the DMD gene in normal and
affected individuals. Cell 50, 509-517.
Liapunova NA (1994) Organization of replication units
and DNA replication in mammalian cells as studied by DNA fiber radioautography.
Int Rew. Cytol.
154, 261-308.
Little RD, Platt TH, Schildkraut CL (1993) Initiation and termination of DNA
replication in human rRNA genes. Mol. Cell. Biol. 13, 6600-6613.
Michel B,
Ehrlich SD and Uzest M (1997) DNA double-strand breaks caused by replication arrest. EMBO
J. 16, 430-438.
Maniatis T, Fritsch EF and Sambrook J
(1982) Molecular
cloning: a laboratory manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory).
Painter RB (1976). Organization and size of
replicons. In Handbook of Genetics, R.C. King, ed. (Plenum, New York). vol. 5, pp. 169-186..
Rao BS, Manor H and Martin RG (1988) Pausing in simian virus 40 DNA
replication by a sequence containing (dG-dA)27.(dT-dC)27.
Nucl. Acids Res.
16, 8077-8094.
Rao BS (1994). Pausing of simian virus 40
replication fork movement in vivo by (dG-dA).(dT-dC)
tracts. Gene 140,
233-237.
Roberts RG, Coffey AJ, Bobrow M and
Bentley DR (1993).
Exon structure of the human dystrophin gene. Genomics 16, 536-538.
Shibuya ML, Ueno AM, Vannais DB,
Craven PA and Waldren CA (1994) Megabase pair deletions in mutant mammalian cells
following exposure to amsacrine, an inhibitor of DNA topoisomerase II. Cancer
Res. 54, 1092-1097.
Spack EG, Lewis ED, Paradowski B,
Schimke RT and Jones PP (1992) Temporal order of DNA replication in the H-2 major
histocompactibility Complex of the mouse. Mol. Cell. Biol. 12, 5174-5188.
Stubblefield E (1974) The kinetics of DNA replication in
chromosomes. In The cell nucleus, H. Busch, ed. (Academic Press, New York), vol. 2, pp.
149-162. .
Umek RM,
Linskens MHK, Kowalski D and Huberman J (1989) New beginnings in the studies of
eukaryotic DNA replication origins. Biochim. Biophys. Acta 1007, 1-14.
Vassilev L and Russev G (1988). Purification of nascent DNA chains
by immunoprecipitation with anti BrdU antibodies. Nucl. Acids Res. 16, 10397.
Vassilev LT and DePamhilis ML (1992) Guide to identification of origins
of DNA replication in eukaryotic cell chromosomes. Crit. Rev. Biochem. Mol.
Biol. 27, 445-472.
Verbovaia L and Razin SV (1995) Analysis of the replication
direction through the domain of a-globin-encoding
chicken genes. Gene
166, 255-259.
Wapenaar MC, Kievits T, Hart KA, Abbs
S, Blonden LAJ, den Dunnen JT, Grootscholten PM, Bakker E, Verellen-Dumoulin
Ch, Bobrow M, van Ommen GJB and Pearson PL (1988). A deletion hot spot in the
Duchenne muscular dystrophy gene. Genomics 2, 101-108.
Yorov YB and Liapunova NA (1977) The units of DNA replication in the
mammalian chromosomes: evidence for a large size of replication units. Chromosoma 60, 253-267.
Zhu J, Newlon CS and Huberman J (1992) Localization of a DNA replication
origin and termination zone on chromosome III of Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 4733-4741.