I. Introduction
HIV genome, like other retroviruses encode for Gag,
Pol and Env. In addition, it also encodes for 6 regulatory and accessory
proteins Tat, Rev, Nef, Vif, Vpr and Vpu. The major structural protein encoded
by env gene of HIV-1 consists of a
protein of 850-880 amino acids. Extensive glycosylation of this precursor
protein results in the production of Gp160 monomers, which then assemble into
oligomers for transport from ER to the plasma membrane (Earl et al, 1991).
During transport from Golgi, intracellular cleavage of Gp160 yields an outer
envelope glycoprotein Gp120 and trans-membrane glycoprotein Gp41 (Kozarsky et
al, 1989). Specifically, the HIV viral envelope protein Gp120 is important for
virus-receptor interaction and virus entry (Kowalski et al, 1987, Hill et al, 1997). Gp41 is
known to play a central role in the envelope glycoprotein oligomerization and
fusion function (Poumbourios et al, 1997). HIV infection results in the
production of HIV specific antibodies, therefore detection of these antibodies
by ELISA and Western blot assay remains the basis of blood donor and patient
screening. Serum specimen from HIV infected people regardless of their clinical
stage react efficiently with precursor glycoprotein Gp160 or its cleavage
product Gp120 and Gp41 (Goudsmit et al, 1987, Lange et al, 1986). Antibodies to
gag protein p24 are the earliest protein detectable by Western blot after
infection, however, these tend to decrease with progression of clinical
symptoms (Goudsmit et al, 1987, Lange et al, 1986). Recombinant antigen based
EIAs have been shown to be more sensitive, especially in detecting early
seroconverters and specific than peptide or virus lysate based EIAs (Galli et
al, 1996, Johnson 1992). The main objective of this study was to
obtain large quantities of purified recombinant protein, suitable to be used as
an immunogen and for development of HIV-1 detection kit. We used Baculovirus
expression vector system for expressing HIV-1 Gp160 as this system results in
efficient processing of the protein, post-translational modifications and is
known to give high yields of expressed protein.
II. Results
A. Generating a Recombinant Baculovirus:
Complete HIV-1 envelope glycoprotein along with the
regulatory protein Tat and Rev were PCR amplified from subtype B, BRU strain of
HIV-1 and cloned into pBacPAK9, baculovirus transfer vector, downstream to the
baculovirus polyhedrin gene promoter (Fig 1). Recombinant baculovirus transfer vector was
screened by colony hybridization followed by restriction enzyme analysis and
was termed as pBacBRU-TRE (Fig 2). Following co-transfection, recombinant
baculovirus was formed by the homologous recombination between pBacBRU-TRE and
Bsu361 digested BacPAK6 viral DNA in the region flanking the chimeric gene,
which allows its insertion into the genome of the wild type virus. The BacPAK6
DNA is missing an essential portion of the baculovirus genome, ORF1629, that is essential for viral replication (Possee et
al, 1991) When the DNA recombines with the vector (the transfer vector carries the missing ORF1629 sequence),
the essential element is restored and the target gene is transferred to the
baculovirus genome. Recombinant viruses were collected and selected by plaque
purification. Recombinant phenotype of the plaques is verified by Dot-Blot
analysis. Two of the plaques were found to be positive by Dot-Blot analysis and
were termed as P4 and P5 (Fig 3). Plaque P4 gave the stronger signal and
was therefore amplified and used for further infections.
B.
Expression of HIV-1 Envelope glycoprotein by Recombinant Baculovirus
Expression
of gp160 in Sf21 cells was examined by indirect immunofluorescence and western
blot analysis of infected cells using HIV-1 positive human polyclonal sera. A
3+ fluorescence was observed at 48-hrs post infection on a scale of 0 to 4+
that is from no fluorescence to intense fluorescence (Fig 4).
Figure 1. a)
pBacPAK9 baculovirus transfer vector, b) Recombinant plasmid pBacBRU-TRE. HIV-1 env, tat and rev gene released
on digestion of pSBRU-TRE was gel purified and subcloned into baculovirus
transfer vector pBacPAK9 predigested with restriction enzymes Xba 1 and Not 1.
Fig.2 a) Autoradiograph
showing recombinant colonies as detected by colony hybridization, b) Restriction enzyme analysis of the recombinant plasmid
pBacBRU-TRE with different enzymes. Lanes M: Lambda DNA digested with Hind III enzyme. Positions of the molecular weight markers
are indicated, 1: uncut; 2: pBacBRU-TRE digested with Bam H1; 3: pBacBRU-TRE digested with Hind III; 4: pBacBRU-TRE digested with Pvu II
Figure 3. Autoradiograph
showing dot blot analysis of cell lysates from plaque picks infected Sf21
cells. 2 plaques labeled as P4 and P5 were found to be positive. Cells infected
with wild type baculovirus AcNPv served as the negative control. pBRU plasmid
DNA served as the positive control.
These results were supported by western blot analysis
of the infected cells at 48hrs-post infection. Gp160 and its cleavage products,
Gp120 and Gp41, could be detected after immunostaining. Since the total
carbohydrate load added to the insect cell expressed glycoprotein is marginally
less than that added during secretion from a mammalian cell, the baculovirus
expressed glycoprotein are correspondingly smaller (105 kDa) than their
mammalian counterparts (120 kDa) No corresponding protein bands were detected
on from wild type baculovirus (AcNPv) infected cells and uninfected cells (Fig
5).
C.
Lymphocyte Proliferation Assay
In vitro T cell proliferative activity of splenocytes
from animals immunized with DNA vaccine pCIBRU-TRE alone (group D3), boosted
with P4 or vPE8/vPE16 (groups D3P2, D3V2) or P4 and vPE8/vPE16 alone (groups
D0P2, D0V2) was studied. (Table 1).
Splenocytes from all the animal groups showed positive proliferative response
on in vitro stimulation (Fig 6). Splenocytes from group D0P2 mice demonstrated
proliferation in response to P4 cell
Figure 4.
The photograph showing Immunofluorescence microscopy of the recombinant
baculovirus infected Sf21 cells at 48h-post infection. HIV-1 positive human
polyclonal serum served as the source of primary antibody.
Figure 5.
Western blot analysis of recombinant baculovirus expressed gp160. Lanes M:
protein high range molecular weight marker; 1: uninfected cell lysate; 2: cell
lysate from AcNPv infected cells; 3 & 4: cell lysate from recombinant
baculovirus infected cells.
lysate (SI-8.16), as well as to vPE8 and vPE16
antigens (SI of 4 and 5.6). Splenocytes from DNA vaccine immunized mice group
D3 and D3P2 proliferated with SI of 8.8 on stimulation with vPE8 and with SI of
3.8 and 4.4 respectively on stimulation with P4. Splenocytes from mice immunized with 2 doses of
vaccinia expressed recombinant Gp120/Gp160 with no DNA priming (Group D0V2)
showed better proliferation with vPE8, as compared with vPE16 and P4. However,
splenocytes from mice immunized with 3 doses of DNA followed by 2 doses of
vaccinia expressed recombinant Gp120/Gp160 (Group D3V2) gave almost equal
proliferation with P4, vPE8 and vPE16 respectively (Fig 6).
Figure 6.
In vitro T cell proliferative response to P4, vPE8 & vPE16 (recombinant
baculovirus expressed gp160) of splenocytes from Balb/c mice immunized with
pCIBRU-TRE (3 doses at biweekly intervals) and boosted with 2 doses of either
recombinant baculovirus (P4) or recombinant vaccinia virus (vPE8 & vPE16).
These groups of mice were marked as D3P2 or D3V2 respectively. Animals from
groups D0P2 and D0V2 were injected only with recombinant baculovirus or
recombinant vaccinia virus (no DNA priming).
Table 1.
Different groups of mice primed with pCIBRU-TRE DNA and boosted with
baculovirus expressed (P4) or vaccinia expressed
(vPE8 and vPE16) recombinant gp160.
|
Group |
pCIBRU-TRE |
P4 |
vPE8
and vPE16 |
|
D3 |
3
doses |
|
|
|
D0P2 |
|
2
doses |
|
|
D3P2 |
3
doses |
2
doses |
|
|
D0V2 |
|
|
2
doses |
|
D3V2 |
3
doses |
|
2
doses |
III.
Discussion
The main objective of this study was to prepare large
amounts of HIV-1 envelope protein, which may be used as a source of antigen for
studying immune response against HIV-1. HIV-1 gp160 with its signal sequence
along with the regulatory genes tat and
rev was used to produce
recombinant baculovirus (Malim et al, 1989, Rosen and Pavlakis., 1990, Roy et al, 1990, Ruben et al, 1989).
This system has several advantages over other systems including high level of
protein production and post-translational modification, which cannot be
achieved in bacterial system (Luckow and Summers 1988, 1989). We observed poor
expression of envelope proteins following infection of Sf21 cells as no protein
was observed after SDS-PAGE of the P4 infected Sf21 cell lysate followed by
coommassie blue staining. Several other studies have indicated that env protein
is refractory to efficient recombinant expression (Hu et al, 1987; Lasky et al,
1986). Replacement of the signal sequence of the HIV-1 envelope protein with
those of herpes simplex virus glycoprotein or human tPA results in efficient
expression (Berman et al, 1988 and Lasky et al, 1986). These studies therefore
suggest that the signal sequence of HIV-1 envelope gene, which consists of 5
positively charged amino acids, may be responsible for the poor expression. Li
et al, (1994), showed that substitution of the gp120 natural signal sequences with
the signal sequences from honeybee mellitin or murine interleukin 3 promotes a
high level of expression of a glycosylated form of gp120 and efficient
secretion. These heterologous signal sequences contain one (mellitin) or no
(IL-3) positively charged amino acids. These workers also demonstrated that on
stepwise substitution of positively charged amino acids with neutral amino
acids resulted in enhanced expression of HIV-1 gp120. Similarly, Golden et al,
1998, compared three different signal sequences [human tissue plasminogen
activator (tPA), human placental alkaline phosphatase (pap), or baculovirus
envelope glycoprotein (gp67)] and found that the tPA leader yielded the highest
level of secreted protein, followed by the gp67 and pap sequences.
In this study, however, HIV-1 gp160 and its complete
cleavage products were observed on Western Blot analysis using HIV-1 positive
human polyclonal sera. Suggesting thereby that the envelope protein retained
its antigenicity and may be used as a source of antigen for Western Blot
analysis. Immunogenicity as well as antigenicity of this baculovirus expressed
envelope protein was also demonstrated by lymphocyte proliferation assays.
Large-scale protein purification is being pursued for further studies.
IV.
Material and methods
A. Plasmids, cells, reagents and peptides
pCR-Script SK (+) cloning vector was purchased from
Stratagene, LaJolla, CA, USA. pBRU plasmid containing complete genome of BRU
strain of HIV-1 cloned in pUC18 was obtained through the AIDS Research and
Reference Reagent Program, Division of AIDS, NIAID, NIH, Bethesda, MD, USA.
BacPAK, Baculovirus expression system was purchased from Clontech (BD
Biosciences Clontech, Palo Alto, CA).
Plasmids were grown in DH5a strains of Escherichia coli
(Life Technologies, Gaithesburg, MD, USA), and purified using Wizard miniprep
columns (Promega Corp, Madison, WI). TNM-FH media for insect cell culture was
obtained from HyClone (Genetix, New Delhi, India). TNM-FH medium contains
Grace's medium, lactalbumin hydrolysate and yeast extract. Sf 21 cells were
cultured at 27oC in TNM-FH medium supplemented with 10% FBS
(TNM-FH/FBS). Vaccinia expressed recombinant gp120 and gp160 (vPE8 and vPE16)
were obtained through NIH AIDS Research and Reference Reagent Program.
B. DNA Constructs
3kb env-tat-rev gene
segment (nt 5352- nt 8354) of HIV-1 subtype B strain, BRU, was PCR amplified
using primers API (5352-5390) TTATTCTAGAGAGAAGAGCAAGAAATGGA
TCCAGTAGAT and APII (8316-8354) TTTTTGAGCTCTTGCCACCCATTTTAAAGTAAAGACCTT
and cloned into pCR-Script (SK+) cloning vector to produce pSBRU-TRE as
described earlier (Arora and Seth, 2001). The 3kb HIV-1 env-tat-rev gene segment was released by restriction digestion of
pSBRU-TRE with Xba I, Not I and Bgl
I. The env, tat and rev
gene fragment was then purified from low melting point agarose gel and
subcloned into baculovirus transfer vector, pBacPAK9 predigested with Xba I and Not
I to generate pBacBRU-TRE. Recombinant clone was screened by colony
hybridization followed by restriction enzyme analysis. pCIBRU-TRE, mammalian
expression vector expressing 3kb HIV-1 env-tat-rev gene under the control of Immediate-Early
Promoter/Enhancer of CMV, used in this study for immunizing Balb/c mice has
been described earlier (Arora and Seth, 2001).
C. Generating a Recombinant Virus
Recombinant virus was prepared as per manufacturer's
instructions. Briefly, 35mm tissue culture dishes were seeded with 1x106
Spodoptera frugiperda cells
(Sf21) (Vaughn et al, 1977) in 1.5
ml of complete TNM-FH/FBS medium and incubated overnight at 27oC in
a humid chamber. 500ng of plasmid pBacBRU-TRE DNA, along with Bsu 361 digested BacPAK6 viral DNA was mixed with 5mg of lipofectin and incubated at room temperature for
15 min. Culture medium in the tissue culture dishes containing Sf21 cells was
replaced with 1.5 ml of serum free TNM-FH. Lipofectin-DNA complex was then
gently added to Sf21 cells. Plates were incubated at 27oC for 5 hrs.
Thereafter, serum free TNM-FH medium was replaced with TNM-FH/FBS medium and
the plates were returned for incubation at 27oC for 4 days.
D. Isolation of Recombinant virus
Plaque assay was performed using co-transfection
supernatant to generate a pure clone of recombinant virus. 1x106
Sf21 cells were seeded in 35mm tissue culture dishes and incubated overnight at
27oC. These cells were then infected with 100ml of neat or 10-1 dilution of
co-transfection supernatant. One hour later, the virus inoculum was removed and
infected cells were overlaid with 1.5ml of agarose (1.5% in TNM-FH/FBS). After
agarose was set 1.5 ml of TNM-FH/FBS medium was added to each dish and
incubated for 4 days at 27oC. Plaques were stained with .03% of
neutral red solution. 4 plaques were picked up and transferred into an
eppendorf tube containing 500ml of TNM-FH/FBS and stored at 4oC overnight.
E. Virus Propagation and Evaluation
The plaque picks were used as a source of virus to
infect cells in a 96 well plate. Infections were performed in duplicate. Cells were harvested 4 days following
infection and cell lysate was used to perform dot blot analysis to detect the
recombinant virus. Each sample was suspended in 200ml of 0.5N NaOH and 20ml of 10M-ammonium acetate. Samples were then spotted on to the nitrocellulose membrane
by loading on the wells of the dot blot manifold apparatus (Bio Rad Laboratory,
Richmond, CA). Vacuum suction was applied to drain off the entire solution.
Membrane was dried at room temperature for 5-10 min and then baked for 2 hrs at
80oC. Hybridization was performed using a32P-dCTP labeled envelope probe prepared by
random primer labeling using Klenow fragment of DNA polymerase 1 (Amersham
Biosciences, Piscataway, NJ). The membrane was then washed and exposed to a
Kodak-X film overnight at -70oC.
F. In Vitro Expression
A time course experiment was performed to examine the
expression of HIV-1 env gene in Sf
21 cells infected with the recombinant virus. Cells were harvested at various
time intervals post infection. SDS PAGE, immunofluorescence and Western Blot
analysis of cell lysate were conducted to study expression of proteins.
SDS-PAGE was performed according to Laemmli. For Western Blot analysis proteins
were resolved by SDS-PAGE and transferred onto a nitrocellulose membrane using
Trans-blot SD semi-dry electrophoretic transfer Cell (Bio Rad Laboratories) The
membrane was treated with non-fat powdered milk in TTBS (Tween 20- Tris buffer
Saline) for 1 hr at room temp. and reacted with HIV-1 positive human polyclonal
serum (at a dilution of 1:200) in TBS for 1h at room temperature. After washing
thrice with TTBS, the membrane was incubated at room temperature for 1 hr. with
anti-human IgG conjugated with alkaline phosphatase (1:10,000). Membrane was
then washed thrice with TTBS and incubated in the substrate solution (Sigma
fast BCIP/NBT tablet dissolved in 10ml of deionized water, Sigma Chemicals Co.,
St. Louis). For Immunofluorescence, P4 (recombinant baculovirus) infected
cells, uninfected cells (control) and AcNPv (wild type virus) infected cells were harvested at different
time points and washed thrice with PBS.
1x104 cells were spotted onto the wells of a teflon-coated
slide and fixed with acetone: methanol (1:1) at -20oC for 30 min.
For staining, cells were allowed to react with HIV-1 positive human polyclonal
serum (1:50) for 1h at 37oC. Cells were then washed with PBS and
incubated with FITC conjugated anti-human IgG (Sigma) and incubated for 1hr at
37oC. Thereafter, the cells were washed and mounted with glycerol
buffer and visualized under fluorescent microscope.
G.
T Cell Proliferation Assay
3H thymidine uptake assay
was used to measure the proliferation of splenocytes after antigenic
stimulation. Balb/c mice were immunized intramuscularly with pCIBRU-TRE or pCI
(control vector) DNA as described earlier (Arora and Seth, 2001). Six groups of
Balb/c mice were taken (each group comprising 5 mice) (Table 1). In-group D3
three doses of 100 mg DNA each were given at bi-weekly intervals. In D0P2
group animals were immunized with 2 doses of P4 with no DNA priming. In-group
D3P2 animals were immunized with 3 doses of pCIBRU-TRE DNA followed by 2 doses
of P4. Group D3V2 consisted of mice immunized with 3 doses of pCIBRU-TRE
followed by 2 doses of recombinant vaccinia virus expressed gp120 and gp160
(vPE8 and vPE16). D0V2 group consisted of mice immunized with 2 doses of vPE8
and vPE16 with no priming with DNA construct and control group. Stimulating
antigens included vaccinia
expressed recombinant gp160/gp120 (vPE16/ vPE8) and baculovirus expressed gp160
(P4). Splenocytes from various groups of mice were harvested and re-suspended
at a concentration of 2x106 cells/ml in RPMI 1640 medium
supplemented with 10% FCS. Cells were stimulated in triplicate. Five mg/ml of vPE16/vPE8 infected vero cell
lysates/ P4 infected Sf21 cell lysates was used in cell proliferation assay.
Lysates of wild type vaccinia virus (WR) infected Vero cells/ wild type
baculovirus (AcNPv) infected Sf21 cell lysate was used as control to study the
non specific 3H-thymidine uptake due to wild type vaccinia/vero cell
proteins or wild type baculovirus/Sf21 cell protein in the cell lysates.
Stimulation index was calculated by the following formula.
