Gene Ther Mol Biol Vol 13, 186-193, 2009

The aberrant expression of bone morphogenetic protein 12 (BMP-12) in human breast cancer and its potential prognostic value

Research Article

Jin Li¹, Lin Ye¹, Christian Parr¹, Anthony Douglas-Jones¹, Howard G. Kynaston¹, Robert E. Mansel¹, Wen G. Jiang¹*

¹Metastasis & Angiogenesis Research Group, Cardiff University School of Medicine, Heath Park, Cardiff, CF14 4XN

_____________________________________________________________________________________________

*Correspondence: Wenguo Jiang, Metastasis & Angiogenesis Research Group, Department of Surgery, Cardiff University School of Medicine, Heath Park, Cardiff, CF14 4XN, UK; Tel: 0044 (0) 29 2074 2895; Fax: 44 29 2074 2896; E-mail: jiangw@cf.ac.uk

Keywords: Bone morphogenetic protein-12 and breast cancer

Received: 10 June 2009; Revised: 11 June 2009;

Accepted: 10 June 2009; electronically published: 15 June 2009

Summary

Background and aims: Bone morphogenetic proteins (BMPs) play important roles in the development and progression of breast cancer via the regulation of cellular proliferation, differentiation, apoptosis, motility of tumor cells and angiogenesis. BMP-12 is a new member of the BMP family and has been implicated in the development of certain tissues. However, its role in breast cancer is largely unknown. The current study investigated the expression pattern of BMP-12 in a breast cancer cohort and evaluated the possible correlation between BMP-12 and clinical and pathological features. Method: BMP-12 transcripts were examined in a variety of breast cancer cell lines using RT-PCR. The expression of BMP-12 transcripts in primary breast cancer tissues (n=112) and normal mammary tissues (n=31) was determined using quantitative real time PCR. The expression and cellular distribution of BMP-12 was further examined using immunohistochemical staining. The transcript level of BMP-12 was analysed against the clinical, pathological and follow-up (10 years) data. Results: BMP-12 transcript was detected at a lower level in breast cancer cell lines and breast tumour tissues. Immunohistochemical staining revealed significantly lower levels of BMP-12 staining in breast tumors than in normal tissues. It showed a trend that BMP-12 transcript levels were higher in tumors from patients with a good prognosis compared with those with a poor prognosis. Tumors from patients with longer overall survival also had a higher level of the transcript than those from patients with a shorter survival. Conclusion: BMP-12 expression is decreased in breast tumors, and is correlated with poor prognosis. It suggests that BMP-12 may be an inhibitory factor during the disease progression and may have potential prognostic implications in breast cancer.

I. Introduction

In Europe and in the USA, 1 in 10 women will be affected by breast cancer in their lifetime. Despite recent advances in the diagnosis and treatment of breast cancer, this disease continues to be a major cause of death in females (Jemal et al, 2008). The clinical outcome is dependent upon a number of factors including the size of primary tumor, histological type, grade, lymph node involvement, and distant metastasis. The most common site of breast cancer metastasis is bone. This leads us to focus on the mechanism of bone metastasis, which involves the interactions between cancer cells and bone marrow endothelial cells, osteoblasts, osteoclasts, and their microenvironment.

Bone Morphogenic Proteins (BMPs) are osteogenic factors abundant in bone matrix and also play important roles in various physiological and pathophysiological conditions, including embryonic development, organogenesis, bone formation, reproduction, adult tissue homeostasis, bone development and bone metastasis. They are highly related molecules, which form a subgroup of the transforming growth factor-β (TGF-β) super family. BMPs comprise an amino-terminal pro-region and a carboxy-terminal ligand of 110-140 amino acids in length, which are synthesized as large precursor proteins, processed into mature proteins, and secreted as homo- or heterodimers (Ozkaynak et al, 1990; Wozney et al, 1990; Wozney et al, 1988). BMPs regulate target gene transcription by signalling through specific serine-threonine receptors and intracellular Smad proteins (Itoh et al, 2000). Six of the Type-I receptors and three of the Type-II receptors have been indicated in the BMP signalling, with BMPR-IA, BMPR-IB (Type-I) and BMPR-II (Type-II) being specific for BMPs (Shi and Massague, 2003).

BMP and BMP signalling have been indicated in the tumorigenesis and progression of various solid tumors (Ye et al, 2007). Aberrations in BMPs’ expression and signalling have also been indicated in breast cancer and are associated with disease progression and prognosis. For example, decreased expressions of BMP-2, BMP-7, GDF-9a and BMP-15 have been seen in primary breast tumours and are correlated with poor prognosis (Buijs et al, 2007; Davies et al, 2008; Hanavadi et al, 2007). Most interestingly, a decrease in BMP-7 expression in primary breast tumors associates with bone metastasis. Experimental data from an in vivo bone metastasis model further supports an inhibitory role of BMP-7 in bone metastasis from breast cancer (Buijs, Henriquez et al, 2007). In contrast to these observations, elevated expression of some BMPs, such as BMP-4, BMP-5 and BMP-7 has also been implicated in breast cancer (Alarmo et al, 2008; Alarmo et al, 2007; Alarmo et al, 2006; Bobinac et al, 2005; Raida et al, 2005). Collectively, these evidences suggest that BMPs play important roles during the disease progression and bone metastasis. Apart from the aberrant expression of BMPs in breast, perturbed expression of BMP receptors and downstream signalling were also indicated in the development and progression of breast cancer, particularly the disease specific bone metastasis (Bokobza et al, 2009; Helms et al, 2005; Katsuno et al, 2008).

Bone morphogenetic protein-12 (BMP-12), also known as growth differentiation factor 7 (GDF-7), was first identified in 1994 (Storm et al, 1994). It shares high identity in amino acid sequence at carboxyl terminal with GDF-5 and GDF-6. GDF-7 has been indicated in the development and maintenance of various tissues, including bone, cartilage, tendon, neural tissue and tooth (Lee et al, 1998; Lo et al, 2005; Maloul et al, 2006; Mikic et al, 2008; Morotome et al, 1998). However, the role played by BMP-12 in cancer remains unknown. Present study aimed to examine the expression of BMP-12 in human breast cancer and assess the correlations with pathological features and clinical outcomes.

II. Materials and methods

A. Cell culture

Breast cancer cell lines were purchased from the European Collection of Animal Cell Cultures (ECACC, Salisbury, England). Cells were routinely cultured in DMEM / Ham’s F12 with L-Glutamine (PAA Laboratories, Somerset, UK) supplemented with streptomycin, penicillin and 10% foetal bovine serum (PAA Laboratories, Somerset, UK), in an incubator at 37.0^oC, 5% CO₂ and 95% humidity.

B. Tissues and patients

Breast cancer tissues (n=112) and normal background tissues (n=31) were collected during operation and stored in deep freezer until use. Patients were routinely followed clinically. The median follow up for the cohort was 10 years. The presence of tumor cells in the collected tissues was verified by a consultant pathologist (ADJ) using H&E staining of frozen sections. Clinical details of patients are provided in Table 1.

C.Tissue processing and preparation of RNA and cDNA

Tissue samples were homogenized in RNA extraction reagent (TRI reagent, Sigma-Aldrich Ltd, Poole, England, UK) to extract total RNA. The concentration of RNA was determined using a spectrophotometer. 0.5µg RNA was used in a 20µl reverse transcription reaction to generate cDNA using a RT kit (AbGene Laboratories, Essex, England).

D. Screening of BMP-12 transcripts expression in breast cell lines using PCR

Primers were designed using the Beacon Designer software (version 2, Biosoft International, Palo Alto, California, USA), to amplify regions of human BMP-12 that have no significant overlap with other known sequences and that the amplified products span over at least one intron, based on sequence accession number AB158468. The primers used were: 5' GCAGAGGAAAGAGAGCTTAT 3’ and 5' GATGTAGAGGATGCTGATGG 3’. Reactions were carried out at the following conditions: 94°C for 5 minutes, 36 cycles of 94°C for 1 minute, 55°C for 40 seconds and 72°C for 1 minute, followed by a final extension at 72°C for 10 minutes. PCR products were separated on a 2% agarose gel and photographed using a digital camera mounted over a UV transluminator. β-actin was used as a housekeeping gene: 5' ATGATATCGCCGCGCTCG 3’ and 5' CGCTCGTGTAGGATCTTCA 3’.

E. Determination of BMP-12 Transcripts in Breast Tissues Using Quantitative PCR

The real time quantitative PCR was carried out to determine the levels of BMP-12 transcripts in the breast cancer cohort. The assay was based on the Amplifuor technology and primers were designed by Beacon Designer software which included complementary sequence to universal Z probe (Intergen Inc., Oxford, United Kingdom), as we previous reported (Jiang et al, 2005; Parr et al, 2004)

Primers used for BMP-12 quantitation were 5’ GATCACCGGCTTCACAGA 3’ and 5’ ACTGAACCTGACCGTACAGTCGTTAAGGCT 3’ and for housekeeping GAPDH 5’ GGCTGCTTTTAACTCTGGTA 3’ and 5’ GACTGTGGTCATGAGTCCTT 3’. Each 10µl reaction contains 5µl of Hot-start Q-master mix (Abgene), 10 pmol of specific forward primer, 1 pmol reverse primer which has the Z sequence, 10 pmol of FAM-tagged universal Z probe (Intergen Inc., Oxford, United Kingdom), and 50ng cDNA. The Q-PCR was carried out on IcyclerIQ™ (Bio-Rad, Hemel Hemstead, England, UK), which is equipped with an optic unit that allows real time detection of 96 reactions. The following condition was used in the reaction: 94°C for 12 minutes, 60 cycles of 94°C for 15 seconds, 55°C for 40 seconds (the data capture step) and 72°C for 20 seconds. The levels of the transcripts were generated from an internal standard that was simultaneously amplified with the samples. Cytokeratin-19 (CK19) was used to normalise cellularity during the analysis and primers for CK19 were 5'CAGGTCCGAGGTTACTGAC 3’; and 5'ACTGAACCTGACCGTACACACTTTCTGCCAGTGTGTCTTC 3’, respectively. Data are shown here as either the number of transcripts (mean number of BMP-12 transcript per 50ng total RNA) or as BMP-12: CK19 ratio.

Table 1. Demographic information of the study cohort

F. Immunohistochemical Staining of BMP-12 in Breast Specimen

This was based on the method previous described (Kang et al, 2005; Martin et al, 2003). Briefly, frozen breast tissues were cut into 5µm sections using a cryostat (Leica Microsystems (UK) Ltd., Bucks, UK). The sections were mounted on super frost plus microscope slides, fixed in a 1:1 mixture of acetone and methanol for 20 minutes and air-dried. The sections were stored at -20^oC. Staining for each molecule was conducted on all the slides at the same time in a single batch to avoid variance in experimental conditions. The sections were then placed in Optimax wash buffer (BioGenex, San Ramon, USA) for 5 – 10 minutes to rehydrate. Sections were incubated for 20 mins in a blocking solution that contained 10% horse serum and probed with the primary antibody (rabbit anti-human BMP-12), at a concentration of 1:100, for 60 minutes). The dilution chosen here was based on an evaluation test, during which the antibody was tested over a range of dilution from 1:10 to 1:1000. Primary antibodies were omitted in the negative controls. Unbound primary antibody was then removed by washing the sections 4 times in wash buffer. A universal secondary antibody (Vectorstain ABC Kit, Vector Laboratories Inc., Burlingame, USA) was then applied for 30 minutes at room temperature. Following washings, Avidin Biotin Complex (Vector Laboratories) was then applied to the sections followed by extensive washings. Diaminobenzidine chromogen (Vector Labs) was then added to the sections, which were incubated in the dark for 5 minutes. Sections were then counter-stained in Gill's Haematoxylin and dehydrated in ascending grades of methanol before clearing in xylene and mounting under a cover slip.

G.Statistical Analysis

Statistical analysis was performed using the Minitab statistical software package (version 14). Non-normally distributed data was assessed using the Mann-Whitney test, while the two samples t-test was used for normally distributed data. Kaplan-Meier survival analysis and Cox hazardous proportion analysis were performed using SPSS statistical software (version 12, SPSS Inc. Chicago, IL, USA). Differences were considered to be statistically significant at p<0.05.

III. Results

A. The Expression of BMP-12 in breast cancer cell lines and tissues

The presence of the BMP-12 transcript was examined in a panel of breast cancer cell lines and normal human breast tissue using conventional RT-PCR. We found that BMP-12 transcripts were expressed in normal human breast tissue, but not detectable in most breast cancer cell lines except for MDA-MB-157, which weakly expressed the gene transcript. There was no significant difference in the levels of BMP-12 transcripts in the more aggressive breast cancer cell lines (MDA-MB-231), in comparison with the less aggressive cell lines (MCF-7, ZR-7 51, MDA-MB-436, MDA-MB-157, BT549) (Figure 1).

To verify the expression of BMP-12 in breast tissue, we examined its protein expression using immunohistochemistry. The immunochemical staining of BMP-12 revealed stronger staining in normal breast tissues compared to breast cancer tissue. Figure-2 displays BMP-12 staining in normal tissues (Figure 2A), and its distribution was mainly confined to the cytoplasm of mammary epithelial cells. Compared to the normal cells, the expression of BMP-12 was very weak in cancer cells of tumor tissues (Figure 2A). The staining of BMP-12 protein, as shown by staining intensity was significantly decreased in breast cancer tissues, p=0.0041 vs. normal tissues (Figure 2B). The levels of BMP-12 transcript were also determined in the breast cancer cohort using quantitative PCR. There was no significant difference seen between breast cancer tissues (82.8+/-648.5) and normal tissues (60.8+/-233.7), p=0.19..

B. BMP-12 transcripts level and lymph nodal status, pathological types, tumor grade and TNM staging

We further analysed the levels of BMP-12 transcript in connection with other indicators of prognosis: the nodal status of patients, Tumor Node Metastasis staging (TNM) and tumor grade. There was no significant difference shown by the data, but a trend is seen in reference to nodal status. The patients with lymphatic metastases had lower levels of BMP-12 (8.9±33.8), p=0.26 compared to the node negative group (159±920). The same trend was also observed in the connection to TNM status. BMP-12 transcripts levels were decreased in the advanced breast cancer, particularly in TNM 3 and TNM 4, which were 0.441±0.978 and 7.06±14.11, p=0.23 and p=0.29 in comparison with that of TNM1 (147±884) respectively (Figure 3).

C. Potential correlation of reduced BMP-12 expression with poor prognosis

We analysed the levels of BMP-12 transcript against predicted prognosis of the patients, which used Nottingham Prognostic Index (NPI) as an indicator. Based on the NPI scores, patients can be divided into three groups; with good prognosis (NPI 1, <3.4), moderate (NPI 2, 3.4-5.4) and poor prognosis (NPI 3, >5.4). It showed that the patients with moderate and poor prognosis had lower levels of BMP-12 expression; 11.57±39.63 of NPI-2 group and 2.18±7.83 of NPI-3 group, p=0.27 and p=0.24 compared with that of good prognosis group (159±920), respectively (Figure 3).

The association of BMP-12 transcript expression with clinical outcomes of the patients was also analysed based on the follow-up data. It showed decreased BMP-12 transcript levels (7.42±30.95) in patients with poor prognosis, including those with local recurrence, metastases and died of breast cancer, p=0.25 compared to that of patients remained disease free (113.9±768.2) (Figure 3). The Kaplan-Meier survival model was used to analyze the overall survival status of patients with breast cancer. It was found that patients with higher BMP-12 transcript levels had a longer overall survival (148.4 months, 95% CI 134.1-162.6) compared to those with low levels (119.9 months, 95%CI 107.9-132.1), although this is yet to reach statistical significance (p=0.179) (Figure 4). It is interesting to note that 9 of the patients in the present cohort developed bone metastasis. The tumours from patients with bone metastasis had a lower levels of BMP-12 transcripts when compared with those who remained disease free (17.8±16.4 vs 113.9±92.5), however the difference is not statistically significant (p=0.69).

D. BMP-12 transcripts level and Estrogen Receptor Status

We also quantified the BMP-12 expression levels in the patients sub grouped as ER-α and ER-β negative or positive. The ratio of BMP-12 and CK19 showed a trend that BMP-12 reduced in the patients with ER-α negative (15.54+9.59) or ER-β positive tumors (0.7+0.54), respectively compared to the ER-α positive (213+205) and ER-β negative (102+86.1), although the differences were yet to reach statistical significance (p=0.34, p=0.24 respectively).

IV. Discussion

BMP-12, also known as GDF-7 plays profound role in regulating development and homeostasis of a variety tissues, such as bone, tendon, tooth and nerve. In the present study, we first examined its expression in breast cancer, including breast cancer cell lines and human breast cancer tissues. BMP-12 was expressed at lower level or absent in most examined breast cancer cell lines in comparison with the normal breast tissue and placenta. The expression of BMP-12 mRNA was first revealed in human breast tissue, the existence of BMP-12 in the breast tissue was further confirmed by immunohistochemical staining of BMP-12 in human breast tissue, which was confined to cytoplasm of mammary epithelial cells. IHC also demonstrated a decreased staining of BMP-12 in breast tumors compared to normal background tissues. This is consistent with the decreased or loss of BMP-12 expression in breast cancer cell lines. It suggests that BMP-12 is reduced/lost in breast cancer cell lines and in mammary tumours, a pattern of expression arguing a potential role played by BMP-12 in breast cancer.

BMPs have been implicated in the disease progression and bone metastasis of breast cancer. During the disease progression, certain BMPs are decreased, which indicate these BMPs may be inhibitory factors against breast cancer cells. For example, the BMP-2, BMP-6, BMP-7, GDF-9a and BMP-15, are shown to be decreased in the primary tumors of the breast, and their reduced expression associate with disease progression and poor prognosis (Buijs, Henriquez et al, 2007; Davies, Watkins et al, 2008; Hanavadi, Martin et al, 2007). It is noteworthy that the decreased BMP-7 expression is also linked to the disease specific bone metastasis, which is further supported by in vivo bone model experimental evidence. In contrast, some BMPs are up regulated in the breast cancer, and may contribute to the disease progression and bone metastasis, such as BMP-4, BMP-5 and BMP-7 (Alarmo, Korhonen et al, 2008; Alarmo, Kuukasjarvi et al, 2007; Alarmo, Rauta et al, 2006; Bobinac, Maric et al, 2005; Raida, Clement et al, 2005). In the current study, we first noted that BMP-12 was decreased in the breast cancer.

Figure 1: Screening for BMP-12 transcript expression in a range of human cancer cell lines, with normal human mammary tissues as a positive control. MCF-7 cell line was derived in 1970 from pleural effusion. MDA-MB-435 has been shown to be from a melanoma. MDA-MB-453 is tetraploid cell line from mammary gland breast. BT549 is a breast cancer cell line, though by expression analysis is atypical. Actin was used as the house keeping control. O and N indicate cells of different passages. MDA-MB-157 and normal mammary tissues showed the corrected sized products. A clear band at larger size appeared in BT474 and BT549 cells. The nature of the product as a possible expression variant is currently under investigation.

Figure 2: A. Immunohistochemical staining of human breast specimens. Left, normal breast tissue. BMP-12 was found to be well stained in the normal mammary epithelial cells. Right, breast cancer tissue. Staining of breast cancer cells for BMP-12 is seen to be weakly positive in the breast tumor specimens when compared to the normal ones. B. Staining intensity for BMP-12 in tumor tissues (relative density 16.4±17.2) was significantly decreased (p=0.0041, indicated by * in B), compared to normal tissues (30.895±14.8). Insert: negative control for IHC staining. Arrows indicate BMP-12 positive cells.

Figure 3: Quantitative analysis of BMP-12 in human mammary tissues, using quantitative RT-PCR. Shown in the figures are mean numbers of BMP-12 transcript per 50ng total RNA. A. Quantitative PCR analysis of BMP-12 expression in human breast cancer. BMP-12 expression is increased in breast cancer tissue compared with normal tissue, though P-value is not significant (p=0.19). B. NPI. Patients with a good prognosis have more BMP-12 expressed in tumors than the tumors of patients with poor prognosis; p-value is not significant (p=0.12). C. Comparison of BMP-12 expression between the TNM classification groups. A decreased trend was seen in the advanced TNM status, particularly in TNM 3 and TNM 4, which were 0.441±0.978 and 7.06±14.11, p=0.23 and p=0.29 in comparison with that of TNM1 (147±884) respectively. D. Tumor grade. There’s no significant relationship between tumor grade and BMP-12 (p=0.23). E. Correlation between BMP-12 and clinical outcome. The patients with poor outcome express lower level of BMP-12 compared with those with good outcome, and p-value is 0.067. F. Correlation between BMP-12 and node status. The mean copy number of group with negative node status was 159, while the positive group had lower level at 8.9 (P=0.26). Shown is BMP-12 transcripts levels, which have been normalised against the corresponding CK19 levels.

Decreased BMP-12 transcript levels were seen in patients with advanced diseases (TNM3 and TNM4) compared to those with early stage of breast cancer. This indicates lower level of BMP-12 expression may associate with lymph node metastasis and distant metastasis of the disease. It was further confirmed when compared BMP-12 transcript levels of patients with nodal metastases to that of patients without lymph node involvement, in that lower levels of BMP-12 transcript was seen in nodal negative group. This suggests an inhibitory function of BMP-12 against the disease progression, particularly during tumor cells disseminate to local lymph nodes and distant sites.

Aberrations in expression of certain BMPs have been associated with poor prognosis in breast cancer. In the current study, we also analysed the BMP-12 transcript levels against the NPI score and follow-up data. Lower levels of BMP-12 transcript were seen in the patients with poor prognosis, including local recurrence, metastasis and die of breast cancer, compared with that of patients remaining disease free. In term of overall survival, patients with higher levels of BMP-12 expression have longer survival.

The current study has also observed a potential link between BMP-12 and ER status. Expression of ER-β in breast cancer is a predictive marker for anti-hormonal treatment and generally associated with better prognosis and the level of ER-β is significantly decreased in higher-grade tumors, which is opposite to ER-α. In this study, the BMP-12 reduced in ER-α negative group, which is consistent with the reduction in ER-β positive group. It indicates that BMP-12 could be regulated by estrogen and its reduction may have some relationship with prognosis.

Figure 4: Levels of BMP-12 transcript and patients long-term survival, using Kaplan-Meier survival analysis. Patients with higher BMP-12 transcript levels had a longer overall survival (148.4 months, 95% CI 134.1-162.6) compared with those with lower levels (119.9 months, 95% CI 107.9-132.1), p=0.179.

Thus, the present study presents evidence for the first time that BMP-12 is expressed at a low level in breast tumour and particular in aggressive breast tumors. To date, there is little knowledge on the molecular and cellular impact of BMP-12 on breast cancer cells. BMP-12 was initially described as a differentiation factor for certain cell types, i.e.oocytes. Presently, there is no report on a direct impact of BMP-12 on breast cancer cells and indeed on any other solid tumour cell types. One reason is the lack of available recombinant BMP-12 for investigation. We are currently exploring ways of generating human recombinant BMP-12 in order to conduct in vitro investigations.

In conclusion, the current study shows decreased expression of BMP-12 in human breast cancer compared to normal breast tissue. This reduction in BMP-12 expression may associate with disease progression and poor prognosis. It suggests BMP-12 may be a putative inhibitory factor in breast cancer. However, further investigation is needed to fully understand the role played by BMP-12 in breast cancer and evaluate the prognostic and therapeutic potentials. Furthermore, a larger tumor cohort may further help to decipher a clearer correlation between BMP-12 and disease progression, for which we are currently investigating.

Acknowledgements

The authors would like to thank Cancer Research Wales and The Fong Family Foundation for supporting their work.

References

Alarmo, E. L., Korhonen, T., Kuukasjarvi, T. et al, (2008) Bone morphogenetic protein 7 expression associates with bone metastasis in breast carcinomas. Ann Oncol 19, 308-14.

Alarmo, E. L., Kuukasjarvi, T., Karhu, R. and Kallioniemi, A. (2007) A comprehensive expression survey of bone morphogenetic proteins in breast cancer highlights the importance of BMP4 and BMP7. Breast Cancer Res Treat 103, 239-46.

Alarmo, E. L., Rauta, J., Kauraniemi, P. et al, (2006) Bone morphogenetic protein 7 is widely overexpressed in primary breast cancer. Genes Chromosomes Cancer 45, 411-9.

Bobinac, D., Maric, I., Zoricic, S. et al, (2005) Expression of bone morphogenetic proteins in human metastatic prostate and breast cancer. Croat Med J 46, 389-96.

Bokobza, S., Ye, L., Kynaston, H., Mansel, R. E. and Jiang, W. G. (2009) Reduced expression of BMPR-IB correlates with poor prognosis and increased proliferation of breast cancer cells. Cancer Genomics Proteomics in press.

Buijs, J. T., Henriquez, N. V., van Overveld, P. G. et al, (2007) Bone morphogenetic protein 7 in the development and treatment of bone metastases from breast cancer. Cancer Res 67, 8742-51.

Davies, S. R., Watkins, G., Douglas-Jones, A., Mansel, R. E. and Jiang, W. G. (2008) Bone morphogenetic proteins 1 to 7 in human breast cancer, expression pattern and clinical/prognostic relevance. J Exp Ther Oncol 7, 327-38.

Hanavadi, S., Martin, T. A., Watkins, G., Mansel, R. E. and Jiang, W. G. (2007) The role of growth differentiation factor-9 (GDF-9) and its analog, GDF-9b/BMP-15, in human breast cancer. Ann Surg Oncol 14, 2159-66.

Helms, M. W., Packeisen, J., August, C. et al, (2005) First evidence supporting a potential role for the BMP/SMAD pathway in the progression of oestrogen receptor-positive breast cancer. J Pathol 206, 366-76.

Itoh, S., Itoh, F., Goumans, M. J. and Ten Dijke, P. (2000) Signaling of transforming growth factor-beta family members through Smad proteins. Eur J Biochem 267, 6954-67.

Jemal, A., Siegel, R., Ward, E. et al, (2008) Cancer statistics, 2008. CA Cancer J Clin 58, 71-96.

Jiang, W. G., Davies, G., Martin, T. A. et al, (2005) Targeting matrilysin and its impact on tumor growth in vivo: the potential implications in breast cancer therapy. Clin Cancer Res 11, 6012-9.

Kang, H., Watkins, G., Parr, C. et al, (2005) Stromal cell derived factor-1: its influence on invasiveness and migration of breast cancer cells in vitro, and its association with prognosis and survival in human breast cancer. Breast Cancer Res 7, R402-10.

Katsuno, Y., Hanyu, A., Kanda, H. et al, (2008) Bone morphogenetic protein signaling enhances invasion and bone metastasis of breast cancer cells through Smad pathway. Oncogene 27, 6322-33.

Lee, K. J., Mendelsohn, M. and Jessell, T. M. (1998) Neuronal patterning by BMPs: a requirement for GDF7 in the generation of a discrete class of commissural interneurons in the mouse spinal cord. Genes Dev 12, 3394-407.

Lo, L., Dormand, E. L. and Anderson, D. J. (2005) Late-emigrating neural crest cells in the roof plate are restricted to a sensory fate by GDF7. Proc Natl Acad Sci U S A 102, 7192-7.

Maloul, A., Rossmeier, K., Mikic, B., Pogue, V. and Battaglia, T. (2006) Geometric and material contributions to whole bone structural behavior in GDF-7-deficient mice. Connect Tissue Res 47, 157-62.

Martin, T. A., Parr, C., Davies, G. et al, (2003) Growth and angiogenesis of human breast cancer in a nude mouse tumour model is reduced by NK4, a HGF/SF antagonist. Carcinogenesis 24, 1317-23.

Mikic, B., Ferreira, M. P., Battaglia, T. C. and Hunziker, E. B. (2008) Accelerated hypertrophic chondrocyte kinetics in GDF-7 deficient murine tibial growth plates. J Orthop Res 26, 986-90.

Morotome, Y., Goseki-Sone, M., Ishikawa, I. and Oida, S. (1998) Gene expression of growth and differentiation factors-5, -6, and -7 in developing bovine tooth at the root forming stage. Biochem Biophys Res Commun 244, 85-90.

Ozkaynak, E., Rueger, D. C., Drier, E. A. et al, (1990) OP-1 cDNA encodes an osteogenic protein in the TGF-beta family. Embo J 9, 2085-93.

Parr, C., Watkins, G. and Jiang, W. G. (2004) The possible correlation of Notch-1 and Notch-2 with clinical outcome and tumour clinicopathological parameters in human breast cancer. Int J Mol Med 14, 779-86.

Raida, M., Clement, J. H., Ameri, K. et al, (2005) Expression of bone morphogenetic protein 2 in breast cancer cells inhibits hypoxic cell death. Int J Oncol 26, 1465-70.

Shi, Y. and Massague, J. (2003) Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685-700.

Storm, E. E., Huynh, T. V., Copeland, N. G. et al, (1994) Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature 368, 639-43.

Wozney, J. M., Rosen, V., Byrne, M. et al, (1990) Growth factors influencing bone development. J Cell Sci Suppl 13, 149-56.

Wozney, J. M., Rosen, V., Celeste, A. J. et al, (1988) Novel regulators of bone formation: molecular clones and activities. Science 242, 1528-34.

Ye, L., Lewis-Russell, J. M., Kyanaston, H. G. and Jiang, W. G. (2007) Bone morphogenetic proteins and their receptor signaling in prostate cancer. Histol Histopathol 22, 1129-47.

From left to right: Dr Jin Li, Dr Lin Ye, Dr Christian Parr, Dr Anthony Douglas-Jones, Professor Howard Kynaston, Professor Robert E. Mansel, Professor Wen G Jiang