Gene Ther Mol Biol Vol 1, 1-172. March, 1998.
Status of gene therapy in 1997: molecular mechanisms, disease targets,
and clinical applications
Teni Boulikas
Institute
of Molecular Medical Sciences, 460 Page Mill Road, Palo Alto, California 94306
and
Regulon Inc., 249 Matadero Avenue, Palo Alto, CA 94306
__________________________________________________________________________________________________
Correspondence: Teni Boulikas, Regulon Inc., 249 Matadero Avenue,
Palo Alto, CA 94306, Tel (650) 813-9264, Fax: (650) 424-9594, E-mail:
Boulikas@Worldnet.att.net
Key words: gene therapy, gene transfer, clinical trials,
cancer, immunotherapy, p53, adenovirus, retrovirus, adeno-associated virus,
HIV-1, HSV-1, EBV, AIDS, tumor vaccines, IFN-g, TNF-a, VEGF,
retinoblastoma, purine nucleoside phosphorylase, HSV-tk, E1A, E1B, Cre, LoxP,
recombination, HIV vectors, liposomes, fusogenic peptides, plasmovirus,
transcription factor, TIL, IL-2, IL-3, IL-7, IL-12, GM-CSF, prostate cancer,
p21, p16, apoptosis, Bcl-2, Bax, Bcl-xs, E2F, bystander effect, MDR1, IGF-I,
antisense, triplex DNA, ParkinsonÕs disease, lysosomal storage disease,
hemophilia, cystic fibrosis, CFTR, rheumatoid arthritis, hypertension, familial
hypercholesterolemia, LDL, angiopoietin, restenosis, angiogenesis, TGF-b, arterial
injury, atherosclerosis, ADA deficiency, obesity, leptin.
Summary
Gene therapy is a newly emerging field
of biomedical research aimed at introducing therapeutically important genes
into somatic cells of patients; a new and revolutionary era in molecular
medicine has begun. Diseases already shown to be amenable to therapy with gene
transfer in clinical trials include cancer (melanoma, breast, lymphoma, head
& neck, ovarian, colon, prostate, brain, chronic myelogenous leukemia,
non-small cell lung, lung adenocarcinoma, colorectal, neuroblastoma, glioma,
glioblastoma, astrocytoma, and others), AIDS, cystic fibrosis, adenosine
deaminase deficiency, cardiovascular diseases (restenosis, familial
hypercholesterolemia, peripheral artery disease), Gaucher disease, a1-antitrypsin
deficiency, rheumatoid arthritis and a few others. Human diseases expected to
be the object of clinical trials include hemophilia A and B, ParkinsonÕs
disease, ocular diseases, xeroderma pigmentosum, high blood pressure, obesity
and many others. The establishment of novel animal models for human disease,
the discovery of new genes, and improvements in successful gene delivery open
bright new prospects for molecular medicine. A wide variety of delivery
vehicles for genes have been tested including murine retroviruses, recombinant
adenoviral vectors, adeno-associated virus, HSV, EBV, HIV vectors, and
baculovirus. Nonviral gene delivery methods use cationic or neutral liposomes,
direct injection of plasmid DNA, and polymers. Various strategies to enhance
efficiency of gene transfer have been tested such as fusogenic peptides in
combination with liposomes, or polymers, to enhance the release of plasmid DNA
from endosomes. Recombinant retroviruses stably integrate into the DNA and
require host DNA synthesis; adenoviruses can infect nondividing cells but cause
immune reactions leading to the elimination of therapeutically transduced
cells. Adeno-associated virus (AAV) is not pathogenic, does not elicit immune
responses but new strategies are required to obtain high AAV titers for
preclinical and clinical studies. Wild-type AAVs integrate into chromosome 19
whereas recombinant AAVs are deprived of site-specific integration and may also
persist episomally; HSV vectors can infect nonreplicating cells such as neuron
cells, have a high payload capacity for foreign DNA but inflict cytotoxic
effects. It seems that each delivery system will be developed independently of
the others and that each will prove its strengths for specific applications. At
present, retroviruses are most commonly used in human clinical trials followed
by adenoviruses, cationic liposomes and AAV. Polymer-encapsulated syngeneic or
allogeneic cells implanted into a tissue of a patient can be used to secrete
therapeutic proteins; the method is in trials for amyotrophic lateral sclerosis
using the ciliary neurotrophic factor gene, and can be extended to Factor VIII
and IX for hemophilia, interleukin genes, dopamine-secreting cells to treat
Parkinson's disease, nerve growth factor for Alzheimer's disease and other
diseases. Ingenious techniques under development with great future prospects
for human gene therapy, include the Cre-LoxP recombinase system to rid of
undesirable viral DNA sequences used for gene transfer, use of tissue-specific
promoters to express a gene in a particular cell type or use of ligands, such
as peptides selected from random peptide libraries, recognizing surface molecules to direct the
gene vehicle to a particular cell type, designing p53 Ògene bombsÓ that explode
into tumor cells, exploit the HIV-1 virus to engineer vectors for gene
transfer, the combining of viruses with polymers or cationic lipids to improve
gene transfer, the attachment of nuclear localization signal peptides to
oligonucleotides to direct them to nuclei, and the invention of molecular
switch systems allowing genes to be turned on or off at will.
Although many human tumors are non- or
weakly immunogenic, the immune system can be reinforced and instructed to
eliminate cancer cells after transduction of patientÕs cells ex vivo with the
cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a, followed
by cell vaccination of the patient (e.g. intradermally) to potentiate
T-lymphocyte-mediated antitumor effects (cancer immunotherapy). DNA vaccination
with genes encoding tumor antigens and immunotherapy with synthetic tumor
peptide vaccines are further developments in this exciting field. The genes
used for cancer gene therapy in human clinical trials include a number of tumor
suppressor genes (p53, RB, BRCA1, E1A), antisense oncogenes (antisense c-fos, c-myc, K-ras), and suicide
genes (HSV-tk, in combination with ganciclovir, cytosine deaminase in
combination with 5-fluorocytosine). Important in gene therapy are also the
genes of bcl-2, MDR-1, p21, p16, bax, bcl-xs, E2F, IGF-I VEGF, angiostatin, CFTR, LDL-R, TGF-b, and
leptin. Reports on human clinical trials using adenoviral and retroviral
injections of the p53 gene have been very encouraging; future directions might
go toward the use of genes involved in the control of tumor progression and
metastasis. The molecular mechanisms of carcinogenesis have been largely
elucidated and improvements in gene delivery methods are likely to lead to the
final victory of the human race in the fight against cancer and other deadly
diseases.
Abbreviations:
a1-AT, a1-antitrypsin
5FC, 5-fluorocytosine
5FU, 5-fluorouracil
aa, amino acid
AAV, adeno-associated virus
Ad, adenovirus
ADA, adenosine deaminase
aFGF, acidic fibroblast growth factor
AIDS, acquired immunodeficiency syndrome
APCs, antigen-presenting cells
bFGF, basic fibroblast growth factor
bp, base pairs
CAT, chloramphenicol acetyltransferase
CD, cytosine deaminase
CDKs, cyclin-dependent kinases
CEA, carcinoembryonic antigen
CF, cystic fibrosis
CFTR, cystic fibrosis transmembrane regulator
cfu, colony forming units
CMV IE, cytomegalovirus immediate-early
CMV, cytomegalovirus
CNS, central nervous system
CNTF, ciliary neurotrophic factor
CTLs, cytotoxic T lymphocytes
DBD, DNA-binding domain
DSBs, double-strand DNA breaks
EBV, Epstein-Barr virus
EGF, epidermal growth factor
EGFR, epidermal growth factor receptor
FH, familial hypercholesterolemia
GCV, ganciclovir
GFP, green fluorescent protein
GM-CSF, granulocyte-macrophage colony stimulating factor
HIV-1, human immunodeficiency virus type 1
HPV, human papillomavirus
HSC, hematopoietic stem cells
HSV, herpes simplex virus
i.m., intramuscular
i.p., intraperitoneal
i.v., intravenous
ICE, interleukin-1b converting
enzyme
IFN-g,
interferon-g
IGF-I, insulin-like growth factor I
IGF-IR, insulin-like growth factor I receptor
IL, interleukin
IL-1b,
interleukin-1b
ITR, inverted terminal repeat
LAK, lymphokine-activated killer cells
LDL-R, low density lipoprotein receptor
LTR, long terminal repeat
mAb, monoclonal antibody
MAR, matrix-attached region
MeP-dR, 6-methylpurine-2Õ-deoxyriboside
MHC, major histocompatibility complex
MLV, murine leukemia virus
MMTV, mouse mammary tumor virus
Mo-MLV, Moloney murine leukemia virus
MOI, multiplicity of infection
MT, metallothionein
NeoR, neomycin phosphotransferase
NK, natural killer cells
nt, nucleotides
ODNs, oligodeoxynucleotides
ORFs, open reading frames
ORIs, origins of replication
PAI-1, plasminogen activator inhibitor-1
PARP, poly(ADP-ribose) polymerase
PBL, peripheral blood lymphocytes
PCNA, proliferating cell nuclear antigen
PDGF, platelet-derived growth factor
PGF, placenta growth factor
PKC, protein kinase C
PMGT, particle-mediated gene transfer
PNP, purine nucleoside phosphorylase
PSA, prostate specific antigen
PVR, proliferative vitreoretinopathy
RA, rheumatoid arthritis
RA-SF, rheumatoid arthritis synovial fibroblasts
rAAV, recombinant adeno-associated virus
RAC, recombinant advisory committee
RB, retinoblastoma
RLU, relative luciferase units
RSV, Rous sarcoma virus
s.c., subcutaneous
SCID, severe combined immunodeficient
SMC, smooth muscle cell
TAD, transactivation domain
TGF-b,
transforming growth factor-b
TIL, tumor-infiltrating lymphocyte
TK, thymidine kinase
TNF-a, tumor
necrosis factor a
tPA, tissue plasminogen activator
uPA, urokinase plasminogen activator
VEGF, vascular endothelial growth factor
VSMC, vascular smooth muscle cell
VSMC, vascular smooth muscle cells
VSV, vesicular stomatitis virus
wt, wild-type
I. Introduction
Monumental
progress in several fields including DNA replication, transcription factors and
gene expression, repair, recombination, signal transduction, oncogenes and
tumor suppressor genes, genome mapping and sequencing, and on the molecular
basis of human disease are providing the foundation of a new era of biomedical
research aimed at introducing therapeutically important genes into somatic
cells of patients. The main targets of gene therapy are to repair or replace
mutated genes, regulate gene expression and signal transduction, manipulate the
immune system, or target malignant and other cells for destruction (reviewed by
Anderson, 1992; Nowak, 1995; Boulikas, 1996a,b; Culver, 1996; Ross et al,
1996).
Two main approaches have been pursued for gene
transfer to somatic cells (i) direct
gene delivery using murine retroviruses, adenoviruses, adeno-associated virus,
HSV, EBV, liposomes, polymers, or direct plasmid injection (gene therapy in vivo); and (ii) ex vivo gene therapy involving removal of syngeneic cells
from a specific organ or tumor of an individual, genetic correction of the
defect in cell culture (ADA deficiency, LDL-R for FH) or transfer of a
different gene (IL-2 to tumor infiltrating lymphocytes to potentiate the cytotoxicity
to tumors, cytokine genes to tumor cells from a patient for cancer
immunotherapy, multidrug resistance gene transfer to render bone marrow cells
resistant to certain antineoplastic drugs), followed by reimplantation of the
cells. The reimplanted cells produce the therapeutic protein.
Several key factors or steps appear to be involved
for the effective gene transfer to somatic cells in a patient or animal model: (i) the type of vehicle used for gene delivery (liposomes, adenoviruses,
retroviruses, AAV, HSV, EBV, polymer, naked plasmid) which will determine not
only the half-life in circulation, the biodistribution in tissues, and efficacy
of delivery but also the route through the cell membrane and fate of the
transgene in the nucleus; (ii) interaction
of the gene-vehicle system with components in the serum or body fluids (plasma
proteins, macrophages, immune response cells); (iii) targeting to the cell type, organ, or tumor, and binding to
the cell surface; (iv) port and mode
of entrance to the cell (poration through the cell membrane, receptor-mediated
endocytosis), (v) release from
cytoplasmic compartments (endosomes, lysosomes), (vi) transport across the nuclear envelope (nuclear import); (vii) type and potency of regulatory
elements for driving the expression of the transferred gene in a particular
cell type including DNA sequences that determine integration versus maintenance
of a plasmid or recombinant virus/retrovirus as an extrachromosomal element; (viii) expression (transcription) of
the transgene producing heterogeneous nuclear RNA (HnRNA) which is then (ix) spliced and processed in the
nucleus to mature mRNA and is (x)
exported to the cytoplasm to be (xi)
translated into protein. Additional steps may include posttranslational
modification of the protein and addition of a signal peptide (at the gene
level) for secretion.
All steps can be experimentally manipulated and
improvements in each one can enormously enhance the level of expression and
therapeutic index of a gene therapy approach. It has been proposed that the
plasmid vector is unable to translocate to the nucleus unless complexed in the
cytoplasm with nuclear proteins possessing nuclear localization signals (NLSs).
NLSs are short karyophilic peptides on proteins destined to function in the
nucleus used for binding to specific transporter molecules in the cytoplasm,
mediating their passage through the pore complexes to the nucleus (see
Boulikas, 1998, this volume). NLS are present on histones, transcription
factors, nuclear enzymes, and a number of other nuclear proteins; nascent
chains of DNA-binding polypeptides could bind to the supercoiled plasmid in the
cytoplasm mediating its translocation to the nucleus.
During delivery of foreign DNA in vivo vehicles may be attacked by macrophages, lymphocytes, or
other components of the immune system and the vast majority will be cleared
from blood, intracellular, or other body fluids before it is given the chance
to reach the membrane of the cell target; the half-life of naked plasmids
injected intravenously into animals is about 5 min (Lew et al, 1995). Cationic
lipids, other than being very toxic, mediate efficient gene delivery passing
through biological membranes; those lipid-DNA complexes surviving the immediate
neutralization by serum proteins in the blood can reach the lung, heart and
other tissues after vein or artery injection with one heart beat and transform
endothelial vascular cells (reviewed by Boulikas, 1996d).
A variety of viral vectors have been developed to
exploit the characteristic properties of each group to maintain persistence and
viral gene expression in infected cells. Retroviral vectors and AAV integrate
into target chromosomes and the transgene they carry can be inactivated from
position effects from chromatin surroundings. Vectors with
persistence/integration functions may not result in high levels of gene
delivery in vivo.
Adenoviruses and retroviruses which are of the most
frequently used vehicles for gene transfer can accommodate up to 7kb of total
foreign DNA into their genome because of packaging limitations. This precludes
their use for the transfer of large genomic regions. Transfer of intact yeast
artificial chromosome (YAC) into transgenic mice will enable the analysis of
large genes or multigenic loci such as human b-globin
locus (reviewed by Peterson et al, 1997).
A small portion of plasmid molecules crossing the
cell membrane will escape degradation from nucleases in the lysosomes and
become released to the cytoplasm; even a smaller portion of these molecules will
enter nuclei; finally, after successfully reaching the nucleus, plasmids with
therapeutic genes are usually degraded by nuclear enzymes and transgene
expression is permanently lost after about 2-7 days from animal tissues
following successful gene delivery. During the peak of transgene expression
(usually 7-48 h from injection) the transgene transcript can follow the normal
fate of other nuclear transcripts when proper polyadenylation signals are
provided; its processed mRNA will be exported to the cytoplasm and translated
into the therapeutic protein.
The choice of the appropriate delivery system for
successful somatic gene transfer demands understanding of the drawbacks and
advantages of each delivery system, such as limitations in the total length of
the DNA that can be introduced, including the cDNA of the therapeutically
important gene and control elements. Understanding the pathophysiology of the
disease and the cell targets can give clues on the way of introducing the gene
(i.v., i.p., intratumoral, s.c. injection) or direct the gene therapist to
designing methods to target and secrete a therapeutic protein from a tissue
which is not the normal site of production of a therapeutic protein. The type
of control elements required for the anticipated tissue-specific expression of
the construct, the presence of viral or other origins of replication as well as
of the cDNA encoding the viral replication initiator protein for an episomal
replication of the transgene, sequences that prompt integration and others that
insulate the gene from the chromatin surroundings at the integration site, are
also important for successful gene transfer.
Cancer gene therapy and immunotherapy has been the
first priority of human gene therapy protocols. New gene targets are being
defined and new clinical protocols are being proposed and approved. Effective
eradication of a great variety of tumors with drugs which inhibit angiogenesis
has been extraordinarily successful on animal models and the method moves fast
to clinical trials; transfer of anti-angiogenesis genes will be the next step.
A number of anticancer genes are being tested in preclinical or clinical cancer
trials including p53, RB, BRCA1, E1A, bcl-2, MDR-1, HER2, p21, p16, bax,
bcl-xs, E2F, antisense IGF-I, antisense c-fos, antisense c-myc, antisense K-ras
and the cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a. A promising approach
is transfer of the herpes simplex virus thymidine kinase (HSV-tk) gene (suicide gene) and systemic
treatment with the prodrug ganciclovir which is converted by HSV-tk into a
toxic drug killing dividing cells. Theoretically, expression of therapeutic
genes preferentially in cancer cells could be achieved by regulatory elements
from tumor-specific genes such as carcinoembryonic antigen.
The first gene therapy products are expected to
receive FDA approval by the year 2000; the market for gene therapy products is
expected to exceed $45 billion by 2010.
This article reviews the molecular mechanisms and
recent developments for the gene therapy of cancer, HIV, ADA deficiency,
Parkinson's disease, lysosomal storage disease, hemophilia A and B, a1-antitrypsin deficiency, cystic fibrosis, rheumatoid
arthritis, hypertension, familial hypercholesterolemia,
atherosclerosis/restenosis, wound healing, and obesity including the treatment
of cancer and heart diseases with angiogenesis inhibitors and gene transfer to
the arterial wall. It is my intention to give a general overview rather to
exhaust the field.
DIVISION ONE: GENE DELIVERY SYSTEMS AND GENE
EXPRESSION
II. Gene delivery using retroviruses
A. Recombinant murine retroviruses
The recombinant Moloney murine leukemia virus (Mo-MLV
or MLV) has been extensively used for gene transfer. Retroviral vectors derived
from Mo-MLV promote the efficient transfer of genes into a variety of cell
types from many animal species; up to 8 kb of foreign DNA can be packaged in a
retroviral vector. Recombinant retroviruses have been the most frequently used
and promising vehicles for the delivery of therapeutic genes in human gene
therapy protocols (Appendix 1).
Retroviral vectors cause no detectable harm as they enter their target cells;
the retroviral nucleic acid becomes integrated into chromosomal DNA, ensuring
its long-term persistence and stable transmission to all future progeny of the
transduced cell.
The life cycle of the retrovirus is well understood
and can be effectively manipulated to generate vectors that can be efficiently
and safely packaged. An important contribution to their utility has been the
development of retrovirus packaging cells, which allow the production of
retroviral vectors in the absence of replication-competent virus.
Recombinant retroviruses stably integrate into the
DNA of actively dividing cells, requiring host DNA synthesis for this process
(Miller et al, 1990). Although this is a disadvantage for targeting cells at G0, such as the
totipotent bone marrow stem cells, it is a great advantage for targeting tumor
cells in an organ without affecting the normal cells in the surroundings. This
approach has been used to kill gliomas in rat brain tumors by injection of
murine fibroblasts stably transduced with a retroviral vector expressing the
HSV-tk gene (Culver et al, 1992; see below).
B. Retrovirus packaging cell lines
The use of retroviral vectors in human gene therapy
requires a packaging cell line which is incapable of producing
replication-competent virus and which produces high titers of
replication-deficient vector virus. The packaging cell lines have been stably
transduced with viral genes and produce constantly viral proteins needed by
viruses to package their genome. Wild-type virus can be produced through
recombinational events between the helper virus and a retroviral vector.
Methods are also available for generating cell lines which secrete a broad host
range retrovirus vectors in the absence of helper virus.
Retrovirus packaging cell lines containing the
gag-pol genes from spleen necrosis virus and the env gene from spleen necrosis
virus or from amphotropic murine leukemia virus on a separate vector have been
used; retrovirus vectors were produced from these helper cell lines without any
genetic interactions between the vectors and sequences in the helper cells
(Dougherty et al, 1989). An ecotropic packaging cell line and an amphotropic
packaging cell line, in which the viral gag and pol genes were on one plasmid
and the viral env gene were on another plasmid have been constructed; both
plasmids contained deletions of the packaging sequence and the 3' LTR; when the
fragmented helper virus genomes were introduced into 3T3 cells they produced
titers of retrovirus which were comparable to the titers produced from
packaging cells containing the helper virus genome on a single plasmid
(Markowitz et al, 1990).
The pBabe retroviral vector constructs which transmit
inserted genes at high titers and express them from the Mo-MLV LTR have been
designed with one of four different dominantly acting selectable markers,
allowing the growth of infected mammalian cells in the presence of G418,
hygromycin B, bleomycin/phleomycin or puromycin, respectively. The packaging
cell line, omega E, generated with separate gag/pol and ecotropic env
expression constructs, was designed in conjunction with the pBabe vectors to
reduce the risk of generation of wild type Mo-MLV via homologous recombination
events (Morgenstern and Land, 1990).
C. Pseudotyped retroviral vectors
The traditional retroviral vector enters the target
cell by binding of a viral envelope glycoprotein to a cell membrane viral
receptor. Coinfection of cells with a retrovirus and VSV (vesicular stomatitis
virus) produces progeny virions containing the genome of one virus encapsidated
by the envelope protein of the other (pseudotypes of viruses); this led to the
development of pseudotyped retroviral vectors where the Moloney murine leukemia
env gene product is replaced by the
VSV-G protein able to interact with other membrane-bound receptors as well as
with some components of the lipid bilayer (phosphatidylserine); because of the
ubiquitous distribution of these membrane components pseudotyped particles
display a very broad host range (Friedmann and Yee, 1995). Use of pseudotyped
vectors has been a significant advancement for retroviral gene transfer.
Pseudotypes of VSV and Mo-MLV, are released
preferentially at early times after infection of MuLV-producing cells with VSV;
at later times, after synthesis of M-MLV proteins has been inhibited by the VSV
infection, neither Mo-MLV virions nor the VSV (Mo-MLV) pseudotypes are made.
There appears to be a stringent requirement for recognition of the viral core
by homologous envelope components for the production of VSV (M-MLV) pseudotypes
(Witte and Baltimore, 1977).
The finding that the G protein of vesicular
stomatitis virus (VSV) can serve as the exclusive envelope protein component
for one specific retroviral vector that expresses VSV G protein was extended to
a general transient transfection scheme for producing very high-titer VSV
G-enveloped pseudotypes from any Moloney murine leukemia-based retroviral
vector (Yee et al, 1994). Pseudotyping
of MuLV particles with VSV-G expressed transiently in cells producing MLV Gag
and Pol proteins, has yielded vector preparations with a broader host range
that could be concentrated by ultracentrifugation. For example, this technology
allowed for efficient concentration of vector by ultracentrifugation to titers
> 109 colony-forming units/ml and offers hope for potential use
for gene transfer in vivo. Furthermore, these vectors could infect cells, such
as hamster and fish cell lines, that are ordinarily resistant to infection with
vectors containing the retroviral envelope protein (Burns et al, 1993).
A human 293-derived retroviral packaging cell line
was generated by Ory et al (1996) capable of producing high titers of
recombinant Mo-MLV particles that have incorporated the VSV-G protein. This new
packaging cell line may be used for direct in vivo gene transfer using
retroviral vectors because the retroviral/VSV-G pseudotypes generated with
these cells were significantly more resistant to human complement than commonly
used amphotropic vectors.
A human immunodeficiency virus type 1 (HIV-1)-based
retroviral vector containing the firefly luciferase reporter gene could be
pseudotyped with a broad-host-range VSV envelope glycoprotein G;
higher-efficiency gene transfer into CD34+ cells was achieved with a
VSV-G-pseudotyped HIV-1 vector than with a vector packaged in an amphotropic
envelope (Akkina et al, 1996).
Because the VSV-G protein is toxic to cells when
constitutively expressed, Yang et al (1995) have used steroid-inducible and
tetracycline-modulated promoter systems to derive stable producer cell lines
capable of substantial production of VSV-G pseudotyped MLV particles.
Similarly, the toxic G protein of VSV could be induced in a cell line by the
removal of tetracycline and the addition of estrogen; this cell line was
transduced with a modified tTA transactivator gene engineered with the
ligand-binding domain of the estrogen receptor to the carboxy terminus of the
tTA transactivator; a single retroviral vector could transduce both the
transactivator gene and the VSV-G protein gene controlled by the tTA-inducible
promoter into mammalian cells (Iida et al, 1996). The tetracycline-inducible
system was modified by fusing the ligand binding domain of the estrogen
receptor to the carboxy terminus of a tetracycline-regulated transactivator to
regulate VSV-G expression in a tetracycline-dependent manner that could be
modulated by b-estradiol in stable packaging cell lines (Chen et
al, 1996).
D. Limitations and advancements using retroviral
vectors
Before the in vivo gene therapy with retroviruses
becomes a successful reality a number of problems must be overcome. Despite the
extensive use of retroviral vectors in gene therapy, there are still problems
to be solved and there is an ultimate need for the development of new, improved
retroviral vectors and packaging systems to fuel further advances in the field
of human gene therapy. The principle limitation of retroviruses has been poor
gene expression in vivo which has been overcome through the use of
tissue-specific promoters. Use of internal ribosome entry sites from
picornaviruses in retroviral vectors has provided stable expression of multiple
gene enhancers (reviewed by Naviaux and Verma, 1992; Boris-Lawrie and Temin,
1993).
Little is known about the factors that influence the
efficiency of retroviral infection in vivo. Many commonly used experimental
animal strains, such as mice, harbor endogenous C-type proviruses, some of
which are expressed and have circulating antibodies against the viral envelope
glycoproteins that cross-react with the Mo-MLV; the efficiency of
retrovirus-mediated transfection in vivo using a variety of mouse strains was
affected by humoral immune competence and interference between endogenous MLVs
and exogenous recombinant Mo-MLV (Fassati et al, 1995).
One of the drawbacks of retroviruses for their
exploitation in gene therapy has been the low viral titers obtained, too low to achieve therapeutic levels of
gene expression; methods for the efficient concentration from large volumes of
supernatant and purification of amphotropic retrovirus particles have been
developed in several laboratories. For example, Bowles et al (1996) have used
concentration and further purification of virus particles by sucrose banding
ultracentrifugation; animal studies have shown that viral transduction
increased proportionally with titer of the retrovirus.
Transduced cells producing retrovirus are
tissue-incompatible and are, therefore, expected to be attacked by the immune
system; this will lead to the elimination of therapeutic cells from the body, a
phenomenon markedly associated also with adenoviral gene transfer. A privileged
exception are brain tumor cells expressing recombinant retrovirus which persist
without immunologic rejection (Culver et al, 1992).
Sodium butyrate treatment of murine retrovirus
packaging cells producing a CFTR vector increased the production of the
retrovirus vector between 40- and 1,000-fold (Olsen and Sechelski, 1995).
The Cre/LoxP recombinase strategy (see below) has
been used to generate retroviral vectors that have the ability to excise
themselves after inserting a gene into the genome, thereby avoiding problems
encountered with conventional retrovirus vectors, such as recombination with
helper viruses or transcriptional repression of transduced genes (Russ et al,
1996). Retroviral vectors with the Cre/LoxP technology have also been used to
deliver the GM-CSF gene to K562 cell culture (Fernex et al, 1997), for the
development of retroviral suicide vectors for gene therapy using the HSV-tk
gene (Bergemann et al, 1995), and for the production of a high-titer producer
cell line containing a single LoxP site flanked by the viral LTRs (Vanin et al,
1997).
Because retrovirus
vectors are integrated into the genome, transcriptional repression of
transduced genes will often take place from position effects exerted from
neighboring chromatin domains; two matrix-attached regions (MARs), one at
either flank of the transgene, are proposed here to insulating the gene in the
retrovirus vector from chromatin effects at the integration site by creating an
independent realm of chromatin structure harboring the transgene. MAR insulators have been used and can
enhance up to 2,000-fold the expression of genes in transgenic animals and
plants (McKnight et al, 1992; Breyne et al, 1992; Allen et al, 1993; Brooks et
al, 1994; Thompson et al, 1994; Forrester et al, 1994).
E. Targeting of retrovirus to specific cell types
A number of approaches have been directed to develop
retroviral vectors that are able to target particular cell types; also efforts
focus toward retroviral vectors that incorporate nonretroviral features and are
tailored to desired needs for specific uses (reviewed by Vile and Russell,
1995; Gunzburg and Salmons, 1996).
Ideally, therapeutic genes should be delivered only
to the relevant cell type and/or expressed in this cell type. Viral and
nonviral vectors can be targeted through ligand-receptor interactions.
Retroviral targeting through protease-substrate interactions has also been
described; epidermal growth factor (EGF) was fused to a retroviral envelope
glycoprotein via a cleavable linker comprising a factor Xa protease recognition
signal. Vector particles displaying the cleavable EGF domain could bind to EGF
receptors on human cells but did not transfer their genes until they were
cleaved by factor Xa protease (Nilson et al, 1996).
A retroviral vector that infects human cells
specifically through recognition of the low density lipoprotein receptor has
been described by adding onto the ecotropic envelope protein of M-MLV a
single-chain variable fragment derived from a monoclonal antibody recognizing
the human LDL-R; the chimeric envelope protein was used to construct a
packaging cell line producing a retroviral vector capable of transfer of the
lacZ gene to human cells expressing LDL-R (Somia et al, 1995).
F. Other retroviruses
Viruses that contain RNA as their genetic material
may be either negative- or positive-strand RNA viruses. The very large group of
negative-strand RNA viruses includes some of the most serious and notorious
pathogens subdivided into those with segmented RNA (influenza viruses,
comprising eight separate segments of RNA and bunyaviruses containing three
segments of single-stranded RNA, the large, L, the medium, M, and the small, S)
and those with nonsegmented RNA (VSV, rabies, measles, Sendai, respiratory
syncytial virus, Ebola viruses). Positive-strand RNA viruses include poliovirus.
Cloned positive-strand poliovirus cDNA is infectious
but neither isolated genome nor antigenome RNA of negative-strand viruses is
infectious; this is because the negative-strand viral RNA is assembled with
viral nucleoprotein into an RNP complex that becomes the template for the viral
RNA-dependent RNA polymerase. Helper influenza virus-dependent procedures have
been developed in which an influenza virus-like RNA molecule, containing a
reporter gene, was mixed with disrupted virion core proteins to reconstitute
RNP complexes in vitro which were then transfected into influenza
virus-transfected cells. Recombinant nucleocapsid and polymerase proteins for
the unsegmented RNA viruses have also been used to produce infectious virus
without help from an homologous virus using full-length cDNA clones of
intracellularly transcribed antigenomes (rabies, VSV, measles, Sendai) (see
Bridgen and Elliott, 1996 and the references cited therein).
Plasmids containing full-length cDNA copies of the
three RNA genome molecules of Bunyamwera bunyavirus and a negative-sense copy
of the GFP gene, flanked by T7 promoter and hepatitis delta virus ribozyme
sequences, were used to produce infectious virus particles without helper
virus; these plasmids were used to transfect HeLa cells which expressed T7 RNA
polymerase and recombinant Bunyamwera bunyavirus proteins by previous
transfection with the appropriate plasmids; 24 h after infection about 1 in
1,000 HeLa cells displayed fluorescence indicative of transcription and
replication of the reporter RNA (Bridgen and Elliott, 1996).
III. Adenoviral gene delivery
A. Adenovirus replication, transcription, and
attachment to the nuclear matrix
Before understanding the principle of adenoviral gene
transfer, it is essential to comprehend the molecular events which are involved
in the life cycle of the adenovirus. Adenoviruses posses a well-defined origin
of replication which is stimulated by transcription factors NFI and NFIII (Hay,
1985; Pruijn et al, 1986). The transcription factor NF-I (also called CTF,
CCAAT box-binding protein, or C/EBP) stimulates replication of adenovirus DNA
in vitro (Pruijn et al, 1986; Jones et al, 1987; Santoro et al, 1988;
Coenjaerts et al, 1991) by establishing cooperative interactions with Ad-DBP (Adenovirus DNA-binding protein)
(Cleat and Hay, 1989). The transcription factor NFIII (also called Oct-1 or
OTF-1), involved in the regulation of the histone H2B and immunoglobulin genes,
can stimulate initiation of adenovirus DNA replication in vitro (O'Neil et al., 1988; Mul et al, 1990; Verrijzer et al,
1990; Coenjaerts et al, 1991).
The adenovirus 5 protein Ad-DBP is a single-stranded
DNA binding protein product of the viral E2A absolutely required for chain
elongation during Ad5 DNA replication; other than facilitating unwinding of the
DNA, Ad-DBP might also protect single-stranded DNA at the replication fork from
nuclease attack, increase the rate of processivity of the viral DNA polymerase,
and increase binding of NFI of the core origin of Ad5 (Cleat and Hay 1989).
This protein has a size of 529 amino acids, is phosphorylated and apart from
its role in DNA replication is also involved in transcription, recombination,
transformation, and virus assembly (see Tucker et al 1994). Crystal structure
at 2.6 A resolution of Ad-DBP shows that a 17 aa C-terminal domain hooks onto a
second Ad-DBP molecule thus promoting its cooperativity during DNA binding; Ad
DBP was proposed to act by forming a core around which single-stranded DNA
winds (Tucker et al, 1994).
Adenoviruses replicate episomally; they need to
attach to the nuclear matrix of the host cell for their replication. Two
adenoviral proteins have been found attached to the nuclear matrix and
presumably mediating the anchorage of the adenovirus: (i) the E1a protein (11 kDa), a transcription and replication
factor sufficient to immortalize primary rodent cells, which was crosslinked to
matrix proteins with oxidation with o-phenanthroline/Cu2+ (Chatterjee and Flint, 1986) and (ii) the adenovirus terminal protein
(55 kDa) which is covalently attached to the 5' end of Ad DNA and initiates DNA
replication; the adenovirus terminal protein mediated adenovirus anchorage to
nuclear matrix was resistant to 1M guanidine extraction (Bodnar et al, 1989;
Schaack et al, 1990; Fredman and Engler, 1993).
Three types of internal matrix structures were
recognized in HeLa cells infected with adenovirus 2; an amorphously dense
region; granular regions representing virus capsid assembly structures; and
filaments connecting these regions to one another and to the peripheral lamina
(Zhonghe et al, 1987); the perinuclear matrix was also rearranged after
adenovirus infection.
Electron micrographs of thin sections through nuclei
of adenovirus-infected HeLa cells showed that the 3H-deoxyuridine grains
were located at the periphery as well as in the interior of nuclei.
Simultaneous visualization of adenovirus transcription and replication showed
that the two processes occurred in adjacent, yet distinct, foci throughout the
interior and periphery of nuclei presumably in association with the nuclear
matrix; DNA molecules were found to be displaced from the replication foci and
to become spread in the surrounding nucleoplasm serving as templates for
transcription (Pombo et al, 1994).
Adenovirus infection provokes dramatic rearrangements
to the nuclear matrix. A reorganization in both internal and peripheral NM was
also observed in HeLa cells after infection with adenovirus 2 giving structures
able to support the increased replication demands and capsid assembly of the
virus (Zhonghe et al, 1987). Splicing of adenoviral HnRNA takes place on the
nuclear matrix. All adenovirus 2 polyadenylated RNAs could be UV crosslinked to
two host HnRNP proteins that are involved in the association of HnRNA to the
matrix (Mariman et al, 1982).
Adenovirus establishes foci called replication
centers within the nucleus, where adenoviral replication and transcription
occur; although the rAAV genome was faintly detectable in a perinuclear
distribution after successfully entering the cell, AAV was mobilized to the
adenovirus replication centers when the cell was infected with adenovirus; thus
AAV colocalizes with the adenovirus replication centers (Weitzman et al, 1996).
B. Adenovirus E1A and E1B proteins in apoptosis and
control of the host cell cycle
Viruses have developed strategies to shut down
protein synthesis in the host and subdue its protein synthesizing machinery to
produce progeny virus when infecting cells. In response, many cell types commit
suicide after viral infection to protect the organism from further infection.
Striking back, viruses have evolved mechanisms to prevent infected cells from
perishing using mechanisms that inhibit apoptosis of the host cell;
adenoviruses synthesize the 19 kDa E1B protein which has a domain similar to
that of the cellular protein Bcl-2, the apoptosis inhibitor (Sarnow et al,
1982; van den Heuvel et al., 1990). p53 can be complexed with adenovirus E1B
(Sarnow et al, 1982; van den Heuvel et al., 1990).
Expression of the
adenovirus E1A protein stimulates host DNA synthesis and induces apoptosis; on
the contrary E1B 19 kDa associates with Bax protein and inhibits apoptosis (Figure 1). The E1A oncogene of
adenovirus exerts its effect via p53 protein (Debbas and White, 1993; White,
1993). Indeed, expression of E1A increases the half-life of p53 resulting in
accumulation of p53 molecules in adenovirus-infected cells leading to apoptosis.
Although induction of host DNA synthesis by E1A provides a suitable environment
for virus replication, the induction of apoptosis by the same protein impairs
virus production since virus-infected cells are eliminated (see Han et al, 1996
for references). p53-deficient cells are transformed by E1A because of absence
of the pathway for induction of apoptosis by p53 (Lowe et al, 1994).
E1A represses HER-2/neu transcription and functions
as a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. Transfer
the E1A gene into cancer cells that overexpress HER-2/neu is an interesting
aspect of gene therapy (see E1A in gene therapy; Yu et al, 1995; Chang et al, 1996; Ueno NT et al, 1997; Rodriguez
et al, 1997; Xing et al, 1997).
The E1B oncogene products inhibit apoptosis induced
by E1A expression thus preventing premature death of host cells during
adenovirus infection. This gives an advantage to virus for its proliferation
and E1B proteins (19 kDa and 55 kDa) are necessary for transformation of
primary rodent cells by E1A. E1A alone is unable to transform primary rodent
cells (White, 1993).
The E1B 19K protein of
adenovirus is the putative viral homolog of the cellular Bcl-2 protein; using
the yeast two-hybrid system for the identification of proteins interacting with
E1B, Han and coworkers (1996) have identified Bax as one of the seven
19k-interacting clones. The 50-78 amino acid domain of Bax contains a conserved
region homologous to Bcl-2 which is able to interact specifically with either
Bcl-2 or E1B. In p53 mutant cells expression of Bax induced apoptosis;
inhibition of apoptosis by Bcl-2 may proceed via its ability to bind the
death-promoting Bax protein (Han et al, 1996). The bax gene is upregulated by p53.
Expression of p53 and of adenovirus E1A induce
apoptosis (Debbas and White, 1993; Lowe and Rudley, 1993). A number of proteins
when expressed at sufficient amounts block apoptosis; these include Bcl-2 and
E1B 19 kDa protein of adenovirus (Debbas and White, 1993; Chiou et al, 1994).
All four protein molecules act upstream of Bax which is a potent inducer of
apoptosis: both the cellular Bcl-2 and the 19 kDa protein E1B of adenovirus are
able to interact with Bax inhibiting its involvement in induction of apoptosis
(Han et al, 1996; Figure 1). E1A
acts upstream of p53 by increasing the half-life of p53 resulting in an
accumulation of p53 molecules in the nucleus (Lowe and Ruley, 1993); increased
levels of p53 are then believed to upregulate the bax gene.
The transcription factor E2F was originally
identified as an activator of the adenovirus E2 gene and is implicated in the
regulation of DNA replication (Shirodkar et al., 1992). Following infection of
cells with adenovirus, the DNA binding activity of E2F increases and as a
consequence transcription of the E2 gene of adenovirus increases (Kovesdi et
al., 1987). These changes in E2F are mediated by E1A protein of adenovirus. RB
forms specific complexes with E2F keeping E2F in a form unable to upregulate
its target regulatory sequences. E2F can form specific complexes also with
cyclin A during S-phase in NIH 3T3 cells (Mudryj et al., 1991). Both types of
complexes, E2F-RB and E2F-cyclin A, can be dissociated by the adenovirus E1A
protein (Chellappan et al., 1991; Bagchi et al., 1990; reviewed by White, 1998
this volume) but also by phosphorylation of RB at G1/S causing release of E2F
and stimulation in transcription of genes required for DNA replication (myc, DHFR).
These events contribute to the uncontrolled proliferation of
adenovirus-transformed cells (Mudryj et al., 1990, 1991). Release of E2F from
RB induced by E1A is critical for transformation of cells by E1A (for references
see Hiebert et al, 1995).
C. Strategies of adenoviruses to enter the cell
In order to enter the host cell the adenovirus first
attaches with a high affinity to a cell surface receptor, whose nature still
remains elusive, using the head domains of the protruding viral fibers; the
fibronectin-binding integrin on the cell surface then associates with the
penton base protein on the adenovirus triggering endocytosis of the virus
particle via coated pits and coated vesicles (Svensson and Persson, 1984; Greber
et al, 1996). The third step in adenovirus entry into the host cell includes
Figure 1. Role of E1A and E1B19-kDa
proteins of adenovirus in apoptosis.
penetration
of the adenoviral particles by acid-catalyzed rupture of the endosomal membrane
involving the penton protein and the integrins and allowing escape to the
cytoplasmic compartment; a decrease in endosome pH during internalization
expose hydrophobic domains of these adenoviral capsid proteins which permits
these proteins to insert into the vesicle membrane in a fashion that ultimately
disrupts its integrity (Seth et al, 1984). At the final step the adenoviral
particle is attached to the cytoplasmic side of pore complexes and the DNA is
released to the interior of pore annuli entering the nucleoplasm.
These highly ordered processes are accompanied by
losses or protease degradation of specific proteins on the viral particles; the
fibers and some of the penton base complexes on the adenovirus surface are already
lost during the process of endocytosis; a viral protease, L3/p23, located
inside the capsid at 10 copies per virion, plays a key role in the stepwise
dismantling and in the weakening of the capsid structure culminating with the
release of the adenovirus DNA by degrading of the viral capsid protein VI
(Greber et al, 1996). The mechanism of disruption of endosomes by the
adenoviral particles has been exploited to augment efficiency of transfection
with transferrin-polylysine-DNA complexes (see fusogenic peptides and Curiel et
al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al, 1993;
Morishita et al, 1993; Harries et al, 1993; Curiel, 1994).
To overcome one of the major limitations to the
clinical utility of adenoviruses which is the low efficiency of gene transfer
achieved in vivo, Arcasoy et al (1997) found that the presence of the
polycations polybrene, protamine, DEAE-dextran, and poly-L-lysine significantly
increased the transfection efficiency in cell culture using the lacZ gene; because
the polyanion heparin did not significantly alter gene transfer efficiency, but
completely abrogated the effects of polycations it supports the idea that the
negative charges presented by membrane glycoproteins reduce the efficiency of
adenovirus-mediated gene transfer, an obstacle that can be overcome by
polycations.
D. Advantages and drawbacks of adenoviral vectors in
gene delivery
Adenoviruses possess a linear double-stranded genome
which can be manipulated to accommodate up to 7.5 kb of DNA. Adenoviruses have
the advantage of being able to infect nondividing cells. Other advantages are
the rarity of recombination events between adenoviral vectors and the host
chromosomes, the absence of induction of human malignancies by adenoviruses,
and the relative safety of their use as vaccines (e.g. Ballay et al, 1985;
Haj-Ahmad and Graham, 1986). For safety, replication-deficient, infectious
adenoviruses are being used in somatic gene transfer; for example deletion in a
portion of the E3 region of the virus permits encapsidation whereas deletion of
a portion of the E1A coding sequence
impairs viral replication (Gilardi et al, 1990; Rosenfeld et al, 1991).
E. Deletion of adenoviral DNA sequences for gene delivery
First generation recombinant adenoviruses were
rendered defective by deletion of sequences spanning the E1A and E1B genes;
these adenoviruses expressed low levels of early and late viral genes
responsible for activating destructive cellular immune responses. Further
deletion of other essential genes and growth in new packaging cell lines or
incorporation of temperature sensitive mutations which allow propagation of the
virus in available packaging cell lines at permissive temperatures are
strategies for improving the therapeutic efficacy of recombinant adenoviruses
and for minimizing the immune response elicited to the host (Fisher et al,
1996).
E1-defective, recombinant adenoviruses can be
replication-enabled by the codelivery of a plasmid encoding the deleted E1
functions, a strategy now designated as Òconditional replication-enablement
system for adenovirusÓ (CRESA); when the original replication-enabling plasmid
was replaced by two separate plasmids that encoded the necessary E1A and E1B
functions the E1-defective adenovirus could become conditionally
replication-enabled by an RNA transcript encoding the required E1 functions.
The RNA transcript of E1A enhanced the therapeutic efficacy of the E1-defective
adenovirus: subcutaneous human tumor nodules containing a fraction of cells
cotransduced with the replication-enabling RNA + DNA and an HSV-tk adenovirus
were reduced to a greater extent than control nodules generated from the same
fraction of cells cotransduced with the HSV-tk adenovirus and an irrelevant
plasmid (Dion et al, 1996).
A new type of recombinant adenovirus, (called
delta-rAd), deprived of all viral open reading frames and retaining only the
essential cis elements (i.e., ITRs and contiguous packaging sequence), was
propagated in 293 cells in the presence of E1-deleted helper virus (Fisher et
al, 1996). This adenovirus was packaged as concatamers into virions and was
used to deliver successfully the CFTR gene to human airway epithelial cells in
culture derived from a cystic fibrosis patient. The new delivery system needs
improvements in its production and purification to allow its evaluation and use
in vivo.
F. Immune response to adenoviruses eliminate
therapeutic cells
Adenoviruses can achieve high levels of gene transfer
(Haffe et al, 1992; Morsy et al, 1993; Herz and Gerard; Wilson, 1995; Kozarsky
et al, 1996). However, the duration of transgene expression is limited (i) by clearance of the infected cells
because of the cellular and humoral immune response (including those mediated
by cytotoxic T lymphocytes) to adenoviral antigens (Yang Y et al, 1994, 1995)
and (ii) by loss of adenoviral
episomes in progeny cells (Feng et al, 1997). To circumvent this problem
adenoviral/retroviral chimeric vectors were constructed where the
nonintegrative adenoviral vector was able to induce target cells to function as
transient retrovirus producer cells and the retroviral particles were able to
transduce neighboring cells; thus the recombinant adenovirus became integrative
via the intermediate generation of a retroviral producing cell (Feng et al,
1997). First generation adenovirus-mediated gene transfer of CFTR to the mouse
lung resulted in the expression of viral proteins leading to the elimination of
the therapeutic cells expressing CFTR by cellular immune responses and
repopulation of the lung with nontransgene containing cells; second generation
E1-deleted viruses, also crippled by a temperature sensitive mutation in the
E2A gene, displayed substantially longer recombinant gene expression and
induced a lower inflammatory response (Yang et al, 1994).
In order to circumvent the elimination of
adenovirus-transduced cells by immune responses and for achieving persistence
of transgene expression strategies to reduce the potential for viral gene
expression have been developed; for example, an E4 modified adenovirus which
was replication defective in cotton rats and displayed a reduced potential for
viral gene expression in vivo was engineered (Armentano et al, 1997). Vectors
containing a wild-type E4 region, E4 open reading frame 6, or a complete E4
deletion were compared in the lungs of BALB/c mice for persistence of CFTR or
lacZ expression; expression was transient from the E1a promoter with all
vectors but persisted from the CMV promoter only with a vector containing a
wild-type E4 region; thus, transient expression from adenoviral vectors may
result from the down-regulation of a promoter and not necessarily from immune
response-related factors (Armentano et al, 1997).
The elimination of therapeutically important cells
from the body after recombinant adenovirus-mediated delivery seems to be a
great limiting factor for the use of adenoviruses in long-term gene therapy
(Dai et al, 1995). This problem can be partially circumvented by daily
administration of the immunosupressant cyclosporin A prohibiting the elimination
of virally-transduced cell by activated T lymphocytes (Fang et al, 1995). A
different approach to suppress elimination of therapeutically-transduced cells
after intra-articular delivery of genes to treat RA is by pretreatment of the
joints with the anti-T cell receptor monoclonal antibody H57, a treatment which
resulted in a significant reduction in lymphocytic infiltration and a
persistence of transgene expression (Sawchuk et al, 1996).
The prokaryotic Cre-LoxP recombination system was
adapted to generate recombinant adenoviruses with extended deletions in the
viral genome in order to minimize expression of immunogenic and/or cytotoxic
viral proteins. An adenovirus was produced with a 25-kb deletion that lacked
E1, E2, E3, and late gene expression; this vector exhibited viral titers
similar to those achieved with first-generation (E1a-deleted) vectors which was
efficient for gene transfer to cell culture but gene expression declined to
undetectable levels much more rapidly than that sustained from first-generation
vectors. Vectors deleted only at E1a were sustaining a better reporter gene
expression because of their ability to replicate (Lieber et al, 1996).
A clinical protocol proposed recently for the therapy
of amyotrophic lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells
which is implanted intrathecally to provide human ciliary neurotrophic factor;
the membrane prevents immunologic rejection of the cells interposing a virus
impermeable barrier between the transduced cells and the host (Deglon et al,
1996; Pochon et al, 1996); the method has been applied before for cross-species
transplantation of a polymer-encapsulated dopamine-secreting cell line to treat
Parkinson's disease and for the delivery of nerve growth factor in rat and
primate models of the Alzheimer's disease (Kordower et al, 1994; see Pochon et
al, 1996 for more references). Evidently, similar approaches could be used to
protect adenovirus- and retrovirus-transduced syngeneic cells from immunologic
rejection provided that the therapeutic protein is secreted.
A new area of investigation is directed toward
surface modification of recombinant adenoviruses to render them safer and to
minimize the strong immune responses against the virus and virus-infected
cells; to this end Fender et al (1997) proposed a dodecahedron made of
adenovirus pentons or penton bases and having only one or two adenovirus
proteins instead of the 11 contained in an adenovirus virion; the penton is a
complex of two oligomeric proteins, a penton base and fiber, involved in the
cell attachment, internalization, and liberation of virus from endosomes.
It is certain that great improvements in adenoviral
gene delivery will solve many of the current problems and permit a higher
therapeutic efficacy in the near future.
G. Examples of adenoviral gene transfer
Recombinant adenovirus vectors have been used: for
the transfer of factor IX gene in hemophilia B dogs via vein injection (Kay et
al, 1994) and in mice (Smith et al, 1993); for the transfer of genes into
neurons and glia in the brain (le Gal la Salle, 1993); for the transfer of the
gene of ornithine transcarmylase in deficient mouse and human hepatocytes
(Morsy et al, 1993); for the transfer of the VLDL receptor gene for treatment
of familial hypercholesterolaemia in the mouse model (Kozarsky et al, 1996);
for the transfer of low density lipoprotein receptor gene in normal mice (Herz
and Gerard, 1993); and for the ex vivo transduction of T cells from
ADA-deficient patients (Blaese et al, 1995; Bordignon et al, 1995). The
adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia
of cotton rat respiratory pathway as a model for the treatment of a1-antitrypsin deficiency; both in vitro and in vivo
infections
Figure 2. Localization of a recombinant
adenoviral vector carrying 6.3 kb of dystrophin cDNA by in situ PCR following
intramuscular injection to immunosuppressed mdx mice. Shown are transverse
cryostat sections of mdx tibialis anterior muscle. Panel A shows a strong in situ hybridization signal (an E4 adenoviral
sequence was amplified and an E4 probe was used) in myonuclei of an
immunosuppressed animal injected with E1, E3-deleted adenovirus at 30 days
postinjection (magnification 650x). Panel B
was produced without Taq polymerase during PCR as a negative control. Panel C shows an uninjected muscle processed
as described in panel A showing no hybridization signal. From Zhao JE,
Lochumuller H, Nalbantoglu J, Allen C, Prescott S, Massie B, Karpati G (1997) Study of adenovirus-mediated
dystrophin minigene transfer to skeletal muscle by combined microscopic display
of adenoviral DNA and dystrophin. Hum
Gene Ther 8, 1565-1573. With kind permission of the authors (George
Karpati, Montreal Neurological Institute, Canada) and Mary Ann Liebert, Inc.
have
shown production and secretion of a1-antitrypsin by the
lung cells (Rosenfeld et al, 1991).
A transductional preference of
adenovirus-polylysine-DNA complexes and E1A/B-deleted replication-deficient
adenoviruses was demonstrated for the prostate carcinoma cell lines DU145,
LNCaP, and PC-3 over primary human bone marrow cells and the leukemia cell line
KG-1; this finding led to a strategy to purge bone marrow of a specific subset
of prostate carcinoma cells (Kim et al, 1997).
Figure 2 shows the localization of a recombinant adenoviral
vector carrying 6.3 kb of dystrophin cDNA, driven by the CMV promoter, by in
situ PCR following intramuscular injection to immunosuppressed mdx mice. Figure 3. shows a comparison of the
persistence of dystrophin expression and adenoviral genomes in immunosuppressed
versus immunocompetent mdx mice. The maximum number of fibers containing
recombinant adenovirus was maintained until 60 days in immunosuppressed mice
but for only 10 days in
immunocompetent animals. Thus, optimization of immunosuppression could assure
successful long term dystrophin gene transfer for gene therapy of Duchenne
muscular dystrophy (Zhao et al, 1997).
A number of RAC-approved protocols for gene transfer
to humans use recombinant adenoviruses (Appendix
1, protocols 118-157). Genes
transferred to patients with recombinant adenoviruses include p53 (#130, 131,
147, 148, 152-156), RB (#140), CFTR (#118-123, 125, 128, 129), HSV-tk (126,
127, 132, 136, 139, 141, 143, 145, 146), cytosine deaminase (#134, 151), VEGF
(#157), IL-2 (#135), GM-CSF (#149, 150), anti-erbB-2 single chain antibody
(#133), ornithine transcarbamylase (#137), and GP100 melanoma antigen (#142).
Figure 3. Comparison of the persistence of
dystrophin expression and adenoviral genomes in immunosuppressed versus
immunocompetent mdx mice. Shown are combined dystrophin immunostaining and in
situ PCR in tibialis anterior muscles of mdx mice at 10 days (A and C) and 60 days (B and D) postinjection. In A and B, FK506 was
used as an immunosuppressant, whereas in C and D no immunosuppression was
employed. At 10 days there was no significant difference in adenovirus positive
nuclei (arrows) fibers between the
immunosuppressed and the immunocompetent groups. At 60 days, however, there was
a dramatic decline in the number of positive nuclei in the immunocompetent
muscle. Magnification 650X. From Zhao JE, Lochumuller H, Nalbantoglu J, Allen
C, Prescott S, Massie B, Karpati G (1997)
Study of adenovirus-mediated dystrophin minigene transfer to skeletal muscle by
combined microscopic display of adenoviral DNA and dystrophin. Hum Gene Ther 8, 1565-1573. With kind
permission of the authors (George Karpati, Montreal Neurological Institute,
Canada) and Mary Ann Liebert, Inc.
IV. Gene delivery with Adeno-Associated Virus (AAV)
A. Replication of AAV and rAAV: the role of the
inverted terminal repeats
AAVs are replication-defective parvoviruses, not
associated with any human disease (nonpathogenic), requiring cotransfection
with a helper virus to produce infectious virus particles; they can replicate
in cell culture only in the presence of coinfection with adenovirus or herpes
virus. Five serotypes of distinct AAV isolates have been recovered from human
and other primates. AAV infections in humans are asymptomatic acquired with
other viral infections such as adenovirus or HSV infections; 80-90% of adults
are seropositive for antibodies against AAV (for references see Clark et al,
1995; Berns and Linden, 1995).
The replication of the AAV is dependent on two copies
of a 145-bp inverted terminal repeat (ITR) sequence that flanks the AAV genome
which is the primary cis-acting element required for productive infection and
the generation of recombinant AAV (rAAV) vectors.
In the absence of helper virus, the AAV particle can
penetrate cells and find its way to the cell nucleus where the linear genome is
uncoated and becomes integrated at a specific site on chromosome 19q13.3;
several copies of AAV may integrate in tandem arrays. Thus, the AAV establishes
a latent infection; the integrated viral genome can be activated and rescued by
superinfection with helper virus (either adenovirus or any type of herpes
virus). Inverted repeats at the ends of the viral DNA serve for the integration
appearing near the junctions with cellular DNA sequences (Bohenzky et al,
1988).
Adenovirus establishes foci called replication
centers within the nucleus, where adenoviral replication and transcription
occur; AAV was colocalized with the adenovirus replication centers using in
situ hybridization and immunocytochemistry; AAV may, thus, utilize adenovirus
and cellular proteins for its own replication; the rAAV genome was faintly
detectable in a perinuclear distribution after successfully entering the cell;
however, rAAV was mobilized to replication centers when the cell was
subsequently infected with adenovirus (Weitzman et al, 1996).
Xiao et al (1997) have engineered the pDD-2 plasmid
containing two copies of the D element, a unique sequence adjacent to the AAV
nicking site, flanking a single ITR (a total of only 165 bp of AAV sequence);
this modified hairpin was sufficient to sustain replication of the plasmid
vector when Rep and adenovirus helper functions were supplied in trans. This
plasmid has a significant prospect in gene transfer because is replicated more
efficiently than infectious AAV clones; as a prelude to its replication the
input circular plasmid was converted into a linear substrate by resolution of
the AAV terminal repeat through a Holliday-like structure, a process most
likely mediated by host factors. Linear monomer, dimer, and other
higher-molecular-weight replicative intermediates were generated during the
replication of pDD-2, a feature characteristic of AAV replication. The
replicative intermediates of this plasmid substrate were competent for AAV DNA
replication, encapsidation, infection, integration, and subsequent rescue from
the chromosome when superinfected with Ad and wild-type AAV (Xiao et al, 1997).
The elucidation of the important role of this 165-bp ITR sequence for AAV
replication and the entire life cycle invigorates the important role of
inverted repeats at the origin of replication not only of viruses but also of cellular
origins of replication (Boulikas, 1996e).
B. Packaging capabilities of AAVs
AAVs posses a 4.7 kb single-stranded DNA genome.
Hermonat et al (1997) have examined the maximum amount of DNA which can be
inserted into the wild-type AAV genome without compromising packaging into an
infectious virus particle; the maximum effective packaging capacity of AAV,
examined as increments of 100 bp ligated at map unit 96 of AAV, is
approximately 900 bp larger than wild type. Thus, wtAAV therapy vectors can be
generated carrying a foreign gene of 900 bp or less with the advantages of
wtAAV such as the ease in which high titers of infectious virus can be
generated and the ability to specifically integrate in chromosome 19.
On the contrary, the payload capacity of recombinant
AAV, which has been deprived of its viral genes and bears only the ITRs is in
the order of 4.5-4.7 kb; this means that a cDNA up to this size can be inserted
into a rAAV; for example the size of the CFTR cDNA is 4.5 kb and thus, the
combined length of the promoter that drives CFTR expression and ITRs needs to
be kept under 500 bp (Dong et al, 1996).
Similar results were reported by Dong et al (1996)
who have estimated that the optimal size of AAV vector is between 4.1 and 4.9
kb; the packaging efficiencies were sharply reduced above 5.2 kb and below 4.1
kb; two copies of the vector were packaged into each virion when vectors of
2.2-2.5 kb were provided.
C. Integration of wtAAV but not of rAAV is
site-specific
Wild-type AAV is able to undergo targeted integration
on chromosome 19 after infection in 15 out of 22 clones examined (Kotin et al,
1990, 1992). Of 51 integrations examined by fluorescence in situ hybridization
(FISH) 48 (94%) were to chromosome 19 after infection of IB3-1 bronchial epithelial
cells with wild-type AAV (Kearns et al, 1996). Site-specific integration has
been reported for other viruses including avian leukosis virus (ALV)
integrating adjacent to cellular oncogenes in tumors; however, the mechanism of
ALV integration involves a process of selection of cells able to form tumors by
overexpression of the oncogene due to virus integration rather than exclusive
integration of the ALV at unique sites of the genome (Hayward et al, 1981). RSV
also appears to be integrated at a limited number of sites (Shih et al, 1988).
Adenovirus integration, a more rare event compared to the majority of episomal
molecules, may also occur at a number of preferred sites (Jessberger et al,
1989). A larger number of recombinase molecules than those known today may be
present in mammalian cell nuclei and promote site-specific integration and
recombination events.
Although the human wild-type AAV (wtAAV) is unique in its ability to
target viral integration to a specific site on chromosome 19, the recombinant
AAV (rAAV) vectors have lost the
site-specific integration and targeting ability; furthermore, rAAVs have
incapacitated ability to integrate, and can be found as episomes. When wtAAV-2
was used to infect IB3-1 bronchial epithelial cells all metaphase spreads
examined by fluorescence in situ hybridization (FISH) had integrated copies and
94% of the integrations were to chromosome 19; furthermore, 36 of 56 metaphase
spreads had a single copy of wtAAV integrated and 20 of 56 showed two sites
within chromosome 19 (Kearns et al, 1996). On the contrary, when a recombinant
AAV containing the CFTR cDNA was used to infect the same cells, examination of
67 metaphase chromosome spreads identified four integrations (only 6% of total)
to different chromosomes. No integration was to chromosome 19. When these
studies were repeated on the A35 epithelial cell line selected for stable CFTR
expression, the episomal AAV-CFTR sequences were abundant in the low molecular
weight DNA fraction (Kearns et al, 1996).
Yang et al (1997) have cloned over 40 AAV and rAAV
integration junctions to determine the terminal-repeat sequences that mediate
integration. These studies have shown that in both immortalized and normal
diploid human cells, wt AAV targeted integration to chromosome 19 in head-to-tail
tandem arrays; the majority of the junction sequences were involving incomplete
copies of the AAV inverted terminal repeats (ITRs); inversions of genomic
and/or viral DNA sequences at the wt integration site took place. The viral
integration event was found to be mediated by terminal repeat hairpin
structures and cellular recombination pathways. In contrast, rAAV provirus
integrated on chromosome 2 and at the same locus in two independent cell lines,
in both the flip and flop orientations; genomic rearrangements took place at
the integration site of rAAV, mainly involving deletions and/or
rearrangement-translocations.
Similar data were reported by Rutledge and Russell
(1997): recombinant AAV vectors were found to be integrated by nonhomologous
recombination as single-copy proviruses in HeLa cells and at random chromosomal
locations; the recombination junctions were scattered throughout the vector
terminal repeats with no apparent site specificity; the flanking HeLa DNA at
integration sites was not homologous to AAV or to the site-specific integration
locus of wild-type AAV. Furthermore, vector proviruses with nearly intact
terminal repeats were excised from the genomic HeLa DNA and were amplified
after infection of cells with wild-type AAV and adenovirus.
The integration patterns of four recombinant AAV-2
genomes in individual clonal isolates of the human nasopharyngeal carcinoma
cell line (KB) were different; the difference between the recombinant AAV-2
genomes were in the combinations of the genes for resistance to tetracycline,
to neomycin, to ampicillin, with the genes for AAV replication, and the AAV
capsid genes. None of the KB cell clones examined had the proviral genome
covalently linked to the specific-site of integration of the wt AAV on chromosome
19 (Ponnazhagan et al, 1997a,b).
D. Drawbacks of AAV in gene therapy and their remedy
Gene transfer with AAV vectors has typically been
low. Difficulties in generating recombinant virions on a large scale sufficient
for preclinical and clinical trials and in obtaining high-titer virus stocks
after the initial transfection into producer cells is a limiting factor for the
widespread usage of AAV vectors; this obstacle is expected to be overcome in
the near future. The high viral titers required for preclinical and clinical
studies have been achieved by a new strategy developed by Tamayose et al
(1996); AAV vector particles in cell lysates could be concentrated by
sulfonated cellulose column chromatography to a titer higher than 108
cfu/ml or 5 x 1010 particles/ml. A method for transfecting cells at
extremely high efficiency with a rAAV vector and complementation plasmid while
simultaneously infecting those cells with replication competent adenovirus
using adenovirus-polylysine-DNA complexes has been developed by Mamounas et al
(1995).
The difficulties in developing packaging cell lines
for AAV relate to low levels of rep gene expression from the AAV-p5 promoter
and to the propensity of Rep proteins to suppress continued growth of
immortalized cell lines; expression of AAV rep under control of the LTR of the
human HIV together with the development of cell populations containing
rescuable AAV recombinant genomes increased 50-fold the packaging efficiency of
AAV vectors (Flotte et al, 1995).
After infection of cell cultures with recombinant AAV
there is a decline in the percentage of cells expressing the transferred gene
with time in culture. This decline was associated with ongoing losses of vector
genomes (Malik et al, 1997). For example, transfer to cultures of K562 human
erythroleukemia cells of a truncated rat nerve growth factor receptor (tNGFR)
cDNA as a cell surface reporter under control of the LTR of the Moloney murine
leukemia virus showed that about 30% of cells expressed tNGFR on the surface early
after transduction at a multiplicity of infection (MOI) of 13 infectious units
(IU), which declined to 3% over 1 month of culture. At an MOI of 130 IU, nearly
all cells expressed tNGFR immediately and the proportion of cells expressing
tNGFR declined to 62% over 2 months of culture (Malik et al, 1997).
Another obstacle of rAAV vectors is the low rate of
integration of rAAV into the host genome (which can be improved at high MOI).
The efficiency of integration was about 2% at low MOI (1.3 IU) and increased to
at about 49% at an MOI of 130 (Malik et al, 1997).
E. Advantages using AAV and improvements in AAV gene
delivery
AAV does not elicit an immune reaction and is a
nonpathogenic virus to humans. AAV contains normally a single-stranded copy of
its genome. Transduction with AAV can be enhanced in the presence of adenovirus
gene products through the formation of double stranded, non-integrated AAV
genomes.
AAV has been reported to have advantages over other
viruses for gene transfer to hematopoietic stem cells due to their high titers
and relative lack of dependence on cell cycle for target cell integration. A
robust CMV/LacZ reporter gene expression in primary human CD34+CD2- progenitor cells induced to undergo T-cell
differentiation was obtained without toxicity or alteration in the pattern of
T-cell differentiation. 70% to 80% of the cells isolated from either adult bone
marrow or umbilical cord blood were efficiently transduced with AAV; however,
the expression was transient without integration; this limits the potential use
of AAV in gene therapy strategies for diseases such as AIDS (Gardner et al,
1997).
Gene transduction by AAV vectors in cell culture can
be stimulated over 100-fold by treatment of the target cells with agents that
affect DNA metabolism, such as irradiation or topoisomerase inhibitors (Russell
et al, 1995); great improvements in transduction efficiency can also be
achieved in vivo: previous g-irradiation increased the transduction rate in mouse
liver by up to 900-fold, and the topoisomerase inhibitor etoposide increased
transduction by about 20-fold after direct liver injection or after systemic
delivery via tail vein injection; up to 3% of hepatocytes could be transduced
after a single systemic vector injection (Koeberl et al, 1997). This is a
significant advantage compared to stealth liposomes which , although
concentrating in the liver, spleen and tumors can transduce Kupffer cells but
not hepatocytes after systemic delivery (Martin and Boulikas, 1998, following
article).
A combination of the adenovirus-5 capsid protein or
the Fiber protein of adenovirus with liposomes, termed adenosomes (adenovirus
protein-cationic liposome complexes) improved the efficiency of gene transfer.
This complex was able to mediate efficient transfer of a AAV/CMV-LacZ construct
to endothelial cells (Zhou et al, 1995).
Clark et al (1996) have developed a sensitive assay
system to determine infectivity of AAV vectors based on the replication of
input rAAV genomes rather than transgene expression which depends on the type
of promoter which drives the foreign gene; this system uses a cell line that
expresses AAV helper functions (rep and cap) upon induction by adenovirus
infection.
F. Examples using AAV for gene transfer
AAV will infect a broad number of mammalian cell
lines and has been used as a cloning vector to transduce the NeoR gene
into mammalian tissue culture cells (Hermonat and Muzyczka 1984). Antisense AAV
vectors have been used to inhibit HIV replication (Chatterjee et al, 1992), and
to correct Fanconi's anemia in human hematopoietic cells (Walsh et al, 1994).
AAVs transduce preferentially cells in S phase; topoisomerase inhibitors
increase transduction efficiency (Russell et al, 1995).
Using AAV, the genomic copy of a normal human b-globin gene under control of the DNase
l-hypersensitive site 2 (HS-2) from the locus control region was expressed in
K562 human erythroleukemia cells, which normally lack the b-globin gene; following selection with G418 by virtue
of the neo-resistance function which was provided in the rAAV vector, stable
integration of the exogenous b-globin allele was determined (Zhou et al, 1996).
Similar data were reported by Einerhand et al (1995) transferring a recombinant
AAV-vector containing a human b-globin gene together
with the DNase1 hypersensitive sites 4, 3 and 2 of the human b-globin locus control region as an approach for the
gene therapy of b-thalassemia and sickle cell anemia. The vector
replicated to high titers and could efficiently transduce hematopoietic stem
cells isolated from patients. In order to treat sickle cell anemia Lubovy et al
(1996) have transferred lacZ with a recombinant AAV vector and stably
transduced hematopoietic stem cells purified from normal and homozygous sickle
cell anemia patients.
AAV was able to promote delivery of functional levels
of glial cell line-derived neurotrophic factor (GDNF), in a degenerative model
of Parkinson's disease (Mandel et al, 1997). AAV has also been used for the
transduction of the mouse liver in vivo with Factor IX cDNA as a prelude to
treatment of hemophiliacs (Snyder et al, 1997; Herzog et al, 1997) and for the
human intratracheal instillation of CFTR cDNA into neonatal New Zealand white
rabbits (Rubenstein et al, 1997), and to the lungs of rhesus macaques without
eliciting inflammation (Conrad et al, 1996).
AAV has also been used for the transfer of the human
multidrug resistance gene (hMDR1) cDNA to NIH-3T3 cells followed by selection
of successfully transfected cells based on the drug-resistant phenotype
conferred by the P-glycoprotein efflux pump (see below and Lee et al, 1997,
this volume); integration of MDR1 sequences into the host cell genome was
demonstrated by fluorescent in situ hybridization (FISH) but also the
persistence of nonintegrated AAV-MDR1 episomal plasmids (Baudard et al, 1996).
Introduction of a human globin gene into murine
hematopoietic bone marrow cells ex vivo with a recombinant AAV vector followed
by transplantation of these cells into lethally irradiated congenic mice
sustained a long-term repopulating ability: human globin gene sequences were
detected in the bone marrow and spleen in primary recipient mice for at least 6
months.
Kessler et al (1996) have shown that following a
single intramuscular administration of a recombinant adeno-associated virus
(rAAV) vector, carrying either the lacZ or the human erythropoietin gene into
adult BALB/c mice leads to the local production of the foreign protein in the
muscle for at least 32 weeks; furthermore, human erythropoietin was secreted
and stimulated red blood cell production in the mouse for up to 40 weeks. This
finding was extended by Fisher et al (1997) who arrived to the unexpected
finding that intramuscular injection of highly purified recombinant AAV can
sustain a high level of transgene expression in the absence of adenovirus after
direct injection to the muscle in mice (Figure
4); this expands the potential of AAV for the treatment of inherited and
acquired diseases. Using this approach no humoral or cellular immune responses
were elicited after transfer of lacZ against the neoantigenic E. coli b-galactosidase.
The rAAV genome was integrated at single sites as head-to-tail concatamers into
nuclei of differentiated muscle fibers. Transfer of the lacZ gene using a
highly purified preparation of AAV which was injected into the skeletal muscle
of adult mice in the presence of E2a-deleted adenovirus to enhance transduction
followed by direct visualization of the b-galactosidase by X-gal
histochemistry revealed high transduction of muscle fibers by day 17 associated
with inflammation (Fig 4a and b).
Animals that received the same AAVlacZ in the absence of adenovirus
demonstrated higher levels of transduction that persisted for 240 days (Fig 4c-h).
Figure 4. Purified recombinant AAV-mediated
lacZ gene transfer to the muscle in adult mice sustains a high level of
expression and is inflammation-free. Purified AAVlacZ (1x109 genomes
in 25 ml) was injected into the tibialis
anterior of 5-week-old C57BL/6 mice and tissue was harvested at days 3 (c), 17 (d), 30 (e), 64 (f), and 180 (g, h) post-injection and analyzed by X-gal histochemistry. Samples
of AAVlacZ (1x109 genomes in 25 ml) were
also supplemented with an E2a mutant adenovirus dl802 (5x1010 A260
particles) just prior to injection and tissue was harvested at days 3 (a) and 17 (b) post-injection. Magnification: a-g, X10; h, X5.
Purified
AAVlacZ (175 ml , 1x1012
genomes/ml) was injected into the tibialis anterior of a male rhesus monkey.
Biopsies were taken 14 days post-injection and frozen sections were cut and
stained for b-galactosidase activity (i and j); magnification: I, X5; j, X10.
k and l:
rAAV vector expressing human b-glucoronidase
was injected into the tibialis anterior of 5-week-old C57BL/6 mice (1x109
genomes in 25 ml). 30 days post-injection
the muscle was harvested and frozen sections were cut and stained for b-glucoronidase.
From Fisher KJ, Jooss K, Alston J, Yang Y, Haecker SE, High K, Pathak R, Raper
SE, Wilson JM (1997) Recombinant
adeno-associated virus for muscle directed gene therapy. Nat Med 3, 306-312. Reproduced with the kind permission of the
authors and Nature America, Inc.
AAV-mediated delivery of the lacZ gene by direct
injection to brain tumors which were induced from human glioma cells in nude
mice showed that 30-40% of the cells along the needle track expressed b-galactosidase; subsequent delivery of the
HSV-tk/IL-2 genes to these tumors with AAV and administration of GCV to the
animals for 6 days resulted in a 35-fold reduction in the mean volume of tumors
compared with controls by a significant contribution from the bystander effect
(Okada et al, 1996).
A phase I clinical trial for CF is being conducted at
Johns Hopkins Hospital using AAV (see Kearns et al, 1996, and protocols #165,
166 in Appendix 1).
V. Herpes Simplex Virus-1 (HSV-1) and miniviral
vectors
HSV-1 has a capacity of inserting up to 30 kb of
exogenous DNA which is a clear advantage over the adenovirus (up to 7.5 kb of
exogenous DNA). High titer viral stocks can be prepared from HSV-1. HSV-1 also
displays a wide range of host cells and can infect nonreplicating cells such as
neuron cells in which the vectors can be maintained indefinitely in a latent
state. However, infection with HSV-1 is cytotoxic to cells because of residual
viral proteins produced by the virus. Strategies to circumvent this drawback
led to the development of viral vectors with a very large capacity for
insertion (almost as large as the size of the virus) which depend on defective
helper virus for replication and packaging into infectious virions (see below).
A miniviral vector can combine the advantage of cloning the gene in bacterial
plasmids, the high efficiency of virus-mediated gene transfer, and the
possibility to transfer large genomic DNA fragments including far upstream,
downstream and intronic regulatory elements.
The HSV-1 genome is a 152 kb double-stranded DNA
containing three origins of replication and encoding at least 72 unique
proteins; it consists of a unique long segment replicated from oriL and two
repeats flanking the unique segment each replicated from oriS. Spaete and
Frenkel (1982) have constructed plasmids containing the lytic viral origin of
replication, foreign DNA inserts, and the terminal packaging signal sequences;
in the presence of a wild-type helper virus such an amplicon was amplified into
multimeric tandemly-repeated forms of the original vector by rolling-circle
replication and was packaged into infectious HSV virions (Spaete and Frenkel,
1982). However, the helper virus caused death of the infected cells due to
lytic replication and this system is not amenable to gene therapy.
To circumvent this bottleneck two strategies have
been developed leading to replication-defective helper HSV: (i) a temperature-sensitive system permitted production of virion
stocks at 31o C whereas infection of cells at 37o C
caused inactivation of the helper virus which was incapable of entering the
lytic cycle and allowed delivery of the miniviral vector to the target cell
without causing its death. (ii) In a
different system, the immediately early gene IE3 was deleted from the helper virus; IE3 encodes for a protein (ICP4) essential for early and late viral
gene expression and replication; the helper cell line used for packaging had a
genomic insertion of the IE3 gene of
HSV which was functionally expressed allowing for complementation and for lytic
infection using the IE3-defective HSV
virus (DeLuca and Schaffer, 1987; Geller and Freese, 1990).
Two types of viral vectors have been used for gene
transfer to cancer cells: replication-incompetent vectors expressing a gene
product that leads to the destruction of the tumor or replication-competent
vectors that are inherently cytotoxic to the tumor cells. In order to combine
the two modes of action Miyatake et al (1997) used a defective HSV vector that
consisted of a defective particle, containing tandem repeats of the HSV-tk
gene, and a replication-competent, non-neurovirulent HSV mutant as a helper
virus. When glioma GL261 cells were infected with the tk-defective vector/helper
virus the HSV-TK activity was significantly higher than that in helper
virus-infected cells which contained a single copy of HSV-tk; subcutaneous
injection of these cells to C57BL/6 mice inducing gliomas led to a significant
decrease in tumor size after GCV treatment.
An HSV-1 vector containing a 6.8-kb fragment of the
rat tyrosine hydroxylase promoter (pTHlac) supported a seven- to 20-fold
increase in reporter gene expression in catecholaminergic cell lines compared
to noncatecho-laminergic cell lines. Furthermore, 4 days after stereotactic
injection into the midbrain of adult rats and for a duration of 6 weeks, pTHlac
supported a 10-fold targeting of b-galactosidase
expression to tyrosine hydroxylase-expressing neurons in the substantia nigra
pars compacta compared with pHSVlac; this long term expression was significant
compared to that from pHSVlac which decreased approximately 30-fold between 4
days and 6 weeks after gene transfer (Song et al, 1997); this study also shows
the importance of large control regions in the order of 7 kb in sustaining cell
type-correct gene expression, something feasible with HSV and liposomes but nor
with recombinant retrovirus, adenovirus, or AAV.
VI. HIV vectors for gene transfer
Recent studies have succeeded in exploiting the
deadly HIV-1 virus, after crippling some functions, as a gene delivery vehicle.
An advantage of HIV vectors has been the broad range of tissues and cell types
they can transduce, a property granted because lentiviral vectors are
pseudotyped with vesicular stomatitis virus G glycoprotein. Human lentiviral
(HIV)-based vectors can transduce non-dividing cells in vitro and deliver genes
in vivo; expression of transgenes in the brain has been detected for more than
six months. HIV vectors have been also used to introduce genes directly into
liver and muscle; 3-4% of the total liver tissue was transduced by a single
injection of 1-3 x 107 infectious units (I.U.) of recombinant HIV
with no inflammation or recruitment of lymphocytes at the site of injection.
Whereas expression of green fluorescent protein (GFP), used as a surrogate for
therapeutic protein, was observed for more than 22 weeks in the liver and for
over 8 weeks in the muscle using lentiviral vectors, little or no GFP could be
detected in liver or muscle transduced with the Moloney murine leukemia virus
(Mo-MLV), a prototypic retroviral vector (Kafri et al, 1997).
The development of a stable noninfectious HIV-1
packaging cell line capable of generating high-titer HIV-1 vectors is another
important step towards use of HIV vectors in gene therapy (Corbeau et al,
1996). A hybrid murine leukemia virus-based vector containing U3 and R
sequences from HIV-1 in place of the MLV U3 and R regions gave single
transcriptional unit retroviral vectors under the control of Tat; this vector
has advantages for anti-HIV gene therapy (Cannon et al, 1996).
Although replication-incompetent HIV vectors
displayed a strict CD4+ T cell tropism for gene transfer, a feature
important for AIDS therapy, it was thought to preclude HIV-based vectors for
other gene transfer applications; a two-step gene transfer system, however, was
developed to expand the host range of the HIV vector: in the first step, the
CD4 gene was introduced into target cells using a replication-defective adenoviral
vector; in the second step the CD4-transfected cells were incubated with HIV
vectors which resulted in stable integration and HIV-mediated gene transfer
(Miyake et al, 1996).
An HIV multiply attenuated vector in which the
virulence genes env, vif, vpr, vpu, and nef were deleted was able to deliver
genes in vivo into adult neurons (Zufferey et al, 1997).
HIV-mediated gene transfer was used to transfer the
GFP gene under control of CMV to retinal cells by injection into the subretinal
space of eyes in rats; the GFP gene was efficiently expressed in both
photoreceptor cells and retinal pigment epithelium; predominant expression in
photoreceptor cells was achieved using the rhodopsin promoter. The transduction
efficiency was high and photoreceptor cells in >80% of the area of whole
retina were expressing GFP (Miyoshi et al, 1997).
VII. Epstein-Barr virus (EBV) and baculovirus vectors
EBV is an episomaly-replicating virus in synchrony
with the cell cycle. EBV infects human cells causing mononucleosis; the
presence of the unique latent origin of replication (oriP) in EBV allows for
episomal replication of the virus in human cells without entering the lytic
cycle. The presence of oriP and of the replication initiator protein EBNA1 cDNA
on a vector allows episomal replication in human cells; in addition, plasmids
containing only oriP can replicate episomally into cell lines expressing EBNA-1
(Sun et al, 1994; Banerjee et al, 1995).
A hybrid HSV-1/EBV vector has been developed by Wang
and Vos (1996), which combines (i) the
HSV-1 lytic oriS; (ii) an HSV-1
packaging sequence which allows replication and packaging in the presence of
defective helper virus carrying a deletion in the IE3 gene in the E5 cell line expressing the IE3 gene; (iii) the
latent oriP of EBV and (iv) the EBNA-1 cDNA allow episomal replication
of the infectious vector in the E5 cell line so that viral stocks of high titer
can be made. Infection of tumor-derived fibroblast and epithelial cell lines in
culture and local injection of human liver tumors in nude mice was used to
demonstrate 95-99% efficiency of infection and transfer of the reporter b-galactosidase gene.
Genetically modified baculoviruses (Autographa
californica nuclear polyhedrosis virus) were used to efficiently deliver genes
into cultured hepatocytes of different origin; delivery into human hepatocytes
with baculovirus vectors approached 100% efficiency in cell culture and
expression levels were high when mammalian promoters were chosen. A number of
drawbacks preclude their direct application in vivo; nevertheless gene transfer
was feasible in ex vivo perfused human liver tissue (Sandig et al, 1996;
Hofmann et al, 1998 this volume).
VIII. Liposomal gene delivery
Abbreviations:
DC-CHOL: 3b
[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol
DDAB: dimethyldioctadecyl ammonium
bromide
DMRIE:
N-[1-(2,3-dimyristyloxy)propyl]-N,N-dimethyl-N-(2-hydroxyethyl) ammonium
bromide
DMTAP:
1,2-dimyristoyl-3-trimethylammonium propane
DOGS: Dioctadecylamidoglycylspermine
(Transfectam, Promega)
DOPE: dioleyl phosphatidylethanolamine
DOSPA:
2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl -1-propanaminium
trifluoroacetate
DOTAP:
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
DOTMA: N-[1-(2,3-dioleyloxy)
propyl]-n,n,n-trimethylammonium chloride
DPTAP: 1,2-
dipalmitoyl-3-trimethylammonium propane
DSTAP:
1,2-disteroyl-3-trimethylammonium propane
Lipofectin: DOTMA:DOPE 1:1 (GIBCO BRL)
A. Immune responses and toxicity of cationic
lipid-DNA complexes
Cationic lipids have been widely used for gene
transfer; a number of clinical trials (34 out of 220 total RAC-approved
protocols as of December 1997) use cationic lipids (see Table 4 in Martin and
Boulikas, 1998, this volume, pages 203-206). Although many cell culture studies
have been documented, systemic delivery of genes with cationic lipids in vivo
has been very limited. All clinical protocols use subcutaneous, intradermal,
intratumoral, and intracranial injection as well as intranasal, intrapleural,
or aerosol administration but not i.v. delivery because of the toxicity of the
cationic lipids and DOPE (see Table 4 in Martin and Boulikas, 1998, this
volume, pages 203-206).
Liposomes formulated from DOPE and cationic lipids
based on diacyltrimethylammonium propane (dioleoyl-, dimyristoyl-,
dipalmitoyl-, disteroyl-trimethylammonium propane or DOTAP, DMTAP, DPTAP,
DSTAP, respectively) or DDAB were highly toxic when incubated in vitro with
phagocytic cells (macrophages and U937 cells), but not towards non-phagocytic T
lymphocytes; the rank order of toxicity was DOPE/DDAB > DOPE/DOTAP >
DOPE/DMTAP > DOPE/DPTAP > DOPE/DSTAP; the toxicity was determined from
the effect of the cationic liposomes on the synthesis of nitric oxide (NO) and
TNF-a produced by activated macrophages (Filion and
Phillips, 1997).
Another factor to be considered before i.v.
injections are undertaken is that negatively charged serum proteins can
interact and cause inactivation of cationic liposomes (Yang and Huang, 1997).
Condensing agents used for plasmid delivery including polylysine,
transferrin-polylysine, a fifth-generation poly(amidoamine) (PAMAM) dendrimer,
poly(ethyleneimine), and several cationic lipids (DOTAP, DC-Chol/DOPE,
DOGS/DOPE, and DOTMA/DOPE) were found to activate the complement system to
varying extents. Strong complement activation was seen with long-chain
polylysines, the dendrimer, poly(ethyleneimine), and DOGS; complement
activation was considerably reduced by modifying the surface of preformed DNA
complexes with polyethyleneglycol (Plank et al, 1996).
B. Mechanism of liposome entry to cells
Cationic lipids increase the transfection efficiency
by destabilizing the biological membranes including plasma, endosomal, and
lysosomal membranes; indeed, incubation of isolated lysosomes with low
concentrations of DOTAP caused a striking increase in free activity of b-galactosidase, and even a release of the enzyme into
the medium demonstrating that lysosomal membrane is deeply destabilized by the
lipid; the mechanism of destabilization was thought to involve an interaction
between cationic liposomes and anionic lipids of the lysosomal membrane,
allowing a fusion between the lipid bilayers; the process was less pronounced
at pH 5 than at pH 7.4 and anionic amphipathic lipids were able to prevent
partially this membrane destabilization (Wattiaux et al, 1997).
In contrast to DOTAP and DMRIE which were 100%
charged at pH 7.4, DC-CHOL was only about 50% charged as monitored by a
pH-sensitive fluorophore; this difference decreases the charge on the external
surfaces of the liposomes and was proposed to promote an easier dissociation of
bilayers containing DC-CHOL from the plasmid DNA and an increase in release of
the DNA-lipid complex into the cytosol from the endosomes (Zuidam and
Barenholz, 1997).
C. Tissue targets using cationic liposomes in vivo
Although cationic lipids have been used widely for
the delivery of genes very few studies have used systemic i.v. injection of
cationic liposome-plasmid complexes because of the toxicity of the lipid
component and certainly in animal models, not humans. Administration by i.v.
injection of two types of cationic lipids of similar structure, DOTMA and
DOTAP, has shown that the transfection efficiency was determined mainly by the
structure of the cationic lipid and the ratio of cationic lipid to DNA; the
luciferase and GFP gene expression in different organs was transient, with a
peak level between 4 and 24 hr, dropping to less than 1% of the peak level by
day 4 (Song et al, 1997).
Figure 5 shows the effect of cationic lipid:DNA ratio on
transfection efficiency after i.v. tail injection. Luciferase activity was
detected in all organs examined with the highest level in lung. In the absence
of neutral lipid both DOTMA and DOTAP promoted a linear increase in luciferase
activity in the lung with increasing lipid:DNA from 12:1 to 36:1 nmol lipid: mg of DNA. DOTMA was 10 times more efficient than
DOTAP (106 versus 107 relative luciferase units (RLU) per
mg protein. Cholesterol (Chol) mixed with DOTMA (1:1 molar ratio) decreased the
level of gene expression in the lung whereas cholesterol did not affect the
transfection efficiency of DOTAP liposomes. Inclusion of DOPE into either DOTAP
or DOTMA liposomes significantly decreased the transfection efficiency by
100-fold in the lung.
When a group of four cationic lipids with identical
head group but of different fatty acyl chains were tested for their
transfection efficiencies (Figure 6);
these included DOTAP, DMTAP, DPTAP, and DSTAP. The C14 acyl
chain-lipid DMTAP had a similar transfection efficiency as DOTAP which has 18
carbon atoms in the acyl chain and one double bond (C18D9); on
the contrary, the transfection efficiencies of DPTAP (C16) was
10-100 fold lower and that of DSTAP (C18) was 100 to 1000 fold
lower.
Confocal microscopy of lung tissue after injection of
25 mg pCMV-GFP plasmid DNA complexed with DOTMA liposomes
to mice (Figure 7) has shown that
the type of cells that express the transgene are the endothelial cells that
have typical characteristics of neighboring multiple air-sac structures (Figure 7D).
A number of different organs in vivo can be targeted
after liposomal delivery of genes or oligonucleotides. Intravenous injection of
cationic liposome-plasmid complexes by tail vein in mice targeted mainly the
lung and to a smaller extend the liver, spleen, heart, kidney and other organs
(Zhu et al, 1993). Intraperitoneal injection of a plasmid-liposome complex
expressing antisense K-ras RNA in nude mice inoculated i.p. with AsPC-1
pancreatic cancer cells harboring K-ras point mutations and PCR analysis
indicated that the injected DNA was delivered to various organs except brain
(Aoki et al, 1995).
A number of factors for DOTAP:cholesterol/DNA complex
preparation including the DNA:liposome ratio, mild sonication, heating, and
extrusion were found to be crucial for improved systemic delivery; maximal gene
expression was obtained when a homogeneous population of DNA:liposome complexes
between 200 to 450 nm in size were used. Cryo-electron microscopy showed that
the DNA was condensed on the interior of invaginated liposomes between two
lipid bilayers in these formulations, a factor that was thought to be
responsible for the high transfection efficiency in vivo and for the broad
tissue distribution (Templeton et al, 1997).
Steps to improve for successful liposome-mediated
gene delivery to somatic cells include persistence of the plasmid in blood
circulation, port of entry and transport across the cell membrane, release from
endosomal compartments into the cytoplasm, nuclear import by docking through
the pore complexes of the nuclear envelope, expression driven by the
appropriate promoter/enhancer control elements, and persistence of the plasmid
in the nucleus for long periods. A number of strategies for liposomal delivery
and for enhancing the efficiency of uptake by the cells and release from
endosomal compartments of plasmid or oligonucleotide DNA are reviewed in the
following article (Martin and Boulikas, 1998).
Figure 5. Effect of cationic lipid:DNA
ratio on transfection efficiency after i.v. tail injection. Each mouse received
25 mg of pCMV-Luciferase plasmid DNA
complexed with various amounts of liposomes indicated on the charts (at 1:1
ratio when two lipids were used). Luciferase activity was assayed 20 h after
i.v. injection in up to 5 different tissues represented with different bar
forms: the empty bar is lung, the large stripe bar is spleen, the small stripe
is heart, gray bar is liver, and black bar is kidney. Four time points (12h,
24h, 36h, and 48h from i.v. injection) of luciferase activity are shown.
Numbers +02 to +08 to the left of the figure indicates 102 to 108
relative luciferase units (RLU) per mg protein in the tissue. From Song YK, Liu
F, Chu S, Liu D (1997)
Characterization of cationic liposome-mediated gene transfer in vivo by
intravenous administration. Hum Gene
Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu,
University of Pittsburgh) and Mary Ann Liebert, Inc.
Figure 6. Effect of fatty acyl chain
composition on transfection efficiency. Luciferase activity was assayed 20 h
post-injection in the lung, spleen, heart, liver, and kidney (in the order
shown, see legend to previous figure for bar symbols). From Song YK, Liu F, Chu
S, Liu D (1997) Characterization of
cationic liposome-mediated gene transfer in vivo by intravenous administration.
Hum Gene Ther 8, 1585-1594 with the
kind permission of the authors (Dexi Liu, University of Pittsburgh) and Mary
Ann Liebert, Inc.
Figure 7. Analysis of green fluorescence
protein (GFP) expression in the lung using confocal microscopy. 25 mg pCMV-GFP
plasmid DNA complexed with DOTMA liposomes were injected to mice and GFP
expression in the lung was examined 14 h post-injection . (A): transmitted light image and (B): fluorescence image (green) were observed at low magnification
(Bar 100 mm). C and D are the images
obtained at higher magnification showing the localization of GFP in endothelial
cells (Bar 25 mm). E and F are the images
from control animals injected with pCMV-Luc plasmid rather than GFP plasmid.
From Song YK, Liu F, Chu S, Liu D (1997)
Characterization of cationic liposome-mediated gene transfer in vivo by
intravenous administration. Hum Gene
Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu,
University of Pittsburgh) and Mary Ann Liebert, Inc.
D. Cationic lipids in oligonucleotide transfer
Encapsulation of oligonucleotides into liposomes
increased their therapeutic index, prevented degradation in cultured cells and
in human serum and reduced toxicity to cells (Thierry and Dritschilo, 1992;
Capaccioli et al, 1993; Morishita et al, 1993; Williams et al, 1996; Lewis et
al, 1996); conjugation to a fusogenic peptide enhanced the biological activity
of antisense oligonucleotides (Bongartz et al, 1994). However, most studies
have been performed in cell culture, and very few in animals in vivo; there is
still an important number of improvements needed before these approaches can
move to the clinic.
Zelphati and Szoka (1997) have found that complexes
of fluorescently labeled oligonucleotides with DOTAP liposomes entered the cell
using an endocytic pathway mainly involving uncoated vesicles; oligonucleotides
redistributed from punctate cytoplasmic regions into the nucleus; this process
was independent of acidification of the endosomal vesicles. The nuclear uptake
of oligonucleotides depended on several factors such as charge of the particle
where positively charged complexes were required for enhanced nuclear uptake;
DOTAP increased over 100 fold the antisense activity of a specific
anti-luciferase oligonucleotide. Physicochemical studies of
oligonucleotide-liposome complexes of different cationic lipid compositions
indicated that either phosphatidylethanolamine or negative charges on other
lipids in the cell membrane are required for efficient fusion with cationic
liposome-oligonucleotide complexes to promote entry to the cell (Jaaskelainen
et al, 1994).
Similar results were reported by Lappalainen et al (1997); digoxigenin-labeled
oligodeoxynucleotides (ODNs) complexed with the polycationic DOSPA and the
monocationic DDAB (with DOPE as a helper lipid) were uptaken by CaSki cells in
culture by endocytosis. The nuclear membrane was found to pose a barrier
against nuclear import of ODNs which accumulated in the perinuclear area.
Although DOSPA/DOPE liposomes could deliver ODNs into the cytosol, they were
unable to mediate nuclear import of ODNs; on the contrary
oligonucleotide-DDAB/DOPE complexes with a net positive charge were released
from vesicles into the cytoplasm; it was determined that DDAB/DOPE mediated
nuclear import of the oligonucleotides.
DOPE-heme (ferric protoporphyrin IX) conjugates,
inserted in cationic lipid particles with DOTAP, protected oligoribonucleotides
from degradation in human serum and increased oligoribonucleotide uptake into
2.2.15 human hepatoma cells; the enhancing effect of heme was evident only at a
net negative charge in the particles (Takle et al, 1997). Uptake of liposomes
labeled with 111In and composed of DC-Chol and DOPE was primarily by
liver, with some accumulation in spleen and skin and very little in the lung
after i.v. tail injection; preincubation of cationic liposomes with
phosphorothioate oligonucleotide induced a dramatic, yet transient,
accumulation of the lipid in lung which gradually redistributed to liver. The
mechanism of lung uptake involved entrapment of large aggregates of
oligonucleotides within pulmonary capillaries at 15 min post-injection via
embolism; labeled oligonucleotide was localized primarily to phagocytic
vacuoles of Kupffer cells at 24 h post-injection; nuclear uptake of
oligonucleotide in vivo was not observed (Litzinger et al, 1996).
Phosphorothioate oligonucleotides were found in most
tissues 48 h after i.p. administration with highest concentrations in kidney
and liver; complexation of the oligonucleotide with DOTMA did not affect
neither the oligonucleotide uptake nor its tissue distribution in normal mice
but increased the oligonucleotide cellular uptake (4-10 times) in LOX ascites
tumors (Saijo et al, 1994).
Triplex-forming ODNs were delivered to cells in
culture using adenovirus-polylysine-ODN complexes designed to take advantage of
the receptor mediated endocytosis of adenoviruses to transfer the ODNs to the
cell nucleus; nuclear uptake peaked at 4 h and intact ODN persisted in the
nucleus with a half-life of 12 h (Ebbinghaus et al, 1996).
E. Fusogenic peptides enhance gene transfer
efficiency
Enveloped viruses have evolved efficient mechanisms
to release their genomes from the endosomes into the cytoplasm of the host
cells; specific envelope proteins of the nucleocapsid are capable of
destabilizing the endosomal membrane. Therefore, inactivated viruses have been
used to enhance the transfer of plasmids. Addition of adenoviral particles
capable of inducing endosome lysis (Blumenthal et al, 1986), mediated by a
conformational change in the adenovirus penton protein induced at the lower pH
of endosomes (Seth, 1994) can increase transfection efficiency 100-1000 fold
using 109 adenoviral particles/ml and the transferrin receptor
(Curiel et al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al,
1993; Morishita et al, 1993; Harries et al, 1993; Curiel, 1994; reviewed by
Ledley, 1995).
Use of fusogenic peptides from influenza virus
hemagglutinin HA-2 enhanced greatly the efficiency of
transferrin-polylysine-DNA complex uptake by cells; in this case the peptide
was linked to polylysine and the complex was delivered by the transferrin receptor-mediated
endocytosis (Wagner et al, 1992a; Plank et al, 1994). This peptide had the
sequence: GLFEAIAGFIENGWEGMID GGGYC and was able to induce the release of the
fluorescent dye calcein from liposomes prepared with egg yolk
phosphatidylcholine which was higher at acidic pH; this peptide was also able
to increase up to 10-fold the anti-HIV potency of antisense oligonucleotides,
at a concentration of 0.1-1 mM, using CEM-SS lymphocytes in culture (Bongartz
et al, 1994). This peptide changes conformation at the slightly more acidic
environment of the endosome destabilizing and breaking the endosomal membrane
(Murata et al, 1992; Bullough et al, 1994). Fusogenic peptides have been used
by other investigators (Midoux et al, 1993; Kamata et al, 1994). It is thought
that several fusogenic peptides self-assemble following their conformational
change forming a transmembrane channel (Bongartz et al, 1994).
Sendai virosomes were effective for delivering AAV
neuropeptide Y (NPY) cDNA constructs in vivo. Injections into brain neocortex of
Sendai-virosome encapsulated rAAV construct expressing NPY increased NPY-like
immunoreactivity in neurons but not glia; injections into the rat hypothalamic
para-ventricular nucleus increased body weight and food intake for 21 days (Wu
et al, 1996). Tomita et al (1996) have found that newborn mice can sustain
expression of the insulin gene delivered by Sendai virus-liposome complexes for
at least 8 weeks as assayed by reverse transcriptase PCR and radioimmunoassay,
compared to 2 weeks in adult animals.
A 27 residue peptide vector, containing the fusion
sequence of HIV gp41 and the nuclear localization sequence of SV40 T antigen
was used to deliver oligonucleotides to cell nuclei very rapidly in cell
culture (1h). The complexes formed strongly increased the stability of the
oligonucleotide to nucleases, enhanced passage through the plasma membrane, and
led to endosomal internalization (Morris et at, 1997).
Certain cationic lipids are endowed with a better
ability to disrupt the endosomal membrane and promote release of the plasmid to
the cytoplasm, a prelude for its nuclear import. Presentation of plasmid DNA to
COS cell cultures using three different lipid formulations: (i) vectamidine
(3-tetradecylamino-N-tert-butyl-N'-tetradecylpropionamidi ne), (ii) DOTMA:DOPE (Lipofectin), and (iii) DMRIE-Chol (1:1) resulted in
complex entry via endocytosis for all three cationic lipids as revealed using
transmission electron microscopy. However, the endosomal membrane in contact
with complexes containing vectamidine or DMRIE-Chol, but not Lipofectin, often
exhibited a disrupted morphology (El Ouahabi et al, 1997).
F. Plasmid condensation with spermine, polylysine,
protamine, histones enhances the transfection efficiency
DNA can be presented to cells in culture as a complex
with polycations such as polylysine, or basic proteins such as protamine, total
histones or specific histone fractions (Fritz et al, 1996), cationized albumin,
and others (Smull and Ludwig, 1962). These molecules increase the transfection
efficiency. In addition to HMG1, also histone H1 and HMG17 were identified as
transfection-enhancing proteins in cell culture (Zaitsev et al, 1997). Histone
H2A significantly enhanced in vitro DNA transfection whereas other histones and
anionic liposomes did not (Balicki and Beutler, 1997). Gene transfer through
the asialo-glycoprotein receptor-mediated endocytosis pathway was enhanced with
the histones H1, H2a, H2b, H3, and H4 which were galactosylated with the
crosslinker agent, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, conjugated to
DNA and then used to transfect HepG2 cells, which display the
asialoglycoprotein receptor (Chen et al, 1994). Plasmid DNA and HMG1 were
efficiently co-encapsulated in liposomes by agitation and sonication, and were
co-introduced into cells by hemagglutinating virus of Japan (HVJ)-mediated
membrane fusion; the presence of HMG1 enhanced 3-fold the transfection
efficiency (Kato et al, 1991).
The interaction of plasmid DNA with protamine sulfate
followed by the addition of DOTAP cationic liposomes offered a better
protection of plasmid DNA against enzymatic digestion and gave consistently
higher gene expression in mice via tail vein injection compared with DOTAP/DNA
complexes; 50 mg of luciferase-plasmid per mouse gave 20 ng
luciferase protein per mg extracted tissue protein in the lung which was
detected as early as 1 h after injection, peaked at 6 h and declined
thereafter. Intraportal injection of protamine/DOTAP/DNA led to about a
100-fold decrease in gene expression in the lung as compared with i.v.
injection; endothelial cells were the primary locus of lacZ transgene
expression (Li and Huang, 1997). Protamine sulfate enhanced plasmid delivery
into several different types of cells in vitro using the monovalent cationic
liposomal formulations (DC-Chol and lipofectin); this effect was less
pronounced with the multivalent cationic liposome formulation, lipofectamine
(Sorgi et al, 1997).
Spermine has been found to enhance the transfection
efficiency of DNA-cationic liposome complexes in cell culture and in animal
studies; this biogenic polyamine at high concentrations caused liposome fusion
most likely promoted by the simultaneous interaction of one molecule of
spermine (four positively charged amino groups) with the polar head groups of
two or more molecules of lipids. At low concentrations (0.03-0.1 mM) it
promoted anchorage of the liposome-DNA complex to the surface of cells and
enhanced significantly transfection efficiency (Boulikas et al, in
preparation).
Because the receptor for ecotropic viruses is a
transporter for basic amino acids, use of a histone as a facilitator increased
the efficiency of retroviral infection (Singh and Rigby, 1996). Polybrene is
the usual agent employed during retroviral infection. For supernate infections,
concentrations of 5-10 mg/ml of protamine provided essentially the same
infection efficiency as polybrene; protamine displayed low toxicity on a range
of cell types and increased 7-fold the efficiency of retroviral infection
(Cornetta and Anderson, 1989).
The polycations polybrene, protamine, DEAE-dextran,
and poly-L-lysine significantly increased the efficiency of adenovirus-mediated
gene transfer in cell culture; this was thought to act by neutralizing the
negative charges presented by membrane glycoproteins which reduce the
efficiency of adenovirus-mediated gene transfer (Arcasoy et al, 1997).
G. Targeted gene delivery
Targeting a specific cell type or animal tissue is an
important goal of gene therapy. Many different approaches have been undertaken
to achieve targeting. A recombinant adenovirus encoding an anti-erbB-2
intracellular single-chain antibody (sFv) displayed a genetic selectivity for
the erbB-2-positive prostate carcinoma cell lines DU145 and LNCaP; delivery of
this recombinant adenovirus resulted in cytotoxicity to the DU145 and LNCaP,
but not PC-3, cell lines and reduced the clonogenic capacity of DU145 cells
cultured alone or mixed with various ratios of irradiated human bone marrow.
This finding led to a strategy for effectively reducing DU145 and
erbB-2-positive primary prostate tumor contamination in bone marrow cultures
(Kim et al, 1997). Delivery of an anti-erbB-2 single chain (sFv) antibody gene
for previously treated ovarian and extraovarian cancer patients is in clinical
trials using adenoviral gene delivery (protocol #133).
A luciferase expression vector (pRSVLuc)
non-covalently linked to a humanized HER2 antibody (rhuMAbHER2) covalently
modified with poly-L-lysine bridges was able to direct gene transfer to HER2
expressing cells in vitro (Foster and Kern, 1997).
A targeting gene therapy approach for hematopoietic
stem/progenitor cells has been directed to cell lines expressing the c-kit
receptor; plasmid DNA containing a luciferase reporter gene was condensed with
polylysine covalently linked to streptavidin (which binds biotinylated ligand)
and with polylysine covalently linked to adenovirus (to achieve endosomal
lysis) with the final addition of biotinylated steel factor; omission of the
adenovirus endosomalytic agent from the vector resulted in the loss of gene
expression (Schwarzenberger et al, 1996).
Systemic administration of a c-fos antisense,
regulated by mouse mammary tumor virus (MMTV) control elements in a retroviral
vector, showed expression only in breast epithelium although the vector could
be detected in several tissues thus supporting targeting to MMTV-regulated
tissues (Arteaga and Holt, 1996).
Liposomes coated with polyethyleneglycol (PEG) can be
efficiently targeted to tumor cells that express folate receptors (KB cells) via
conjugation of folate to a PEG spacer of 25 nm in length; shorter PEG spacers
were not efficient in mediating binding of the liposomes to KB cells (Lee and
Low, 1995).
Neri and coworkers (1997) were able to target an
angiogenesis-associated oncofetal fibronectin (B-FN) isoform by
affinity-matured recombinant antibody fragments. B-FN is present in vessels of
neoplastic tissues during angiogenesis but is absent from mature vessels and
could provide a target for diagnostic imaging and therapy of cancer. Phage
display libraries were screened to isolate human antibody fragments able to
recognize this isoform across species; imaging of F9 murine teratocarcinomas
grafted in nude mice is shown on Figures
8 and 9.
H. Targeted gene delivery with peptide-displaying
phages
Development of methods to display and select
collections of peptides specific for binding a target provide valuable tools to
identification of peptide drugs; peptides could be selected for binding
biological targets including cell surface receptor molecules, DNA, antibodies,
or whole cells. The technique of peptide-displaying phages has been developed
for targeted gene delivery. Selection of cell surface-binding peptides, ideally
specific for each type of cell in the human body, will be used for
incorporation into gene delivery vehicles to achieve the long-searched tissue
specificity of the vector (reviewed by Russell, 1996).
Development of the random peptide library as a source
of specific protein binding molecules (Devlin et al, 1990) and exposure of
random peptides on the surface of phages (Cwirla et al, 1990) has been the
catalyst for progress in this promising field. Libraries of random 8 to 12
amino acid peptides expressed on the N-terminus of the pIII protein of the fd
phage or on the N-terminus of the pVIII major coat protein of the same phage
have been selected that bind the extracellular domain of human IL-1 receptor;
screening was against immobilized IL-1 receptor extracellular domain. Two
families of peptides could act as antagonists blocking triggering of the IL-1
signaling pathway; because IL-1 levels become elevated in autoimmune and
inflammatory disorders, these peptide antagonists of IL-1 receptor could
provide novel drugs for these diseases (Yanofsky et al, 1996).
Phages displaying known integrin-binding peptides
have been shown to bind and enter mammalian cells (Hart et al, 1994). A peptide
antagonist to thrombin receptor has been identified using phage display
(Doorbar and Winter, 1994). Production of cell-targeting ligands has been
achieved by cell-binding peptides specific for different cell types in culture;
these peptides are selected through six rounds of binding (and amplification of
phage clones) to a particular cell type from random peptide-presenting phage
libraries; the selected peptides are apparently recognizing specific surface
receptor molecules. For example, the 20mer peptide KTLTLEAALRNAWLREVGLK has
been selected for its high affinity for PEA10 mouse fibroblast cells binding
1000 more efficiently to the cells than random peptides (Barry et al, 1996).
IX. Gene delivery with polymers, peptides and other
means
A. Delivery of transferrin-polylysine-DNA complexes
A number of polymers have been tested and shown to
enhance significantly the transfection efficiency of plasmids but also of
viruses; the enhancement in transfection results from a facilitation in the
interaction of plasmids with the cell surface, transport to endosomes, release
to the cytoplasm, and in some cases nuclear import (reviewed by Behr, 1994).
Figure 8. Role of antibody valence. ¨ Targeting
of fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma
grafted in nude mice using the monomeric scFv(CGS-1) and dimeric scFv(CGS-1)2
directed to oncofetal fibronectin; the dimeric scFv(D1.3)2 with a
binding specificity to lysozyme was used as a negative control. t: tumor; b:
bladder. From Neri D, Carnemolla B, Nissim A, Leprini A, Querze G, Balza E,
Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G (1997) Targeting by affinity-matured recombinant antibody fragments
of an angiogenesis associated fibronectin isoform. Nat Biotechnol 15, 1271-1275. Reproduced with the kind permission
of the authors (Dario Neri, Inst for Mol Biology and Biophysics, ZŸrich) and
Nature America, Inc.
 Figure 9. Role of antibody affinity. Targeting of
fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma
grafted in nude mice using the affinity-matured scFv(CGS-2) and the lower
affinity scFv(28SI) directed to the same epitope of oncofetal fibronectin; Tte
dimeric scFv(D1.3)2 with a binding specificity to lysozyme was used
as a negative control. t: tumor; b: bladder. From Neri D, Carnemolla B, Nissim
A, Leprini A, Querze G, Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L,
Winter G (1997) Targeting by
affinity-matured recombinant antibody fragments of an angiogenesis associated
fibronectin isoform. Nat Biotechnol
15, 1271-1275. Reproduced with the kind permission of the authors (Dario Neri,
Inst for Mol Biology and Biophysics, ZŸrich) and Nature America, Inc.
Curriel and coworkers (1991) have used the
transferrin receptor on the surface of mammalian cells to deliver
plasmid-polylysine-transferrin complexes to cells. These complexes are taken up
by endosomes following receptor binding, a method which suffers from that the
endocytosed DNA is trapped in the intracellular vesicle and is later largely
destroyed by lysosomes; use of the capacity of the adenoviruses to disrupt
endosomes as part of their entry mechanism to the cells have augmented over
1000-fold the efficiency of gene transfer. This method has been further
developed in collaboration with Max Birnstiel; true chemical coupling rather
than simple addition of replication-defective adenovirus particles has shown a
further increase in transfection efficiency (Cotten et al, 1992; Wagner et al,
1992a,b).
A monoclonal antibody against the CE7 antigen (chCE7)
covalently linked to polylysine in the presence of chloroquine was able to
transfect NB cells as efficiently as DOTAP, transfectam, TF-X50, or
lipofectamine; furthermore, transfection was not observed in cell lines
negative for the CE7 antigen (Coll et al, 1997).
B. Polyethylenimine (PEI, ExGen500)
Polyethylenimine, H2N-(CH2-CH2-NH)n-H,
is an organic polymer with a potential for high cationic charge. PEI enhanced
transfection efficiency in cell culture (Boussif et al, 1996). ExGen500 is a
linear 22 kDa form of PEI, which was found to be more efficient than
lipofectin, DOTAP and DOGS in delivering the luciferase reporter gene in both
newborn and adult rabbit lungs (Ferrari et al, 1997). The PEI 800 kDa and PEI
25 kDa branched polymers have also been used to transfer marker genes to the
newborn and adult mouse brain (Boussif et al, 1995; Abdallah et al, 1996).
Another advantage of PEI is that it yields high transfection efficiencies with
a charge ratio of DNA:PEI close to neutral; this is an advantage as particles
with a net positive charge (cationic lipid-DNA complexes) interact with
circulating serum proteins or anionic components of the extracellular matrix in
the various tissues hindering their bio-availability (Schwartz et al, 1995).
The high transfection efficiency of ExGen 500 was
suggested to arise from the Òproton spongeÓ effect which leads to osmotic
swelling of endosomes which have uptaken the DNA complexes (Ferrari et al,
1997).
Different cationic compositions may result in
different targeting and transfection abilities to specific organs; the
branched, 25-kD polyethylenimine polymer (PEI 25k) was superior over DOTAP and
DOGS (Transfectam) in the efficiency
of transfection of the kidney when complexes of these cations with luciferase
plasmid were injected into the left renal artery of rats; luciferase activity
peaked at 2 days, was still significantly higher than controls at 7 days, but
was undetectable at 14 days post-injection (Boletta et al, 1997).
Scanning force microscopy allowed plasmid DNA strands
to be visualized without drying in incomplete condensates prepared with varying
stoichiometries of lipospermine or polyethylenimine in physiological solution;
discrete nucleation centers of condensation were observed often surrounded by
folded loops of DNA using either condensing agent; increasing the amount of
lipospermine or polyethylenimine led to further aggregation through folding
rather than winding of the DNA (Dunlap et al, 1997).
C. APL PolyCat57 and other polymers
APL PolyCat57 is a synthetic polyamino derivative
(nonpeptide, nonlipid polymer) with a glucose backbone which was used by
Goldman and coworkers (1997) for gene transfer in vivo and in vitro. A variety
of human carcinoma cell lines were transfected with an efficiency superior to
that of Lipofectamine. The polymer-plasmid complex was resistant to inhibition
by serum allowing for efficient gene transfer in vivo. The level of the
luciferase and b-galactosidase reporter gene expression after
intrathecal injection, evaluated in animal models bearing stereotactically
implanted D54-MG human glioma cell xenografts, was comparable to that obtained
with an adenoviral vector.
Liposomes composed of the cationic peptide amphiphile
N,N-dihexadecyl-N a-[6-(trimethyl ammonio)- hexanoyl]-L-alaninamide bromide comprising an
L-alanine residue interposed between a charged head group and a double-chain
segment were more effective and less toxic than lipofectin, and DOTAP for the
transfection of COS-7 cells (Kato et al, 1996).
D. Adenovirus-polymer complexes
An adenovirus/DNA complex was constructed by
chemically linking poly-L-lysine to the capsid of the replication-defective
adenovirus dl312; this complex was then coupled with plasmid DNA via ionic
interaction. This system was used to deliver the tumor suppressor protein p53
to the p53- human lung cancer cell line H1299, both in vitro and in
vivo, leading to induction of apoptosis; injection of the complex carrying the
p53 gene to subcutaneous tumor sites 5 days after tumor cell implantation
resulted in a significant inhibition of tumorigenicity as measured by the
number and size of tumors that developed 21 days after treatment (Nguyen et al,
1997a,b).
Complexes of cationic polymers and cationic lipids
with adenovirus increased adenovirus uptake and transgene expression in cells
that were inefficiently infected by adenovirus alone; infection by both
complexes was independent of adenovirus fiber and its receptor, occurred via a
different cellular pathway than adenovirus alone, and enhanced gene transfer to
the nasal epithelium of cystic fibrosis mice in vivo (Fasbender et al, 1997).
E. Peptides in transfer of oligonucleotides
Peptide/oligonucleotide complexes containing a
peptide vector and single or double stranded oligonucleotides were delivered
into cultured mammalian cells in less than 1 h with relatively high efficiency
(90%) at a peptide/oligonucleotide ratio of 20/1. The peptide vector, termed
MPG (27 residues), contained a hydrophobic domain derived from the fusion
peptide of HIV gp41 and a hydrophilic domain derived from the nuclear
localization sequence of SV40 T-antigen. The complexes involved electrostatic
interactions between basic peptide residues and phosphate groups from the
oligos, as well as additional peptide-peptide interactions yielding
oligonucleotides most likely coated with several molecules of MPG; these
complexes, which strongly increased the stability of the oligonucleotide to
nucleases, enhanced passage through the plasma membrane, and did lead to
endosomal internalization; such complexes are promising delivery systems for
oligos (Morris et at, 1997).
The cationic amphipathic peptide WEAKLAKALA
KALAKHLAKALAKALKACEA was synthesized by Wyman et al (1997) to display hydrophobic leucine residues on one
side and hydrophilic lysine residues on the other after coiling to an
amphipathic a-helix at pH 7.5; this peptide was suited for oligonucleotide nuclear
delivery when complexes were prepared at a 10/1 (+/-) charge ratio and was
endowed with the additional property of destabilizing membranes in cell
culture.
F. Plasmoviruses
Plasmoviruses are plasmids capable of expressing all
the viral genes required for generating infectious particles and packaging a
defective genome; transfected as plasmids, plasmoviruses transform the
transduced cells into packaging cells; the cells then release infectious
replication-defective retrovirus particles of typical type C as revealed by
electron microscopy, with the gag proteins correctly processed in the released
particles and containing the transgene to be transferred. Released particles
are capable of infecting nearby cells and to propagate the transgene in the
culture, resulting in stable integration of plasmovirus proviral DNA into the
host genome of infected cells. Nonintegrated plasmovirus DNA was not toxic for
the cells. Plasmoviruses have been used for the propagation of the HSV-tk gene
in cell culture resulting in a major improvement in therapeutic efficacy after
ganciclovir treatment, when compared to that of plasmovirus constructs that
cannot propagate (Morozov et al, 1997).
G. Particle-mediated gene transfer (PMGT) or gene gun
The particle-mediated gene transfer (PMGT) technique, unlike retroviral
transfection, does not require tumor cell proliferation in vitro for gene
transfer; instead, tumor tissue can be dissociated into small tissue clumps or
cell aggregates and then immediately transfected using the gene gun; plasmid-coated
gold particles are delivered to tumor cells using helium pressure with a
hand-held gene delivery device overcoming the cumbersome exposure of the
patient to viral antigens. PMGT with gold particles coated with human GM-CSF
plasmid DNA is being used to transfect melanoma or renal carcinoma tissue from
patients; tumor cells are then lethally-irradiated and patients are
intradermally vaccinated to elicit anti-tumor immune responses (Mahvi et al,
1997).
Gene gun-mediated DNA delivery into the epidermis
overlying an established intradermal murine tumor was used to compare the
antitumor effect of several transgene expression plasmids encoding the
cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF; IL-12 was superior (see IL-12)
(Rakhmilevich et al, 1997).
X. Direct injection of naked plasmid DNA
Naked plasmid has been injected to various tissues
and has shown transfection efficiency. Muscle has been the classical tissue in
a number of studies. Intramuscular (i.m.) administration of expression plasmids
may directly deliver the plasmid to the cytoplasm by damaging the myofibril
along the injected area. Direct i.m. injection of naked VEGF plasmid DNA was
used in rabbits to optimize treatment of acute limb ischemia; after ligation of
distal external iliac artery in New Zealand White rabbits, direct injection of
500 mg of a VEGF165 expression vector into the
ischemic thigh muscles resulted in more angiographically recognizable
collateral vessels at 30 days posttransfection (Tsurumi et al, 1996,
1997). Injection, guided by
intense illumination along the longitudinal axis of the mouse quadriceps muscle
and parallel to the myofibers, yielded 200-fold higher levels of luciferase
expression than perpendicular injection (Levy et al, 1996).
Other tissues including skin, liver, brain and the
gastric submucosa have been successfully transduced with reporter gene cDNA
using naked plasmid delivery. Skin from transglutaminase 1 (TGase1)-deficient
patients suffering with lamellar ichthyosis was regenerated on nude mice;
repeated in vivo direct injections of naked DNA using a TGase1 expression
plasmid showed restoration of TGase1 expression in the correct tissue location
(Choate and Khavari, 1997).
A naked luciferase expression vector injected
intracerebrally in mice provided expression of the luciferase transgene, in
both neurons and glia cells (Schwartz et al, 1996). Naked plasmid DNA in
hypertonic solutions, injected intraportally in mice whose hepatic veins were
transiently occluded, resulted in high levels of luciferase and b-galactosidase expression in 1% of the hepatocytes
throughout the entire liver using 100 mg DNA (Budker et al,
1996).
A single injection through the tail vein of a naked
endothelium-derived nitric oxide cDNA plasmid caused a significant reduction of
systemic blood pressure for 5 to 6 weeks in spontaneously hypertensive rats
(Lin et al, 1997). In vivo delivery
of a luciferase gene under control of the human cytomegalovirus immediate early
gene promoter after intravenous injection (50 mg
DNA) via the tail vein into ICR mice has shown that the DNA was degraded with a
half-life of less than 5 min from the blood; plasmid DNA was differentially
retained in the lung, spleen, liver, heart, kidney, bone morrow, and muscle up
to 24 h postinjection; femtogram levels of plasmid were detected only in muscle
at 6 months post infection (Lew et al, 1995). pCAT was rapidly degraded after
incubation with mouse whole blood in vitro with a half-life of approximately 10
min and much faster after intravenous injection; i.v. injection of
radioactively-labeled pCAT showed rapid elimination from the plasma due to
extensive uptake by non-parenchymal cells in the liver, a process thought to be
mediated via scavenger receptors on these cells (Kawabata et al, 1995).
Direct injection of plasmids carrying reporter genes
into
the gastric submucosa of adult rats resulted in transient expression (1-3 days
and in exceptional cases for up to 21 days) in smooth muscle cells of the
muscularis mucosae and the muscular layer and mesenchymal cells in the lamina
propria. These studies indicate that the gastrointestinal nonepithelial tissue,
a useful target for in vivo gene transfer, can be transfected with naked DNA
(Takehara et al, 1996).
Clinical protocols #158-161 use naked plasmid DNA.
Protocol #158 proposes transferring the carcinoembryonic antigen to autologous
tumor cells in patients with metastatic colorectal cancer for cancer
immunotherapy (Appendix 1, page
170). Protocols 159 and 160 use an intraarterial angioplasty catheter to
deliver VEGF cDNA plasmid to patients with peripheral artery disease or
restenosis. Plasmid DNA coding for
tumor idiotype is being used for intramuscular injection for immumotherapy of
non-HodgkinÕs B-cell lymphoma (protocol #161).
Table 1 summarizes the advantages and disadvantages of the
principal gene delivery methods.
Table 1. Advantages and drawbacks of delivery systems
|
Gene deliv. system |
Advantages |
Drawbacks |
|
Murine retroviral vectors |
Very safe; may achieve high
efficiency of transduction; infects only dividing cells; integrates into host
DNA. |
Loss in expression soon after
infection; low efficiency in vivo; up to 8 kb of DNA; high titers required
for in vivo gene delivery; immunogenicity. |
|
Recombinant adenoviruses |
Infect nondividing cells; rarity
of recombination events between adenoviral vectors and the host chromosomes;
high efficiency of transduction; adenovirus vectors efficiently escape from
the endosome and enter the nucleus; episomaly-replicating virus. |
Induction of immune responses
that eliminates therapeutic cells; may induce unwanted infections to humans;
only up to 7.5 kb of exogenous DNA can be inserted; loss of adenoviral
episomes in progeny cells. |
|
AAV |
Does not stimulate inflammation
or immune reaction; enters nondividing cells and does not replicate;
nonpathogenic virus. |
Low efficiency of gene transfer;
only up to 4.1 and 4.9 kb can be incorporated; wt AAV integrates on
chromosome 19 but recombinant AAV integrates at different sites (e.g.
chromosome 2); integration may cause inactivation of the transgene by
chromatin effects. |
|
HSV-1 |
Can take up to 30 kb of
exogenous DNA; high titer viral stocks; wide range; can infect nonreplicating
cells |
Infection with HSV-1 is
cytotoxic. |
|
Baculovirus |
Specificity for hepatocytes;
high efficiency of infection |
Not applicable in vivo at
present. |
|
EBV |
Episomaly-replicating virus |
wt EBV infects human cells
causing mononucleosis. |
|
HIV-1 |
Transduces non-dividing cells;
broad range of tissues and cell types; no inflammation; sustains expression
of GFP for 8-22 weeks in muscle and liver after injection to animals |
Start up technology, not broadly
tested. |
|
Hybrid HSV/EBV |
High efficiency of infection
(95-99% after intratumoral liver injection) |
Not broadly tested. |
|
Cationic lipids |
High efficiency of transfection
via membrane destabilization (cell membrane and endosomal); destabilize
lysosomal membranes and promote release of plasmid in the cytoplasm. |
Toxic, not suited for i.v.
injection; can interact with negatively charged serum proteins in vivo
causing transgene inactivation; gene expression is transient; i.v. injection
targets mainly the lung |
|
Stealth liposomes |
Non toxic, escape immune
surveillance and concentrate into solid tumors by extravasation. |
Not taken up by tumor cells but
remain in the extracellular space. |
|
Naked plasmid DNA |
Suited for intramuscular
injection and DNA vaccination; easy to use; no viral antigens. |
Low transfection; not widely
applicable method; naked plasmid is cleared from blood rapidly. |
|
Gene gun |
Easy to use (plasmid-coated gold
particles are delivered to tumor cells using helium pressure); rapid, suited
for gene transfer to tumor specimens from patients for immunotherapy. |
Not broadly tested. |
XI. Promoters and enhancers for transgene expression
A. Viral promoters
After escaping serum components and immune cells,
crossing the cell membrane, released from endosomes to the cytoplasm and
transported through the nuclear pores to the nucleus the transgene has to
accomplish two additional tasks: (i) to be efficiently transcribed and (ii) its
expression to last for long periods. These two very important factors depend on
the DNA regulatory elements that drive the expression of the therapeutic gene.
The use of mammalian gene expression vectors has revolutionized the field of
direct gene delivery. The proper choice of promoter and enhancer elements
linked to the gene of interest is decisive for the successful expression of the
gene in the desired tissue or cell type in gene therapy.
The majority of mammalian expression vectors make use
of promoter/enhancer elements from pathogenic viruses including the immediately
early promoter of the human cytomegalovirus (CMV), the Rous sarcoma virus (RSV)
promoter, the enhancer/origin of replication of SV40, the adenovirus type 2
major late promoter (Ad-MLP), as well as promoters from the mouse mammary tumor
virus (MMTV), human immunodeficiency virus (HIV), herpes simplex virus (HSV),
Epstein-Barr virus (EBV), and others.
Many studies have compared the strength of different
promoters in driving a therapeutic gene both in cell culture and in vivo. I
will mention a few sample studies here. Recombinant adenoviruses carrying the
HSV-tk gene under control of the human cytomegalovirus (CMV) immediate early
gene promoter or the adenovirus type 2 major late promoter (Ad-MLP) were compared
for their killing efficiency in combination with GCV treatment; the rat 9L
model for brain tumor and leptomeningeal metastases was used; the adenovirus
containing the CMV promoter showed greater cell killing efficiency compared to
the Ad-MLP promoter; animals with brain tumors showed significantly longer
survival time and animals with leptomeningeal metastases had symptom-free
periods (Vincent et al, 1997).
Doll et al (1996) have compared the efficiency of
expression of the b-galactosidase gene flanked by the AAV ITRs in brain
tumors and primary brain cell cultures driven by four different promoters. The
human CMV immediate-early enhancer/promoter was always the strongest, generally
by at least one order of magnitude, compared with the SV40 early enhancer/promoter,
the JC polymovirus promoter, and the chicken b-actin
promoter coupled to the CMV enhancer. High level of expression was usually seen
within 24 h of transgene delivery by either transfection or infection, but
dropped dramatically within days; all four promoters showed the same decline in
sustaining gene expression of b-galactosidase with time
(Doll et al, 1996).
The type of regulatory elements on plasmid vectors,
including promoter, enhancer, intron, and polyadenylation signals, were
systematically evaluated by Yew et al (1997) by constructing a series of
plasmids. Figure 10 shows the effect
of different introns (panel A) and different poly(A) signals (panel B) on CAT
expression. A hybrid intron (HI) appeared to be the most effective. There was a
4-fold increase in CAT expression from the bovine growth hormone (BGH) poly(A)
signal vector compared to the SV40 poly(A) signal vector.
Figure 10. Effect of different introns (A) and polyadenylation signals (B) on CAT expression. ELM cells were
co-transfected with equimolar amounts of each plasmid using DMRIE:DOPE and CAT
protein levels in cell lysates were assayed 48 h after transfection; pCMVb was used
as an internal control. SVI is the SV40 19S/16S intron; HI, hybrid intron, SV40
pA, SV40 late polyadenylation signal; BGH, bovine growth hormone
polyadenylation signal; b-Glo,
rabbit b-globin polyadenylation
signal. The data are expressed as mean ±SD (n=3). From Yew NS, Wysokenski DM,
Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors
for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the
authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Figure 11. Comparison of CAT expression
from different promoters in vitro. ELM cells (solid bars) or CFT1 cells
(stippled bars), a human airway epithelial cell line derived from a CF patient,
were transfected as described in Figure 10. CAT ELISA assays were carried out
48 h after transfection (an average of 6 assays). CAT protein levels were
normalized to pCF1-CAT (in A) or pCMVHICAT (in B). A. Expression from plasmids containing the BGH poly(A) signal. SPC,
Surfactant protein C promoter; NOS, nitric oxide synthase promoter; UbB,
ubiquitin B promoter; MUC1, mucin 1 promoter; IL8, interleukin 1 promoter; CE,
CMV enhancer; pCAT control is a promoterless CAT plasmid. B. Expression from plasmids containing the SV40 poly(A) signal.
CC10, Clara cell 10 kDa protein promoter; E1a, adenovirus E1a promoter. The
data are expressed as mean ±SD (n=3-12). From Yew NS, Wysokenski DM, Wang KX,
Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors
for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the
authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Figure 11 compares the strength of different promoters from
CAT constructs containing the bovine growth hormone (BGH) poly(A) signal (panel
A) or the SV40 poly(A) signal (panel B) and the hybrid intron. The promoters
were chosen for lung targeting. CMV yielded the highest expression in vitro. To
determine whether or not incorporating two CMV enhancers could produce higher
levels of CAT expression than one, a second CMV enhancer (from -118 to -522
relative to the transcription start site) was inserted 186 bp upstream of the
CMV promoter and its associated enhancer; in the context of the SV40 poly(A) signal
the second CMV enhancer (CE in Figure 11) increased expression 3-fold; however,
when the BGH poly(A) signal was present, the second copy of CMV did not
increase CAT expression (Figure 12).
B. Transcription factor binding sites within the CMV
promoter
Because of its wide use and the more potent effect,
the CMV IE enhancer/promoter deserves some special attention. In order to
understand the potent effect of the CMV promoter in the expression of foreign
genes we need to understand the transcription factors (TFs) that activate this
regulatory region; TFs in the transfected cell will be responsible for binding
to the CMV promoter leading to the activation of the transgene. At present not
all TF regulatory circuits leading to activation of CMV have been deciphered. Figure 13 shows two CMV promoters
retrieved from Genbank which are being used in expression vectors.
The CMV IE promoter includes the 10-bp palindromic
sequence CCATATATGG (Figure
13) which resembles the core motif of serum response elements and proved to
bind specifically to the cellular nuclear protein serum response factor (SRF).
Reporter gene constructs containing four tandem copies of these elements
displayed up to 13-fold increased basal enhancer activity and 18-fold
tetradecanoyl phorbol acetate responsiveness in U937 cells (Chang et al, 1993).
Figure 12. Effect of a second CMV enhancer region on CAT
expression from the CMV promoter. Plasmids were transfected into ELM cells and
the cells were harvested 48 h after transfection. Expression was normalized to
pCMVHICAT (in B). A. CAT protein
levels in cell lysates. RE, RSV LTR enhancer. B. Levels of CAT RNA. Total RNA was isolated from the transfected
cells and a quantitative RNA protection assay was performed. The data are
expressed as mean ±SD (n=3-9). From Yew NS, Wysokenski DM, Wang KX, Ziegler RJ,
Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors for high-level expression in
lung epithelial cells. Hum Gene Ther
8, 575-584. Reproduced with kind permission of the authors (Nelson Yew, Genzyme
Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Two multicopy basal enhancer motifs within the simian
CMV IE enhancer, namely, 11 copies of the 16-bp cyclic AMP response element
(CRE) and 3 copies of novel 17-bp serum response factor (SRF) binding sites
referred to as the SNE (SRF/NF-kB-like element), as well as four classical NF-kB sites within the human CMV promoter, contributed to
TPA responsiveness; the SNE sites of the simian CMV promoter contain potential
overlapping core recognition binding motifs for SRF, Rel/ NF-kB, ETS, and YY1 class transcription factors but fail
to respond to either serum or tumor necrosis factor a; the TPA responsiveness of both human and simian CMV
elements proved to involve synergistic interactions between the core SRF
binding site (CCATATATGG) and the adjacent inverted ETS binding motifs
(TTCC),
which correlated directly with formation of a bound tripartite complex
containing both the cellular SRF and ELK-1 proteins. This protein complex was
more abundant in U-937, K-562, and HeLa cell extracts than in Raji, HF, BALB/c
3T3, or HL-60 cells. A 40-fold stimulation of chloramphenicol acetyltransferase
activity mediated by four tandem repeats of the SNE could be induced within 2 h
(and up to 250-fold within 6 h) after addition of TPA in DNA-transfected U-937
cells, indicating that the stimulation appeared likely to be a true protein
kinase C-mediated signal transduction event rather than a differentiation
response (Chan et al, 1996). These studies demonstrate that different cell
types are expected to sustain different levels of expression from CMV and that,
for cell culture transfections, PKC transduction pathways are likely to
stimulate transgene expression from CMV promoters. These findings have
important implications for promoter choice in gene therapy.
7TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTAttgacgtcaaTGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTG803
Figure 13A. The CMV promoter sequence from
plasmid pRL-CMV, 4079 bp (nucleotides 7-803, Promega) (LOCUS AF025843)
37TCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTAATGTTGGACATGAGCCAATATAAATGTACATATTATGATATGGATACAACGTATGCAATGGGCCAA695
Figure 13B. The CMV IE promoter (nucleotides
37-695, 658 bp) from the expression vector pCMVtkLUC+ (ACCESSION
AF027129). ttgacgtcaa is the binding
site of HB16; GGGACTTTCC is the binding site for HIVEN 86A (two sites); CCATATATGG is the SRF binding
site; TTCC
is the ETS core motif; three CATTGACG motifs in each sequence are in bold-face
(see Boulikas, 1994 for more references).
A closely related family of ubiquitous DNA binding
proteins, called MDBP, binds with high affinity to two 14 base pair (bp) sites
within the human cytomegalovirus immediate early gene 1 (CMV IE1) enhancer;
these MDBP sites did not require cytosine methylation for optimal binding;
mutation of one of the enhancer MDBP sites to prevent MDBP recognition modestly
increased the function of a neighboring CREB binding site in a transient
transfection assay (Zhang et al, 1995). Furthermore, the CMV promoter competed
with the Egr1 promoter for transcription factors or co-factors which might be
required for activation by WT1; WT1 was converted from an activator to a
repressor by co-transfection of an excess of the parental CMV-based vector
(Reddy et al, 1995).
C. Tissue-specific promoters in gene therapy
A number of studies have used tissue-specific
promoters and enhancers from mammalian genes in order to attain a cell
type-specific expression of the transgene. The discovery of genes which are
expressed at high levels in specific tumor cell types has prompted the idea of
the use of their promoter or enhancer DNA sequences to express in this
particular cancer cell type therapeutically important genes (Venkatesh et al,
1990; Brady et al, 1994; Dimaio et al, 1994; Osaki et al, 1994; Pang et al,
1995).
Examples include the expression of the suicidal CD gene under control of the regulatory
regions of the tumor marker gene carcinoembryonic antigen (Richards et al,
1995), the expression of HSV-tk gene,
under control of a-fetoprotein enhancer and albumin promoter, into adult liver cells in
transgenic animals (Su et al, 1996), the expression of b-galactosidase in tyrosine hydroxylase-expressing
neurons in the substantia nigra midbrain of adult rats using the tyrosine
hydroxylase promoter (Song et al, 1997), and the expression of the lacZ marker
gene under control of the murine pancreatic amylase promoter in the pancreas in
neonatal and adult mice (Dematteo et al, 1997). Transduction of the human LDL-R
cDNA under the transcriptional control of the liver-type pyruvate kinase
promoter allowed high and tissue specific expression of the gene in primary
hepatocytes (Pages et al, 1996b).
Fibroblasts, infected with recombinant retroviruses
and selected with G418 for the expression of the vector carrying the
therapeutic gene, have been used for the ex vivo treatment in animal models;
when the therapeutic gene was either under control of the viral LTR or an
heterologous internal promoter, expression of the transgene from the integrated
retrovirus was shut off (Scharfmann et al, 1991). The use of the dihydrofolate
reductase housekeeping gene promoter which is expressed in all cell types, led
to sustained expression, albeit at very low levels (Scharfmann et al, 1991); it
appears that the combination of a suitable enhancer and promoter for a
particular cell type and the method of introduction of the transgene is crucial
for sustained expression.
Combination of the mouse muscle creatine kinase
enhancer with the human cytomegalovirus promoter to drive the expression of the
canine factor IX gene in ex vivo infected mouse primary myoblasts
led to the expression of factor IX and its secretion in the blood of mice
transplanted with these myoblasts for over 6 months; however, the levels of
factor IX protein secreted into the plasma (10 ng/ml for 107
injected cells) were not sufficient to be of therapeutic value (Dai et al,
1992).
Joki and coworkers (1995) have used the promoter of
the early growth response gene 1 (EGR-1, also known as Zif/268, TIS-8, NFGI-A,
or Krox-24) to confer selective expression of the luciferase gene in glioma
cell lines exposed to ionizing radiation; a 10-fold higher activity in
luciferase activity was found after irradiation of the cells which was
detectable at 1-3 h after stimulation with 20 Gy (stereotactic radiosurgery
during treatment of isolated brain metastases, arteriovenous malformations,
meningiomas, craniopharyngiomas, and glioblastomas uses a single dose of 20-30
Gy). Transfection of the HSV-tk gene
under control of the EGF-1 promoter
rendered irradiated, but not nonirradiated, cells sensitive to GCV. Irradiation
induces DNA repair, cell cycle arrest, and reinitiation of DNA synthesis in
surviving cells; g-radiation also induces higher levels of a number of
proteins including p53, AP-1, NF-kB, TNF, IL-1, and EGF-1.
Therefore, use of the EGF-1 promoter
can activate gene expression selectively in radiation fields and could be used
to drive the expression of cytotoxic genes (HSV-tk) for the killing of cancer
cells.
Peptides containing the three zinc fingers of Zif268
could efficiently repress activated transcription from promoter constructs
prepared with Zif268 binding sites inserted at various positions with respect
to the TATA box (Kim and Pabo, 1997); such strategies could find important
applications in gene therapy leading to construction of artificial promoters
able to activate or repress transcription of transferred genes. A potent hybrid
CAG promoter was used to drive the HSV-tk gene and showed effective eradication
of pancreatic tumors in animal xenografts (Aoki et al, 1997).
D. Molecular switch systems
The ability to regulate gene expression via exogenous
stimuli will facilitate the study of gene functions in mammalian cells.
Molecular switch systems have been devised (Wang et al, 1994) allowing the
researcher to turn on or off individual genes; the switch used by Delort and
Capecchi (1996) is composed of three elements: (i) the inducible UAS promoter, a synthetic promoter containing
five GAL4 response elements, normally absent from mammalian genomes; (ii) the synthetic hybrid steroid
receptor (TAXI), composed of the GAL4 DNA -binding domain, a truncated human
progesterone receptor, and the acidic region from VP16 protein of HSV; the
hybrid molecule activates transcription from the UAS promoter when bound to an
inducer drug, and (iii) the
synthetic nontoxic drug inducer RU486 which is permeable to blood-brain and
placental barriers; this model allows up to 100-fold induction of a gene linked
to this system and can be finely tuned to lower levels of induction (Delort and
Capecchi, 1996).
Transient cotransfection of HeLa cells with the
UAS-CAT and the hybrid receptor expression vector showed that the hybrid TAXI
protein bound to the UAS promoter only after treatment with RU486 but not
progesterone; the TAXI/UAS system was successfully used in transgenic mice to
regulate the expression of a human growth hormone gene; the ex vivo approach,
however, did not sustain long-term expression of the transgene. This system might
allow physicians to alter the level of expression of foreign genes during
somatic cell transfer in response to the clinical state of the patient (Delort
and Capecchi, 1996).
Iida et al (1996) have modified the
tetracycline-controlled inducible system by the addition of the ligand-binding
domain of the estrogen receptor to the carboxy terminus of the tTA
transactivator; a single retroviral vector could transduce both the transactivator
gene and the gene of interest controlled by the tTA-inducible promoter into
mammalian cells; cell lines expressing the transactivator were established
where the expression of a gene (the toxic G protein of vesicular stomatitis
virus) depended on the removal of tetracycline and the addition of estrogen.
A different genetic switch used consisted of the
cytochrome P450 1A1 promoter driving the expression of the human apolipoprotein
E (apoE) gene in transgenic mice; this switch system was induced by b-naphthoflavone; the inducer could pass
transplacentally and via breast milk from an injected mother to her suckling
neonatal pups, giving rise to the induction of human apoE in neonate plasma and
lowering the cholesterol levels in hypercholesterolemic pups (Smith et al,
1995).
XII. DNA recombination in gene therapy
A. Mechanisms of DNA recombination
Genetic recombination, i.e., exchange of segments of
DNA between two molecules of DNA, is a very frequent event. It often occurs during meiosis and also between homologous
chromosomes in mitosis. Homologous
recombination involving double-strand DNA breaks (DSBs), has similarities to
mechanisms of repair of DSB lesions by cells. Specific recombinases have played
and continue to play an important role in molecular evolution and genome
shuffling; deregulation in recombination procecess is connected to chromosomal
aberrations (inversions, translocations) in cancer. The double-strand-break
repair model was put forward by Szostak and collaborators (1983) to explain
genetic recombination in yeast. Recent studies (reviewed by Stahl, 1996) have
isolated the recombination intermediate molecules predicted by the DSB repair
model; in this model, a 5Õ-3Õ exonuclease is responsible for the removal of
segments of single strands starting bidirectionally from the DSB followed by
invasion, repair synthesis and ligation to give the joint molecule which is
then reduced to a pair of duplexes by a Holliday junction resolvase.
The development of mature lymphocytes in mammals
results from a complex combination of genetically preprogrammed events and
interactions with antigens. Shared
in its general mechanisms by both B (bone marrow) and T (thymus) lymphocytes
this developmental program involves a series of cell migration gene
rearrangements, cell-to-cell contacts, as well as positive and negative
selection processes; recombination mechanisms take place at the immunoglobulin
and the T cell receptor genes to generate a large number of immunoglobulin
genes in different lymphocyte clones. One site-specific recombination event
brings together the V and the J segments of the light chain immunoglobulin
genes. In the case of the heavy
chain genes, one recombination event joins a V to a D segment, sequentially
followed in a time frame by the joining of the recombined V-D segment to a J
segment. Recent studies have shown that the mechanism of V(D)J recombination is
a two-step process involving: (i) site-specific
DNA cleavage at the 7mer sequence and at the first nucleotide of the coding
sequence, implicating the RAG-1 and RAG-2 proteins which are necessary and
sufficient for this step (van Gent et al, 1996); (ii) joining of broken ends in a mechanism similar to the repair
of double strand breaks. The murine SCID locus has provided crucial information
in the elucidation of the second step in V(D)J recombination: thymocytes in
SCID mice are able to catalyze joining of signal ends but display an
accumulation of hairpin coding ends (Zhu et al, 1996). The murine SCID locus
has been mapped to the gene encoding the catalytic subunit of DNA-dependent
protein kinase (DNA-PK) (Kirchgessner et al, 1995).
Group I introns from a variety of organisms contain
long open reading frames (ORFs) that encode site-specific DNA endonucleases
which promote integration of their DNA into cognate sites via homologous
recombination. These endonucleases typically cleave intron-lacking DNA near the
site of intron insertion (exon-exon junction) creating a staggered DSB which
facilitates intron invasion (intron homing). This mechanism has been
demonstrated in mitochondria, chloroplasts and nuclei of eukaryotic cells.
I-CreI is a member of this class of molecules that promotes homing of the
chloroplast 23S rRNA intron in Chlamydomonas
reinhardtii ; I-CreI contains once the LAGLI-DADG motif (whereas other
members of the family contain two copies of this motif separated by 90-120
amino acids); this motif is important for the endonuclease activity of the
molecule. DNA cleavage by I-CreI requires Mg2+ or Mn2+ and is inhibited by monovalent
cations, has an optimum for catalytic activity of 50-55oC, is
stabilized by DNA and binds to 12 nt on each target strand (Wang et al, 1997).
B. Aberrant recombinations can result in human
disease
Mammals carry about 1,000,000 copies of Alu sequences
and 10,000 to 100,000 copies of complete and truncated versions of the L1 class
of LINEs. Such sequences promote homologous recombination causing
translocations of genes and have been hold responsible for a number of human
disorders. Alu sequences are found in introns. One type of mutation in the LDL
receptor gene responsible for familial hypercholesterolemia has incurred by
Alu-Alu recombination deleting several exons and thus producing a truncated
receptor molecule with loss of function (Lehrman et al, 1987). De novo insertions of an L1 element into
the factor VIII gene can cause hemophilia A in humans (Kazazian et al, 1988).
Foreign DNA transferred to host cells may be rejected
(degraded), integrated at random sites by illegitimate recombination,
integrated at homologous sites by legitimate recombination, or remain
extrachromosomal and replicate autonomously. The homologous recombination between chromosomal DNA and
transfected DNA sequences, an event termed "gene targeting," can be
used to correct mutated genes in cultured cells.
It has been known for a long time that the
translocation of an active gene to the neighborhood of heterochromatin
(transcriptionally inert part of the genome) results in silencing of the
translocated gene, a process known as "position effect variegation",
first described in Drosophila (Lewis, 1950; Wilson et al, 1990).
Chromosomal translocations seem to contribute to
tumorigenesis either by activating proto-oncogenes to oncogenes or by
inactivating tumor suppressor genes. Mammalian chromosomes contain a number of
break-susceptible or fragile sites where breakage can be induced reproducibly
by experimental manipulations. Such fragile sites might lie in the neighborhood
of transposable elements, hypervariable minisatellites or other DNA structural
peculiarities such as Z-DNA, and other hotspots of recombination (reviewed by
Haluska et al., 1987).
Nonrandom chromosome rearrangements, observed in a
variety of human and animal tumors are associated with the enhanced expression
or deregulation of cellular oncogenes. For
example, the human c-myc oncogene
becomes active following its translocation close to the enhancer sequence
within the immunoglobulin heavy chain gene locus (Hayday et al., 1984). The
chromosomal translocation (17;19) in acute lymphoblastic leukemia produces a
chimeric transcription factor consisting of the amino-terminal portion of the
helix-loop-helix proteins E12/E47 fused to the DNA binding and leucine zipper
dimerization motifs of the liver-specific protein factor Hlf (Hepatic leukemia
factor), normally not expressed in lymphoid cells (Hunger et al., 1992). In
pre-B cell acute lymphoblastic leukemia (ALL) the t(1;19) translocation brings
together two gene fragments encoding for transcription factors and results in
the synthesis of a chimeric transcription factor composed of truncated E2A and
Pbx1 (Kamps et al., 1991).
C. Exploitation of recombinases in gene therapy: the
Cre/LoxP system
A strategy has recently been developed which
facilitates culturing of human cells derived from primary tumors. This method
is based on the transient expression of T antigen of SV40 which has been shown
to immortalize primary cells of human and murine origin and on the use of
bacteriophage recombinase Cre which catalyzes sequence-specific recombination
at the LoxP sequence inducing permanent deletion of T antigen cDNA; indeed, if
two LoxP sequences were provided as direct repeats the intervening sequence
could be deleted during Cre recombination and lost from cells. This is an
advantage for primary cell cultures because the continuous expression of SV40
large T antigen may alter the antigenicity of the cells and induce other type
of mutations not associated with the original tumor; according to this strategy
large T antigen can be expressed in a time-dependent way (Li et al, 1997).
Figure 14 shows the structure of the two retroviral vectors
used by Li et al (1997) to facilitate culturing of primary tumor cells and Figure 15 the change in morphology as a
result of Cre-Puro retrovirus-induced loss of expression of T antigen in T
antigen-immortalized primary cell cultures of mouse breast cancer cells.
Figure 14. Structure of retroviral vectors
LoxP-HyTK-large T and Cre-puro allowing expression of T antigen and
Cre/LoxP-catalyzed deletion of T antigen cDNA. The 4 small arrows indicate the
primers used for PCR analysis; the large arrow above the NLS-CRE box indicates
the Cre recombinase mediating LoxP specific deletion. LTR are the long terminal
repeats of Moloney Murine Leukemia virus; LOX is the 34 bp sequence identical
to the recognition site of Cre recombinase; HyTK is the hygromycin/thymidine
kinase fusion gene; NLS-CRE is the Cre recombinase gene targeted to the nucleus
by a nuclear localization signal (NLS); SV40 is the SV40 promoter; Puro is a
puromycin selection marker. From Li LP, Schlag PM, Blankenstein T (1997) Transient expression of SV 40
large T antigen by Cre/LoxP-mediated site-specific deletion in primary human
tumor cells. Hum Gene Ther 8,
1695-1700. Reproduced with the kind permission of the authors and Mary Ann
Liebert, Inc.
Figure 15. Large T antigen-immortalized
breast cancer cells change morphology and lose expression of T antigen after
infection with Cre-Puro retrovirus: after prolonged culture the cells were
infected with Cre-Puro retrovirus (B, D)
or mock-infected (A, C), selected
for Puromycin resistance (A, B, C, D) and resistance to ganciclovir (B, D) and
analyzed by light microscopy (A, B) and staining with a large T-antibody (C,
D). From Li LP, Schlag PM, Blankenstein T (1997)
Transient expression of SV 40 large T antigen by Cre/LoxP-mediated
site-specific deletion in primary human tumor cells. Hum Gene Ther 8, 1695-1700. Reproduced with the kind permission of
the authors and Mary Ann Liebert, Inc.
Reversible immortalization of primary cells was
achieved by Westerman and Leboulch (1996) using retrovirus-mediated transfer of
an oncogene that could be subsequently excised by site-specific Cre/LoxP
recombination; the FLP/FRT recombination was not efficient in primary cells.
Pure populations of cells in which the oncogene was permanently excised were
obtained which reverted to their preimmortalized state. Using the Cre/LoxP
recombination strategy primary cells could be cultured and expanded; the method
was proposed to be applicable for facilitating gene transfer to cells
unresponsive to exogenous growth factors.
A retroviral vector, containing both a neomycin
resistance expression unit flanked by loxP sites and GM-CSF cDNA, was used to
transduce the human hematopoietic K-562 cell line. Superinfection of K562 cell
clones with a retrovirus containing a Cre recombinase expression unit and
molecular analyses of 30 doubly transduced subclones showed a strict
correlation between Cre expression and LoxP-flanked selectable cassette
excision; excision of the selectable cassette resulted in a significant
increase of GM-CSF transcription driven by the retroviral promoter (Fernex et
al, 1997).
Novel retroviral vectors for gene transfer were
developed by Bergemann et al (1995) by inserting two LoxP sites into a
retroviral vector also containing the HSV-tk gene; Cre expression in cells
infected with this vector was followed by BrdU selection for cells in which
site-specific recombination took place. Furthermore, replacement of the
enhancer/promoter elements in both LTRs by Lox sequences led to the development
of retroviral suicide vectors for gene therapy. Vanin et al (1997) have used
the Cre/LoxP recombinase system to generate high-titer retroviral producer cell
lines; incorporation of LoxP sites at the flanks of a NeoR-HSV-tk
cassette in the proviral DNA allowed excision of these selectable markers
through expression of Cre recombinase and the production of a high-titer
producer cell line containing a single LoxP site flanked by the viral LTRs.
Retransfection of this cell line with a plasmid containing a gene of interest
flanked by LoxP sites and the Cre expression vector allowed insertional
LoxP/LoxP recombination of the gene into the favorable preexisting site in the
genome and the generation of a new line with a titer equivalent to that of the
parental producer cell line. The Cre/LoxP recombinase strategy has been used to
generate retroviral vectors with the ability to excise themselves after
inserting a gene into the genome (Russ et al, 1996).
Bushman and Miller (1997) fused retroviral integrase
enzymes to sequence-specific DNA-binding domains and investigated target site
selection by the resulting proteins. A fusion protein composed of HIV integrase
linked to the DNA-binding domain of l repressor was able to
direct selective integration of retroviral cDNA in vitro into target DNA
containing l repressor binding sites. A fusion of HIV integrase
to the DNA binding domain of the zinc finger protein Zif268 also directed
increased integration near Zif268 recognition sites.
Introduction of foreign DNA into cell nuclei with
recombinase cDNA and appropriate sequences to promote recombination may promote
nor only insertion of a therapeutic gene into a specific chromosomal site but
also chromosomal rearrangements that could convert therapeutically transduced
cells into malignant. There is a great deal of knowledge to be derived from
these very promising strategies of gene therapy before they can be successfully
applied to humans.
XIII. Fate of the transgene in the nucleus
A. How to sustain transgene expression?
A major drawback in gene therapy applications is loss
in gene activity within a few days from gene transfer although all previous
steps were successful. In other words, the transferred gene is transiently
expressed for 1-4 days and its expression thereafter declines dramatically.
This is due (i) to the degradation
of the gene in the nucleus; (ii) the
dilution of the plasmid during replication of the cells from its inability to
replicate; (iii) its inactivation by
position effects from chromatin surroundings after its integration into the
chromosomal DNA; (iv) the
elimination of the therapeutic cells expressing the transgene by the immune
system of the organism either because of the antigenicity of the expressed
protein or because of the antigenicity of viral proteins, an effect often
associated with adenoviral and retroviral gene delivery.
A number of strategies are being pursued to solve
these problems. Sustaining the expression of a transgene into somatic cells
for, lets say, 6 months would mean than a gene therapy treatment would need to
be repeated twice a year, for example to a hemophilia patient or to a patient
who has undergone balloon treatment after coronary heart disease and is being
treated via arterial gene transfer.
An approach to sustain expression of the transgene is
via episomal replication of the plasmid carrying the transgene for long periods
of time, maintaining the plasmid in high copy numbers, and in a form
replicating in synchrony with the cell cycle; even better a plasmid can be
replicated continuously independently of the cell cycle, an approach to find
application in the transfection of nondividing cells by plasmids (which to date
is a virtue of adenoviruses, AAV, and HIV-1 vectors; see Table 1).
A way to sustain expression of the transgene could be
achieved via targeted integration into one or several different chromosomal
locations and the insulation of the transgene from neighboring chromatin
domains using special classes of DNA sequences able to act as insulators and
maintain independent realms of gene activity (such as matrix-attached regions,
MARs). In this case flanking of the foreign gene by two MAR sequences is
expected to insulate it against position effect variegation and prevent
inactivation of the gene at the chromatin level by chromatin condensation or
other mechanisms propagated from the neighboring domains at the integration
site (Boulikas, 1995b).
Several studies have shown that linearization of
plasmids with restriction enzymes favor highly their integration into the
host's genome compared with supercoiled, covalently-closed plasmid DNA. Free
ends of DNA are known to promote recombination and a number of nuclear proteins
including p53, poly(ADP-ribose) polymerase, ligases I and II, Ku antigen,
DNA-dependent protein kinase are known to bind to free ends of DNA, whereas
other molecules such as helicases and endonucleases are known to function
during repair of lesions in DNA inducing the appearance of strand breaks;
especially important in this aspect are members of the RAD50-57 family of
proteins involved in recombination and in repair of double-strand breaks.
B. Episomal plasmids for gene transfer
Integration or replication of a foreign gene
introduced as a plasmid into mammalian cells is a very rare event; plasmid DNA
resides transiently in the nucleus as an episomal, extrachromosomal element for
short periods of time after transfection of cells in culture (usually up to one
or very few days) during which transcription can take place; after that the
episomal DNA is degraded and lost permanently from the cells.
Viral origins of replication have been introduced
into the same plasmid as the reporter gene and found to increase the
persistence of expression. A polyoma virus-based plasmid containing the polyoma
virus origin of replication and the T antigen gene, as well as the neoR gene was
maintained extrachromosomally in mouse embryonic stem (ES) cells at 10-30
copies per cell for at least 74 cell generations in the presence of G418
(Gassmann et al, 1995).
Prolonged episomal persistence may be an advantage
for gene therapy of nondividing cells. A limited number of studies in gene
transfer have used plasmids able to replicate episomally. Most of the plasmids
used contain viral origins of replication but also the gene of the replication
initiator protein that after its expression in the host will interact with the
origin of the plasmid to maintain a relatively high copy number of plasmids
which will persist for some time. The advantage using episomal replication of
plasmids is enormous in somatic human gene therapy as it can sustain expression
of a transgene for a few months after a single injection of the plasmid as
compared to the loss of expression after about 1-10 days (maximum at day 2)
following injection of nonepisomal plasmids (Zhu et al, 1993). Thierry and
coworkers (1995) have succeeded in sustaining the expression of the luciferase
reporter gene in mice for up to 3 months after a single intravenous injection
of a plasmid including the human papovavirus BKV early region and origin of
replication, the large tumor antigen (T antigen) as the replication initiator
protein, and the late viral capsid proteins in the same construct harboring the
luciferase gene; this plasmid was shown to be replicated extrachromosomally for
2 weeks in the lung.
Episomal replication of a hybrid HSV-1/EBV vector was
achieved when the latent oriP of EBV and the EBNA-1 cDNA, which encodes for the replication initiator protein of
EBV, were included in the vector (Wang and Vos, 1996).
Expression of viral replication initiator proteins
(e.g. T antigen) is oncogenic. Of special interest in human gene therapy is to
determine human DNA sequences able to sustain the extrachromosomal replication
of plasmids into permissive human cells for longer periods. Such DNA sequences
known to act as origins of replication, although poorly understood, have been
found in human, monkey, and other mammalian genomes and could be used to
sustain the replication of the plasmid thus increasing its copy number in the
cell and the time of its persistence (see page 122-123).
To this end, a technology has been developed in our
laboratory that permits us to isolate human origins of replication (ORIs) and
to include selected ORIs together with the cDNA of the replication initiator
protein responsible for activating this particular ORI, in plasmids with
therapeutic genes (Boulikas et al, in preparation).
C. Considerations of chromatin structure of plasmids
during gene delivery
Almost all supercoiled plasmids used in gene
transfer, as produced in bacteria, are under negative supercoiling. Immediately
after their import into nuclei plasmids are packaged into nucleosomes that
absorb and constrain part or most likely all of the negative supercoils. This
is true assuming that no cuts on the DNA are introduced during its passage
through the cell membrane barrier to cytoplasmic lysosomes before entering
nuclei; if DNA is cut the supercoils on the plasmid will be relaxed. Nicked DNA
might be repaired and ligated in nuclei by DNA ligases and be subject to the
same constrains as chromosomal DNA. Use of linear plasmids is expected to
stimulate recombination during repair of double strand breaks (also would
increase degradation of the plasmid in the nucleus and loss of the transgene)
ultimately resulting in plasmid integration at variable chromosomal loci,
determined to some extend by the nature of the free ends of DNA and the short
terminal sequence of the DNA at the ends as well as the type of recombinase
molecules in the cell type used.
Treatment of cell cultures with sodium butyrate
inducing hyperacetylation of core histones would reverse in part the relieving
of the negative torsional strain by the wrapping of the plasmid around histone
octamers and will provide DNA in a negatively superhelical of underwound form
able to sustain transcription of the template (Schlake et al, 1994).
D. Overcoming the influences of chromosomal
surroundings at plasmid integration sites
Use of two MARs each flanking the reporter gene on
either side is expected to form a minidomain after integration of the foreign
gene into a chromosomal site. MARs potentiate the effect of promoters and
enhancers when two MAR elements are placed one upstream and the other
downstream from control elements but not between them. MARs will (i) shield reporter genes from the
influences of chromosomal surroundings that most often cause inactivation of
foreign genes. This effect of chromatin structure on neighboring sequences is
known as position effect variegation. Indeed about 85% of the chromosomal sites
are transcriptionally inactive assuming that 15% of the genomic DNA is
transcribed; however, even integration of a foreign gene into an active
chromatin locus may not warrantee its transcriptional activation as other
parameters, such as proximity of the integration site to the natural promoter
and enhancer elements of the active chromatin domain, or orientation of the
integrated gene with respect to the active gene in the chromosomal DNA may
determine its level of expression. (ii) MARs
will maintain a supercoiled DNA topology within the domain thus increasing the
negative supercoiling at local promoter and enhancer sites, a prerequisite for
efficient transcription (see Boulikas, 1995b).
XIV. Transfer of reporter genes
A. Transfer of the b-galactosidase (lacZ) reporter gene
Before a gene therapy preclinical study or even gene
transfer to cells in culture begins it is essential to test the variables and
pinpoint the conditions leading to the success of the operation using reporter
gene transfer. LacZ, encoding the b-galactosidase (b-Gal) from E. coli is one of the most commonly used
reporter genes. A staining procedure for this enzymatic activity can result in
the generation of blue color using X-Gal as a substrate leading to the direct
visualization of its activity, for example, in thin sections through animal
tissues.
Transfer of the reporter b-galactosidase gene to human liver tumors in nude
mice was performed by Wang and Vos (1996) using a hybrid HSV-1/EBV vector which
replicates episomally when the latent oriP of EBV and the EBNA-1 cDNA were included.
Many mammalian tissues, especially intestine, kidney,
epididymis,
and lung contain endogenous b-Gal, a lysosomal enzyme participating biochemically
in glycolipid digestion. Weiss et al (1997) were able to detect mammalian b-Gal activity on histochemical preparations of mouse,
rat and baboon lung tissue (Figure 16)
and also to distinguish between the endogenous and bacterial b-Gal activity in airway epithelial cells in the
transgenic Rosa-26 mouse in based upon the differences in pH optima between the
mammalian and bacterial enzymes (Figure
17). Time and temperature of exposure to X-Gal could not be used to
distinguish between endogenous and exogenous b-Gal
activity; thus, exposure of tissue preparation to pH 8.0-8.5, which minimized
detection of the endogenous activity allowed unambiguous discrimination and was
the method of choice to detect reporter b-Gal activity.
Figure 16. Endogenous mammalian b-Gal activity
was detected in minced lung preparations from a variety of species following
incubation with X-Gal in PBS. Representative fields from paraffin-embedded
sections are shown. Original magnification 400X. Airway epithelium, alveolar
macrophages and several unidentified cell types are stained blue and are,
therefore, positive for b-Gal
activity. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection of b-galactosidase
activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene
expression and endogenous b-galactosidase
activity. Hum Gene Ther 8,
1545-1554. With the kind permission of the authors (Daniel Weiss, Fred
Hutchinson Cancer Research Center) and Mary Ann Liebert, Inc.
Figure 17. Endogenous mammalian b-Gal
activity was not detected following incubation with X-Gal at pH>7.5 whereas
bacterial b-Gal activity was detected
at pH 8.0-8.5 in airway epithelial cells in the transgenic Rosa-26 mouse.
Original magnification 250X. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection
of b-galactosidase activity in lung:
assessment of X-Gal reagent in distinguishing lacZ gene expression and
endogenous b-galactosidase activity. Hum Gene Ther 8, 1545-1554. With the
kind permission of the authors (Daniel Weiss, Fred Hutchinson Cancer Research
Center) and Mary Ann Liebert, Inc.
Table 2. Reporter gene transfer in vivo
|
Gene delivered |
Human disease |
Vector |
Method/Goal |
Results |
Reference |
|
CAT and
luciferase |
none |
DOTMA:
DOPE |
Expression
of reporter genes in mouse tissues after a single intravenous injection. |
CMV
promoter was most effective; expression in vascular endothelia, extravascular
and parenchymal cells present in lung, spleen, and heart; lower expression in
all other tissues; persisted for 9 weeks. |
Zhu et
al, 1993 |
|
Luciferase/CMV
construct and lacZ |
none |
Transfectam
(DOGS:DOPE) |
To show
effectiveness in gene transfer after intracranial injection of
liposome-plasmid complexes into the newborn mouse. |
Transient
expression of luciferase in striatal parenchymal cells; lipospermine:DNA
charge ratio of 2 or smaller was most effective in vivo. |
Schwartz
et al, 1995 |
|
Luciferase/CMV |
none |
Cationic
liposomes |
Distribution
of luciferase gene expression among tissues and persistence of expression
after systemic injection. |
Use of
viral origins of replication and T antigen cDNA in vector sustained
expression up to 3 months primarily in the lung in mice. |
Thierry
et al, 1995 |
|
lacZ and
HSV-tk/IL-2 |
glioma |
AAV |
Direct
injection of tumors induced from human glioma cells into the brains of nude
mice. |
30-40% of
the cells along the needle track expressed b-galactosidase;
administration of GCV to the HSV-tk/IL-2 treated animals for 6 days, resulted
in a 35-fold reduction in the mean volume of tumors compared with controls. |
Okada et
al,. 1996 |
|
lacZ and
human erythropoietin |
none |
AAV |
Single
intramuscular injection into adult BALB/c mice. |
Protein
expression was detected in myofibers for at least 32 weeks; dose-dependent
secretion of erythropoietin and corresponding increases in red blood cell
production in mice persisted for up to 40 weeks. |
Kessler
et al, 1996 |
|
lacZ |
Retinal
degeneration; retinitis pigmentosa |
AAV |
Subretinal
injection of recombinant AAV particles encoding lacZ. |
Successful
transduction of all layers of the neuroretina as well as the retinal pigment
epithelium; the efficiency of transduction of photoreceptors was
significantly higher than that achieved with an equivalent adenoviral vector. |
Ali et
al, 1996 |
|
lacZ |
Inherited
hearing disorders |
AAV |
To assess
the feasibility of introducing genetic material directly into the peripheral
auditory system; infusion into the cochlea of guinea pigs. |
Thin
sections of cochleae showed intense immunohistochemical reactivity in the
spiral limbus, spiral ligament, spiral ganglion cells and the organ of Corti
but much weaker staining in the contralateral ear. |
Lalwani
et al, 1996 |
|
lacZ |
ParkinsonÕs
disease |
HSV-1 |
Stereotactic
injection into the midbrain of adult rats. |
A 6.8-kb
fragment of the rat tyrosine hydroxylase promoter supported a 7- to 20-fold
increase in reporter gene expression in catecholaminergic tyrosine
hydroxylase-expressing neurons in the substantia nigra. |
Song et
al, 1997 |
|
lacZ |
Leptomeningeal
cancer |
AAV |
To test
the feasibility of AAV-mediated gene therapy. |
Successful
transduction of medulloblastoma (DAOY) cells in a nude rat model of
leptomeningeal disease. |
Rosenfeld
et al, 1997 |
|
lacZ |
vascular
disorders |
AAV |
To
develop gene therapies for vascular disorders by gene transfer into isolated
segments of normal and balloon-injured rat carotid arteries. |
Comparable
gene transfer into medial and adventitial cells, with significantly higher
efficiency of transduction in injured compared with normal vessels. |
Rolling
et al, 1997 |
|
human
placental alkaline phosphatase (AP) |
lung
disease |
AAV |
To assess
the ability of AAV vectors to transduce airway cells; AP gene was delivered
to one lobe of the rabbit lung using a balloon catheter. |
AP
staining was almost exclusively in the epithelial and smooth muscle cells in
the bronchus at the region of balloon placement; staining was in ciliated
cells but was also in basal cells and airway smooth muscle cells. |
Halbert
et al, 1997 |
A phase I study involving six patients with
inoperable lung cancer and an endobronchial lesion accessible by bronchoscopy
was initiated to evaluate the feasibility, tolerance, and clinical effects
using adenoviral delivery of the Escherichia
coli lacZ marker gene driven by the RSV promoter; biopsy specimens of the
tumor and surrounding mucosa in 5 patients were tested positive for b-galactosidase expression (Tursz et al, 1996).
B. Transfer of the luciferase and green fluorescent
protein (GFP) reporter genes
A synthetic polyamino derivative was used by Goldman
and coworkers (1997) to transfer the luciferase and b-galactosidase reporter genes in animal models
bearing stereotactically implanted human glioma cell xenografts. The luciferase
reporter gene was transferred in both newborn and adult rabbit lungs using
polyethylenimine (Ferrari et al, 1997).
Thierry and coworkers (1995) have succeeded in
sustaining the expression of the luciferase reporter gene in mice for up to
three months using episomal vectors (Table
2).
GFP has been used as a reporter molecule for gene
expression because it fluoresces green after blue-light excitation. However,
many attempts by Hanazono et al (1997) to isolate stable retroviral producer
cell clones secreting vectors containing GFP (after transfer of the neoR gene
and selection in G418) have failed because stable GFP-clones were undergoing
major rearrangements or other mutations which abrogated GFP expression and
prevented vector production.
Additional studies using reporter gene transfer are
summarized on Table 2.
DIVISION TWO: GENE THERAPY OF CANCER
XV. Cancer immunotherapy and tumor vaccines
A. The molecular basis of cancer immunotherapy
Many human tumors are nonimmunogenic or weakly
immunogenic. The immune system, evolved to rid the body of unwanted intruders,
could be instructed and reinforced to eliminate cancer cells. Increasing the
immunogenicity of tumors by causing local cytokine production or by increase in
the expression in MHC antigen can lead to local antitumor effect (Tepper et al,
1989; Fearon et al, 1990). Indeed, immune surveillance is of the major defense
mechanisms against cancer; immunosuppressed individuals are more prone to
cancer and nude mice, lacking immune response, are exploited in the lab to
elicit tumors after injection of tumorigenic cells, a response that, in many
cases, cannot be elicited in normal mice.
Cells undergoing malignant transformation are
believed to be eliminated from the body by white blood cells including natural
killer cells (NK), lymphokine-activated killer cells (LAK), cytotoxic T
lymphocytes (CTL), tumor-infiltrating lymphocytes (TIL), and activated
macrophages; since established cancers in the human body may escape this
potential defense mechanism of immunologic surveillance, cancer patients have
been treated with IL-2 to stimulate their cellular immune mechanisms to kill
cancer cells; lengthy and complete remissions, however, were at a low rate and
complications were encountered by the toxicity caused by the systemic
administration of IL-2 (Rosenberg, 1992).
Transfection of the IL-2 gene into human melanoma cells increased cellular immune
response (Uchiyama et al, 1993). This and similar approaches have established
the foundation of the ex vivo cancer immunotherapy by transfer of autologous
(cancer patientÕs) cells after transduction in vitro with cytokine genes (see
below). The ultimate goal is the activation of tumour-specific T lymphocytes
capable of rejecting tumour cells from patients.
B. Cancer immunotherapy with tumor infiltrating
lymphocytes (TILs)
Ex vivo approaches in immunotherapy have been aimed at
isolating T cells directly from tumors (known as tumor infiltrating lymphocytes
or TILs), stimulate TILs to proliferate in cell culture with IL-2 followed by
their reintroduction into the blood stream of advanced cancer patients
(Rosenberg et al, 1988). The adoptive transfer of TILs was 50-100 times more
potent than that of lymphokine-activated killer (LAK) cells isolated from the
patient's tumors. Treatment of 20 patients with TILs after their expansion in
vitro, plus IL-2, resulted in objective regression of metastatic melanomas in
lungs, liver, bone, skin, and subcutaneous sites which lasted for several
months (Rosenberg et al, 1988).
TILs were also transfected in vitro with the
bacterial neomycin-resistance gene and were reintroduced into patients with
advanced cancer in order to follow their persistence in blood circulation with
PCR methods (Aebersold et al, 1990). Such Ògene markingÓ clinical protocols
using TILs are numbers 1, 3, 9. 13, 57, and 169 in Appendix 1, pages 159-172.
Having shown safety in the NeoR-modified TIL protocol, the gene for tumor
necrosis factor (TNF) was added to
the vector for therapy of malignant melanoma in advanced cancer patients; the
first patient began treatment in January 1991. TNF, however, is effective as an
anticancer agent in mice at 400 mg/kg body weight, but in humans, TNF is toxic
at 8 mg/Kg and so far of no proven therapeutic value at this low concentration
(reviewed by Anderson, 1992). In a similar approach, the TNF gene was replaced by the gene of interleukin-2 (IL-2) in order to develop locally high
doses of IL-2 at the tumor site by immunization with TIL cells from the patient
producing systemic antitumor immunity (Rosenberg et al, 1992).
TNF-a, (also IL-1b, IFN-g, and vitamin D3) after
binding to their transmembrane receptors stimulate the production of the second
messager ceramide from sphingomyelin in the plasma membrane by activating
sphingomyelinase; this results in a cascade of signal transduction events that
result in down regulation of c-myc and induction of apoptosis, to terminal
differentiation, or to RB-mediated cell cycle arrest (see apoptosis further
below).
IL-2 stimulates the differentiation of precursor
lymphocytes into LAK cells and further stimulates LAK cell proliferation; LAK
cells are probably produced by activation of NK cells or from activated T cells
by IL-2. Administration of IL-2 plus amplified LAK cells into mice models led
to marked regression of disseminated cancers and leukemia. LAK cells are able
to destroy tumor cells that express only weakly histocompatibility antigens.
IL-2, however, has several pleiotropic effects: stimulation of B cell
proliferation; activation of HLA class II antigen expression on endothelial
cells, TILs, and melanoma cells; and enhanced production and release of TNF-a, and IFN-g (see Cassileth et al,
1995 and the references cited therein).
However, the use of large numbers of adoptively
transferred, broadly cytotoxic LAK cells in combination with IL-2 has been
effective for only small subsets of cancer patients (reviewed by Wiltrout et
al, 1995).
TILs, which could potentially kill tumor cells, are
found in many tumors but remain suppressed or anergic; this anergy may arise
from the absence of lymphokines which provide signals for TIL cell activation
and stimulation to proliferation although ligands may be bound to the variable
region of the T cell receptor; indeed, nonimmunogenic tumors are rejected by
syngeneic mice upon transfection by IL-2
or IL-4 genes; IL-2 lymphokine
production by the tumor cells bypasses T helper function in the generation of
an antitumor response rendering the tumor cells immunogenic; nontransfected
tumors are not rejected by the animal and grow causing its death (Tepper et al,
1989; Fearon et al, 1990).
Ex vivo gene therapy trials using cytokine gene
transfer (see below) circumvent the problem of toxicity of IL-2 administration;
for non-gene transfer therapies, white blood cells drawn from patients are
fractionated, cultured, stimulated with IL-2 or other cytokines, and
reintroduced in much higher numbers into the blood of the patient.
C. Cancer immunotherapy with cytokine genes
The combination of immunotherapy with conventional
treatments such as radio- and chemotherapy may be necessary to eradicate
minimal residual disease. Advanced therapies involve the transfection of
lymphocytes in culture with cytokine genes followed by selection of the
successfully transfected cells with a selectable marker such as the bacterial
neomycin-resistance gene (Cassileth et al, 1995). Numerous phase I clinical
trials employing either syngeneic genetically modified or allogenic tumor
vaccines are in progress (see immunotherapy in Appendix 1, page 159-172). The development of tumor cells
transduced with cytokine genes and their exploitation as tumor vaccines in
patients with cancer is a very promising field (reviewed by Jaffee and Pardoll,
1997).
Cytokine genes used for cancer immunotherapy include
those of IL-2, IL-4, IL-7, IL-12, IFNs, GM-CSF, TNF-a in combination with genes encoding co-stimulatory
molecules, such as B7-I. The major goal of the use of immunostimulatory
cytokines is the activation of tumour-specific T lymphocytes capable of
rejecting tumour cells from patients with low tumour burden or to protect
patients from a recurrence of the disease. As distant metastasis is the major
cause for therapeutic failures in clinical oncology, treatment of patients
having a low tumor volume with immunotherapy could protect the patient from
recurrence of disease. Treatment of rodent tumor models with little or no
intrinsic immunogenicity with this approach resulted in regression of
preexisting tumors and cure of the animals from their disease; furthermore, in
some instances cured animals had retained immunological memory and resisted a
second challenge with the parental tumor cells (reviewed by Gilboa, 1996;
Mackensen et al, 1997).
The transduction of the tumor cells of the patient
with cytokine genes ex vivo and the development of tumor vaccines depends on
the establishment of primary cell culture from the solid tumor. Although
malignant melanomas are easy to culture, it is difficult to establish cell
lines from most other primary human tumors using convenient methods; primary
tumor cultures are being used (i) for
the transduction of autologous cells from the cancer patient with cytokine
genes to develop cancer vaccines after intradermal implantation to the patient; (ii) for characterization of
tumor-specific cytotoxic T lymphocytes in order to identify specific antigens
on the human primary culture; (iii) for
extensive phenotypic characterization of the tumor in cell culture. The
Cre/LoxP system (see recombinases in gene therapy) has been used to facilitate
the establishment of primary cell lines from human tumors (Li et al, 1997).
Human gene therapy protocols 3 and 10 (Appendix 1) use immunization of cancer
patients with autologous cancer cells transduced with the gene for tumor necrosis factor (TNF).
D. Cancer immunotherapy with the IL-2 gene
Active immunization with pancreatic tumor cells
genetically engineered to secrete IL-2 were shown to inhibit pancreatic tumor
growth in vivo; this was shown using a poorly immunogenic subcutaneous model of
murine ductal pancreatic cancer by implanting tumor Panc02 cells in C57BL/6
mice; whereas 90% of animals vaccinated with irradiated parental Panc02 and
subsequently challenged with parental Panc02 cells developed tumors by 48 days
only 40% of animals vaccinated with irradiated Panc02 cells engineered to
secrete IL-2 and challenged with parental Panc02 cells developed tumors by 48
days (Clary et al, 1997).
According to a RAC-approved clinical protocol the
gene for human interleukin-2 (IL-2) was transduced into a cell line established
from the neoplastic cells of a patient with malignant melanoma; this procedure
established an IL-2-secreting cell line with integration of the IL-2 gene into
genomic DNA. The IL-2-secreting cells were irradiated, in a manner sufficient
to inactivate 100% of the cells but insufficient to completely inhibit IL-2
synthesis, and administered to 12 patients with metastatic malignant melanoma in
a Phase I toxicity study. These cells have the capacity to induce an
antimelanoma response as shown in animal studies (Das Gupta et al, 1997).
A significant number of RAC-approved clinical
protocols use IL-2 cDNA transfer. These include protocols 11, 16, 19, 20, 46,
48, 50, 61, 71, 102, and 135, in Appendix
1 and protocols 190, 197, 198, 200, 204, 211, 213, 215, and 219 using
cationic lipids for gene transfer (Table
4 in Martin and Boulikas, 1998, this
volume, pages 203-206).
E. Cancer immunotherapy with the IL-3 gene
IL-3 was found to enhance the development of
cytotoxic T lymphocytes; during antitumor response, macrophages could ingest
whole tumor cells, cell fragments, or heat shock proteins complexed to
antigenic peptides and then process the tumor antigens for presentation; IL-3
stimulated antigen-presenting cells (APCs), which are macrophage-like, within
the tumor leading to generation of cytotoxic T lymphocytes (CTLs). This
constitutes a plausible pathway for enhancement in tumor rejection by IL-3 stimulation
(Pulaski et al, 1996).
IL-3 signaling proceeding either via the JAK-STAT or
the Ras-Raf pathways, stimulates a number of genes such as the DUB-1 encoding a deubiquitinating enzyme
the overexpression of which leads to G1 arrest (Zhu et al, 1996); deubiquitination
might be an additional mechanism to couple extracellular signaling to cell
growth. IL-3 signaling leads to stimulation in myeloid cell proliferation.
F. Cancer immunotherapy with the IL-7 gene
Primary cell cultures from 45 patients with malignant
melanoma were transfected via electroporation with the gene encoding for human
interleukin-7 (IL-7) resulting in the production of biologically active IL-7
without altering the expression of HLA class I and II, ICAM-1, and of a
melanoma-associated antigen. Irradiation of the transfected cells with 10,000
cGy, which arrested tumor cell growth in vitro, did not affect the ability of
the cells to secrete IL-7 in the culture medium; this approach, which does not
use retroviruses, could be applicable in vaccination protocols for melanoma
patients (Finke et al, 1997).
Transfer of the IL-7 cDNA for cancer immunotherapy is
being used in a human clinical trial (protocol 70, Appendix 1).
G. Cancer immunotherapy with the IL-12 gene
IL-12 gene therapy is one of the more novel and
promising approaches in cancer therapy. IL-12 is a heterodimeric cytokine
composed of two subunits, p40 and p35, that requires the simultaneous
expression of both the p35 and p40 chain genes from the same cell for
production of biologically active IL-12. Coordinate expression of the IL-12 p40
and p35 genes in several solid tumor models has been found to induce strong and
specific antitumor immune responses. A variety of biological functions have
been attributed to IL-12 including the induction of IFN-g and the promotion of predominantly Th1-type immune
responses to antigens (Tahara et al, 1996).
The local secretion of IL-12 achieved by gene
transduction suppressed tumor growth and promoted the acquisition of specific
antitumor immunity in mice. This was shown by intradermal inoculation of mice
with NIH3T3 cells transduced with expression plasmids or a retroviral vector
expressing the murine IL-12 gene admixed with murine melanoma BL-6 cells; CD4+
and CD8+ T cells, as well as NK cells, were responsible for the
observed antitumor effects resulting from IL-12 paracrine secretion.
Transduction of tumor cells with B7.1 gene enhanced the antitumor immune
response (Tahara et al, 1996).
The antitumor effect of several transgene expression
plasmids encoding the cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF was tested
using the gene gun-mediated DNA delivery into the epidermis overlying an
established intradermal murine tumor; this study showed that IL-12 gene therapy
was much more effective than treatment with any other tested cytokine gene for
induction of tumor regression as determined from the increased CD8+
T cell-mediated cytolytic activity in the draining lymph nodes of tumor-bearing
mice; treated animals were able to eradicate not only the treated but also the
untreated solid tumors at distant sites; elevated systemic levels of IFN-g, were found after IL-12 gene therapy. This approach
is providing a safer alternative to IL-12 protein therapy for clinical
treatment of cancers (Rakhmilevich et al, 1997).
Lieu et al (1997) have evaluated three IL-12
retroviral vector designs for their level of IL-12 expression in
leukemia/lymphoma cells; these retroviral vectors were based on the murine stem
cell virus (MSCV) which efficiently transduces functional genes into normal
hematopoietic cells. MSCVpac-mlL-12 and MIPV-mIL-12 contained an
encephalomyocarditis virus internal ribosome entry site for internal
translation of bicistronic mRNA transcripts, while MDCVpac-mIL-12 carried an
expression cassette in the U3 region of the 3' LTR. The MSCVpac-mIL-12 vector
was more efficient and directed robust expression of both p40 and p35 IL-12
genes in several murine tumor cell lines of hematopoietic origin, including a
T-cell lymphoma, a B-cell lymphoma, and a plasmacytoma/myeloma.
Adenoviral delivery of the IL-12 gene was effective
against breast tumors (Bramson et al, 1996) or metastatic colon carcinoma
(Caruso et al, 1996) in animal models: mice bearing breast tumors, injected
intratumorally with a single dose of an adenovirus expressing IL-12 showed
regressions in greater than 75% of the treated tumors; this effect was
accompanied with a maximum expression of IL-12 within the tumor between 24 and
72 hr post-injection which lasted for 9 days and an elevation in IFN-g within the tumor; local production of IL-12 also
stimulated IFN-g production in tumor-draining lymph node cells
(Bramson et al, 1996). Whereas intratumoral adenoviral transfer of the HSV-tk
and the murine IL-2 genes resulted in substantial hepatic tumor regression,
induced an effective systemic antitumoral immunity in the host and prolonged
the median survival time of the treated animals from 22 to 35 days a
recombinant adenovirus expressing the murine IL-12 gene was much more
effective: intratumoral administration of the IL-12 vector alone increased
significantly survival time of the animals; 25% of the treated animals lived
over 70 days (Caruso et al, 1996).
The immunological host response to syngeneic murine
mammary carcinoma cell line variants, genetically modified to express B7-1 or
secrete GM-CSF and IL-12, was examined by Aruga et al (1997). The mammary
adenocarcinoma MT-901 subline was weakly immunogenic by immunization/challenge
experiments and induced tumor-specific T-cell responses in lymph nodes draining
progressive subcutaneous tumors; however, tumor clones from this cell line
expressing B7-1 or secreting GM-CSF exhibited reduced tumorigenicity and
resulted in significantly enhanced T-cell reactivity to tumor-draining lymph
node (TDLN) cells as compared to wild-type TDLN cells. In contrast,
transduction with the IL-12 gene led to complete tumor growth inhibition.
An adenovirus vector, AdIL12-B7-1, encoding the two
IL-12 subunits in early region 1 (E1) and the B7-1 gene in E3 of adenovirus
under control of the murine CMV promoter was used to treat mice tumors derived
from a transgenic mouse mammary adenocarcinoma. A single intratumoral injection
with a low dose (2.5 x107 pfu/mouse) mediated complete regression in
70% of treated animals whereas a similar dose of recombinant virus encoding
IL-12 or B7-1 alone resulted in only a delay in tumor growth. Coinjection of
two different viruses expressing either IL-12 or B7-1 induced complete tumor
regression in only 30% of animals treated (Putzer et al, 1997).
Human peripheral blood lymphocytes (HuPBLs), injected
s.c. in mixture with human lung tumor cells into severe combined
immunodeficient (SCID) mice, engrafted and displayed antitumor cytotoxic
activity; this antitumor activity was dependent upon both CD8+ T cells and CD56+ natural killer cells in the donor
HuPBLs. IL-12 enhanced the human peripheral blood lymphocyte-mediated tumor
suppression; this implies that transfer of the IL-12 gene has a prospect in
this type of immunotherapy. This could be significant under the light of
studies showing that PBLs isolated from a lung cancer patient also suppressed
the growth of the patient's (autologous) tumor when coinjected s.c. with the
tumor cells into SCID mice (Iwanuma et al, 1997).
Tumor cell vaccines were transduced with IL-12 or
IL-2 genes and the antitumor response induced in mice bearing lung metastases
of the BALB/c colon carcinoma C51 were compared by Rodolfo et al (1996). The
cells used for transduction with the IL-12 or IL-2 genes were the
histologically related, and antigenically cross-reacting C26 tumor cells which
were irradiated and injected s.c. Vaccination with C26/IL12 cells cured 40% of
mice, while vaccination with C26/IL2 cells reduced the number of metastatic
nodules without affecting survival; both cell vaccination regimens showed
similar antitumor CTL activation in mice. Both treatments induced antibodies
directed against tumor-associated antigens, but only sera from mice treated
with C26/IL12 contained antibodies that lysed tumor cells. The better
therapeutic efficacy of vaccination with C26/IL12 was found to be associated,
among other factors, with an early infiltration of the metastatic lungs by
activated T lymphocytes (Rodolfo et al, 1996).
Transfer of the IL-12 cDNA for cancer immunotherapy
is being used in human clinical trials (protocols 62, 111, 180, and 183,
Appendix 1).
H. Adoptive immunotherapy with GM-CSF
1. Cell
culture experiments
The human hematopoietic growth factor,
granulocyte-macrophage colony-stimulating factor (GM-CSF), is important in the
management and gene therapy of a variety of malignant disorders of the human
hematopoietic system. Infection of COS-1 monkey kidney cells with a recombinant
AAV vector containing the GM-CSF gene resulted in the release of recombinant
GM-CSF protein into the supernatant; the released GM-CSF was able to sustain
the active proliferation of the GM-CSF-dependent human megakaryocytic leukemia
cell line, M07e, (Luo et al, 1995).
2. Animal
studies
The Dunning rat R3327-MatLyLu prostate tumor model
(an anaplastic androgen-dependent, nonimmunogenic tumor that metastasizes to
the lymph nodes and the lung) has been used for GM-CSF therapy; IL-2- or
GM-CSF-secreting human tumor cell preparations (tumor vaccines) were used for
the treatment of advanced human prostate cancer in rats. All animals with
subcutaneously established tumors were cured; the cancer vaccine induced
immunological memory that protected the animals from subsequent tumor
challenge; GM-CSF was less effective than IL-2 (Vieweg et al, 1994). Using the
Dunning rat prostate carcinoma model, animals with hormone refractory prostate
cancer treated with irradiated prostate cancer cells genetically engineered to
secrete human GM-CSF showed longer disease-free survival compared to untreated
control rats.
To further test the clinical feasibility of the
prostate cancer cell vaccine, cancer cells from patients with stage T2 prostate
cancer undergoing radical prostatectomy were successfully transduced with
MFG-GM-CSF, achieving a significant human GM-CSF secretion in each of 10
consecutive cases (Sanda et al, 1994).
Continuous secretion of GM-CSF and activation of
macrophages may contribute to the antitumor effects of a recombinant vaccinia
virus expressing the gene for murine GM-CSF injected to solid melanoma tumors
twice weekly for 3 weeks; this injection regimen resulted in growth inhibition
of the subcutaneous tumor and enhanced the survival of the animals (Ju et al,
1997).
A recent effort has been toward potentiation of
T-lymphocyte-mediated antitumor effects. T-lymphocyte response incapacitation
in the murine renal cancer model could arise from an impairment of critical
nuclear transcription factors. A vaccine-oriented gene therapy approach used T
cells and antigen-presenting dendritic cells which were recruited through the
use of antigen, chemokines and GM-CSF and further potentiated by fibroblasts
expressing IL-2, IL-4, IL-7, or IL-12; the goal of this approach was to
optimize MHC class I- and class II-dependent pathways for induction of
T-lymphocyte-mediated responses to cancer in animal models (Wiltrout et al,
1995).
Chen et al (1996) found that adenoviral delivery of a
combination of HSV-tk, mouse IL-2, and mouse GM-CSF is much more effective for
the treatment of metastatic colon carcinoma in the mouse liver than HSV-tk
alone or HSV-tk combined only with IL-2; a fraction of the animals developed
long-term antitumor immunity and survived for more than 4 months without tumor
recurrence in the three gene combination regimen; thus, local expression of
GM-CSF in the hepatic tumors and prolonged IL-2 expression were necessary to
generate persistent antitumor immunity.
A gene gun device was used to accelerate and
introduce gold particles coated with GM-CSF cDNA plasmids into mouse and human
tumor cells. Transfected and irradiated murine B16 melanoma cells produced
about 100 ng/ml murine GM-CSF/million cells per 24 hr in vitro for at least 10
days. Toward development of a tumor vaccine, irradiated B16 tumor cells
expressing murine GM-CSF cDNA were then injected into mice. Subsequent
challenge of these mice with nonirradiated, nontransfected B16 tumor cells
showed that 58% of the animals were protected from the tumor by the prior
vaccine treatment compared to only 2% of control animals inoculated with
irradiated B16 cells transfected with the luciferase gene (Mahvi et al, 1996).
Human tumor tissue transfected within 4 hr of surgery
produced significant levels of transgenic human GM-CSF protein in vitro. Human
GM-CSF was readily detectable in serum and at the injection site following
subcutaneous implantation of these transfected tumor cells into nude mice
(Mahvi et al, 1996).
The autocrine secretion of GM-CSF by transduced tumor
cells was found to serve as an effective immune adjuvant in the host response
to a weakly immunogenic murine mammary carcinoma tumor: transfer of activated
lymph node cells derived from mice inoculated with GM-CSF-secreting (240
ng/million cells/24 hours) murine mammary carcinoma cells resulted in the
prolonged survival of animals with macroscopic metastatic disease; this was not
evident utilizing lymph node cells from mice inoculated with wild-type tumor
(Aruga et al, 1997).
3. Clinical
trials
Autologous cells (sensitized T cells)
genetically-modified to secrete GM-CSF have been used for adoptive
immunotherapy on humans. GM-CSF has been used for the treatment of advanced
melanoma or renal cell cancers (Chang et al, 1996). The steps included
retrieval of tumor from the patient for use as a vaccine; the tumor cell line was
transduced with a retroviral/GM-CSF vector; cells were reintroduced into the
patient (tumor vaccination). Removal of draining lymph nodes after 7-10 days
and activation of lymph node cells with a monoclonal antibody directed against
CD3 and expansion of the cell population with IL-2 gave anti-CD3+/IL2-activated
cells which were exquisitely tumor-specific and mediated the regression of
established tumors in animal models (Figure
18).
According to a phase I clinical trial cancer patients
are intradermally vaccinated with lethally-irradiated tumor cells that have
been transfected by particle-mediated gene transfer with gold particles coated
with human GM-CSF plasmid DNA; this is based on preclinical studies showing
that vaccination of mice with irradiated, GM-CSF-transfected melanoma cells
provided protection from subsequent challenges with non-irradiated,
non-transfected tumor cells. Human tumor immunotherapy studies in course use
patients' fresh specimens of melanoma or renal carcinoma; cells are dissociated,
lethally-irradiated and transfected with GM-CSF plasmid DNA-coated gold
particles resulting in the subsequent production of biologically active GM-CSF
protein by the patientÕs cells. PatientÕs cells are used intradermally as a
vaccine to elicit anti-tumor immune responses. Surgical excision of the
vaccination sites will assess GM-CSF production and infiltration of immune
effector cells; patients are being subjected to an intradermal injection in
their opposite extremity of 5 million irradiated cryopreserved tumor cells
taken from the patient at the time of vaccine preparation to asses immune
reactions (DTH testing); if a positive reaction is noted on day 28 the DTH site
will be surgically removed (Mahvi et al, 1997).
Figure 18. A clinical protocol for adoptive
immunotherapy of advanced melanoma patients. Adapted from Chang et al (1996).
A number of RAC-approved human gene therapy protocols
use GM-CSF cDNA transfer. These are protocols 35, 53, 63, 113, 149, 150, 162,
and 181 in Appendix 1.
I. Cancer immunotherapy with the IFN-g gene
Solid tumors in nude mice have been successfully
eradicated with treatment with tumor cell lines stably transfected with an IFN
gene. A number of human tumor cell lines including 293, HeLa, K562, and Eskol (a
malignant immunoblastic lymphoma) were infected with a rAAV carrying a
synthetic type I interferon gene and the bacterial neomycin-resistant gene and
geneticin-resistant cells were selected; when injected into nude mice, 293,
K562, and Eskol cells failed to form tumors for a duration of up to 3 months;
on the contrary, mice receiving nontransduced cells developed tumors within 7
to 10 days; in addition, treatment of an established Eskol tumor with
transduced 293 cells resulted in tumor regression (Zhang et al, 1996).
Three RAC-approved human gene therapy protocols use
IFN-g cDNA transfer. These are protocols 36, 54, and
71
in Appendix 1.
J. Immunotherapy with synthetic tumor peptide
vaccines
Progress in the identification of tumor-specific
antigens, that is proteins expressed at high levels by a specific tumor cell
type such as prostate or breast cancer, most of which are surface glycoproteins
easily recognizable by the immune system, as well as the deciphering of the
mechanisms for enhancing the response of cytotoxic T cell lymphocytes have
advanced the potential for developing cancer vaccines.
Cancer immunotherapies based on synthetic tumor
peptide vaccines have been developed. Tumor-specific CD8+ cytotoxic T lymphocytes (CTLs) recognize
short peptide epitopes presented by MHC class I molecules that are expressed on
the surface of cancer cells. Bone marrow-derived dendritic cells, grown in
vitro in media containing combinations of GM-CSF + IL-4, when pulsed with
synthetic tumor peptides (which are loaded on the surface of the dendritic
cells) became potent antigen-presenting cells (APCs) capable of generating a
protective antitumor immune response. Injection of these cells into naive mice
protected the mice against a subsequent lethal tumor challenge; in addition,
treatment of mice bearing C3 sarcoma or 3LL lung carcinoma tumors with the same
type of cells resulted in sustained tumor regression in over 80% of the animals
(Mayordomo et al, 1995).
One of the obstacles of this method has been the
difficulty in obtaining sufficient numbers of APCs; dendritic APCs have been
isolated from CD34+ hematopoietic
progenitor cells drawn from cord blood and expanded in cell culture in the
presence of GM-CSF and TNF-a; TNF-a inhibits the
differentiation of dendritic cells into granulocytes. Human peripheral blood
mononuclear cells or mouse bone marrow cells depleted of lymphocytes could also
yield dendritic cells when cultured in the presence of GM-CSF + IL-4 (Mayordomo
et al, 1995).
K. DNA vaccines
Vaccines may be one of the first successful
applications of foreign genes into mammalian cells under control of
heterologous promoters and enhancers (Felgner and Rhodes, 1991; Thompson, 1992;
Gilboa and Smith, 1994). Vaccination with DNA has been shown to be a promising
approach for immunization against a variety of infectious diseases (Wang et al,
1993; Michel et al, 1995; Huygen et al, 1996; Kuhober et al, 1996). The method
consists in introducing the gene of a viral or bacterial antigen which is
uptaken and expressed by the hostÕs cells to elicit an antigen-specific immune
response. DNA coding for an antigen can be directly injected into muscle or
skin and stimulate an immune response against the expressed antigen; the gene
can either code for surface molecules, which are often used for conventional
peptide vaccines, or from internal microbial proteins.
During this approach the antigens are produced
intracellularly where they are correctly folded and can be presented to the
immune system to stimulate cytotoxic T cells; the method is safe and simple and
has shown promising results on animals (reviewed by Moelling, 1997). For
example, mice injected intramuscularly with an HIV-1 envelope DNA construct
developed anti-HIV envelope immune responses (Wang et al, 1993); intramuscular
injection of plasmid DNA expression vectors encoding the three envelope
proteins of the hepatitis B virus (HBV) induced humoral responses in C57BL/6
mice specific to several antigenic determinants of the viral envelope (Michel
et al, 1995). Immunization of mice with plasmid DNA constructs encoding one of
the secreted components of Mycobacterium
tuberculosis, antigen 85 gene induced substantial humoral and cell-mediated
immune responses (Huygen et al, 1996).
Because immunization of cancer patients with tumor
antigen proteins is a very promising approach used extensively in cancer
therapy (e.g. Karanikas et al, 1997) many of these approaches could be
transferred to the DNA level using the gene encoding the tumor antigen.
As an extension, this method could find application
using human tumor antigen genes rather than bacterial/viral antigen genes, that
is genes encoding for proteins expressed in tumor but not in normal cells
leading to development of tumor vaccines (Graham et al, 1996; Okamoto et al,
1997); this method mimics the infection of the cell in the host by a pathogenic
virus resulting in the intracellular processing of the viral proteins and their
presentation on the cell surface. Human tumor antigens are, however, weakly
immunogenic compared to microbial antigens a problem connected with
polymorphism in the major histocompatibility complex proteins of the host and
in antigen presentation.
Development of a fusigenic viral liposome vector was
made possible using the HVJ (hemagglutinating virus of Japan, a Sendai virus)
renowned for its cell fusion ability; plasmid DNA containing the human tumor
antigen genes MAGE-1 and MAGE-3 was mixed with HMG-1 nonhistone protein (to
increase nuclear import and expression of the plasmid after transfection) and
was encapsulated into anionic liposomes (phosphatidylserine,
phosphatidylcholine, cholesterol) followed by the addition of inactivated HVJ;
intramuscular injection into mice resulted in production of MAGE-1 and -3 IgG
antibodies (Okamoto et al, 1997).
XVI. Gene therapy of cancer and candidate genes
A. Mechanisms of carcinogenesis
Whereas for inborn errors of metabolism transfer of a
single gene can correct the disorder, cancer is a complex disease involving
mutations in a number of proto-oncogenes and tumor suppressor genes as well as
an imbalance and disarray in phosphorylation events and regulatory circuits of
the cell cycle. As a result of transformation, tumor cells acquire a
proliferation advantage compared with normal cells, most of which are quiescent
in the adult organism; cancer cells acquire partial independence from
regulatory signals from neighboring cells for restricted cell growth. A crucial
step in cancer development is the nonelimination of pre-cancer cells by
apoptosis (usually a subsequence of a mutation in the p53 gene); such cells
acquire a number of unrepaired damage in their DNA, such as strand breaks,
which induce chromosomal translocations and result in clonal expansion of this
cell population.
Tumor cells are able to survive after DNA damage, and
display an increase in mutation rate; cancer cell populations are heterogenous
with respect to translocations, loss of heterozygosity, point mutations and
transpositions in various genes. Whenever the mutated cell acquires an
advantage for rapid growth over other cells in the tumor mass, escaping cell
cycle checkpoints, it may replace the original population, a phenomenon known
as tumor progression; this may lead to appearance of a more malignant
phenotype. As a result, tumor cells are of different genotypes and clones
obtained from the same solid tumor may differ in the level of malignancy.
A number of candidate genes, when become mutated or
overexpressed, may lead to tumor phenotype: p53, RB, and p21 appear to be the
most important. The deregulation of other genes is connected to tumor
progression whereas different groups of genes are associated with tumor cell
metastasis. These facts make a single gene transfer approach to tumor cell mass
to inhibit its growth or change its phenotype from malignant to normal very
challenging.
B. Human clinical trials
The genes used for cancer gene therapy in human
clinical trials include a number of tumor suppressor genes (p53, RB, BRCA1,
E1A), antisense oncogenes (antisense c-fos,
c-myc, K-ras), suicide genes (HSV-tk, in combination with ganciclovir,
cytosine deaminase in combination with 5-fluorocytosine) which have been very
effective in eradicating solid tumors in animals. Also the cytokine genes
(IL-2, IL-7, IFN-g, GM-CSF) are being used for the ex vivo treatment of
cancer cells isolated from human patients and are able to elicit an immunologic
regression especially on immunoresponsive malignancies (melanomas, colorectal
carcinomas, renal cell carcinomas) (Culver, 1996). Future directions might be
toward use of genes involved in the control of tumor progression and
metastasis. Discovery of new genes which are over- or under-expressed during
transformation and metastasis is a promising approach for the identification of
novel gene targets in cancer gene therapy (Georgiev et al, 1998, this volume).
Diseases amenable to therapy with gene transfer in
clinical trials (Appendix 1 and Table 4 in Martin and Boulikas, this volume) include cancer (melanoma,
breast, lymphoma, head and neck, ovarian, colon, prostate, brain, chronic
myelogenous leukemia, non-small cell lung, lung adenocarcinoma, colorectal,
neuroblastoma, glioma, glioblastoma, astrocytoma, and others), AIDS, cystic
fibrosis, adenosine deaminase deficiency, cardiovascular diseases (restenosis,
familial hypercholesterolemia, peripheral artery disease), Gaucher disease,
Hunter syndrome, chronic granulomatous disease, PNP deficiency, a1-antitrypsin deficiency, leukocyte adherence
deficiency, partial ornithine transcarbamylase deficiency, Cubital Tunnel
syndrome, Canavan disease and rheumatoid arthritis. Several RAC-approved
protocols use gene marking rather than gene therapy . An important number of
protocols in cancer use ex vivo immunotherapy (Appendix 1, pages 159-172 & 203-206).
XVII. Gene therapy strategies based on p53
A. p53 as
a tumor suppressor protein
The p53 has been a
fascinating subject in cancer biology since its discovery (Lane and Crawford,
1979; Linzer and Levine, 1979). Originally assigned in the constellation of
oncogenes was later shown to exert suppressive effects on cell growth (Finlay
et al, 1989); indeed, the mutated p53 has many characteristics of an oncogene
(Will and Deppert, 1998, this volume). Mutations in the p53 gene contribute to
the emergence of the malignant phenotype (Diller et al., 1990; Baker et al.,
1990). Alterations in the p53 tumor suppressor gene appear to be involved,
directly or indirectly, in the majority of human malignancies (Vogelstein,
1990). For example, human lung cancer cell lines and specimens showed allelic
loss for chromosome regions 3p and 17p (p53 is assigned to 17p13); these
specimens displayed homozygous deletions of p53,
DNA rearrangements involving the p53
gene, or expression of truncated p53 transcripts suggesting abnormal splicing,
initiation, and termination arising from point or other mutations (Takahashi et
al, 1989; Nigro et al, 1989).
An interesting approach to
unravel the molecular mechanism of action of p53 in restricting cell growth and
in inducing apoptosis was the cloning of genes induced by p53 before the onset
of apoptosis; this led to the identification of a group of 14 genes (out of
7,202 transcripts examined) which were markedly increased in p53-expressing
cells compared with control cells many of which were predicted to encode
proteins that could generate oxidative stress or respond to oxidative stress
(Polyak et al, 1997). Additional studies in this line have suggested that the
induction of the apoptotic pathway by p53 involves (i) transcriptional induction of redox-related genes; (ii) formation of reactive oxygen
species; and (iii) the oxidative
degradation of mitochondrial components (Polyak et al, 1997).
p53 can inhibit
transformation of rat embryo fibroblasts mediated by adenovirus E1A plus activated ras and can also suppress focus formation mediated by myc plus activated ras (Finlay et al, 1989; Eliyahu et al, 1989). Both alleles of p53
need to be mutated or altered for transformation. Introduction of a null
mutation by homologous recombination in murine embryonic stem cells gave mice
which appeared normal but were susceptible to a variety of neoplasms by 6
months of age (Donehower et al, 1992).
The tumor suppressive
activity of p53 seems to involve at least six independent pathways: (i) induction by p53 of the p21/Waf-1/Cip-1 gene which causes growth
arrest both via inhibition of cyclin-dependent kinases and via inactivation of
PCNA; PCNA is the accessory molecule to DNA polymerases a and d and its absence causes
arrest of DNA synthesis at the replication fork; (ii) induction of the death-promoting bax gene by p53 as a mechanism which eliminates oncogenic
virus-infected and transformed cells;
(iii) by a direct interaction of p53 with origins or replication preventing
firing and initiation of DNA replication;
(iv) via binding of p53 to a number of important molecules involved in
transcription (TATA box-binding protein or TBP, TFIIH); (v) by the role of p53 in DNA repair via its patrolling the genome
for small insertion deletion mismatches or free ends of DNA; (vi) p53 is able to attract RPA, an
accessory to DNA polymerases a and d as well as TFIIH and
RAD51 at the damaged DNA sites; TFIIH, RAD51, and RPA have a demonstrated role
in DNA repair (Figure 19).
Additional properties of p53 include the induction of Gadd45 involved in the
arrest of the cell cycle and induction of Mdm2 which, after exceeding a
threshold value in the cell associates with p53 to restrict its regulatory
functions; thus, Mdm2 acts as a feedback loop for p53 to moderate its apoptotic
and cell cycle restrictive functions (Figure
20).
B. Genes
regulated by wild-type p53
Protein p53 appears to be a
transcription factor able to recognize specific regulatory regions in a number
of genes via its central DNA-binding domain; the DNA sequence-specific binding
of wt p53 is regulated by the C-terminal domain of p53 and is activated by a
variety of posttranslational modifications (Hupp et al, 1992). p53 is
phosphorylated and is constitutively expressed at low levels in most normal
tissues (Lane and Crawford, 1979; Linzer and Levine, 1979).
The sequence specificity of
p53 has been determined using random synthetic oligonucleotides followed by
selection by wtp53 and cloning; these studies revealed the 10 bp motif RRRCGYYY (where R is purine and Y pyrimidine) as the binding and recognition
site of wtp53 recognition (El-Deiry et al., 1992); two such 10 bp motifs are
required for p53 binding separated by up to 13 bp of random sequence. Since the 10 bp motif is a palindrome,
the binding site of p53 comprises 4 copies of the half binding sites GYYY oriented in opposite directions, which suggested
that p53 binds either as a dimer to two cruciforms or as a tetramer with each
subunit interacting with one half site. The
second possibility is favored since
Figure 19.
Regulatory circuits involving p53. From Boulikas T (1997) Gene therapy of prostate cancer: p53, suicidal genes, and
other targets. Anticancer Res 17,
1471-1506. With the kind permission of Anticancer Research.
Figure 20. A summary of the apoptotic and cell
cycle restrictive activities of p53. From Boulikas T (1997) Gene therapy of prostate cancer: p53, suicidal genes, and
other targets. Anticancer Res 17,
1471-1506. With the kind permission of Anticancer Research.
biophysical
studies indicate that p53 exists as a tetramer in solution (Stenger et al.,
1992).
Increased levels of p53 upregulate the expression of
specific genes including Cip-1/Waf-1/p21
(El-Deiry et al, 1993), GADD45
(Kastan et al, 1992), cyclin G (Okamoto and Beach, 1994), and mdm2 (Perry et al, 1993; Barak et al,
1993; Momand et al, 1992) which is induced by UV damage in a p53-dependent
pathway (Perry et al, 1993). Gadd45 inhibits cell cycle progression
(Papathanasiou et al, 1991).
Mdm2 acts as a feedback loop for the biological
functions of p53 apparently to moderate the G1/S arrest or apoptosis triggered
by p53 following severe damage to DNA. Mdm2 protein associates with p53 causing
p53 inactivation by preventing its sequence-specific binding to regulatory
targets in DNA (Momand et al, 1992; Oliner et al, 1992). Elevated levels of
Mdm2 mimic the effect of T antigen, E1B of adenovirus, E6 of HPV, which also
inactivate p53 in a similar manner; overexpression of Mdm2 can block the
induction of apoptosis by p53 (Chen et al, 1994).
Additional genes
up-regulated by p53 include human PCNA
(Shivakumar et al, 1995), mouse muscle creatine kinase MCK (Zambetti et al, 1992), EGFR
(Deb et al, 1994), the potent promoter of the death pathway Bax (Miyashita and Reed, 1995), and
thrombospondin-1 (Dameron et al, 1994). Other cellular regulatory regions that
interact with p53 include the RGC repeats in the ribosomal gene cluster (Farmer
et al, 1992; Kern et al, 1992).
The PCNA promoter is
up-regulated in the presence of moderate amounts of wt p53; however, at higher
levels of wt p53 the PCNA promoter is inhibited whereas tumor-derived p53
mutants activate the PCNA promoter (Shivakumar et al, 1995); it has been
suggested that the moderate elevation in wt p53 seen after DNA damage induces
PCNA to cope with its DNA repair activities (Shivakumar et al, 1995); this
inhibition in DNA replication but stimulation in repair by p53 might be
accomplished by an independent pathway involving induction of p21 (El-Deiry et
al, 1993) which interacts with PCNA protein auxiliary to DNA polymerase d to inhibit the replication but not the repair
functions of PCNA (Li et al, 1994).
The bax
gene which induces apoptosis (Figure 21)
is upregulated by p53 whereas the bcl-2
gene which inhibits apoptosis in B cells is down-regulated by p53 (Miyashita et
al, 1994a,b; Miyashita and Reed, 1995). Initiated cancer cells may lead to
tumor development only when a dysfunction in their apoptotic pathway takes
place; some of the mechanisms leading to inactivation of the apoptotic pathway
in cancer cells may result from an up-regulation in the bcl-2 gene (a Bcl-2 chimeric factor is produced in leukemias as a
result of a translocation) or down-regulation of the bax gene. Gene therapy for cancer could involve restoration of the
apoptotic pathway in cancer cells leading to their suicidal death (see below).
Figure 21.
Involvement of Bax and Bcl-2 proteins in apoptosis. Bax is a potent inducer of
apoptosis; binding of Bcl-2 to Bax (also binding of the E1B 19 kDa protein of
adenovirus to Bax) prevents Bax from its apoptotic functions. From Boulikas T (1997) Gene therapy of prostate cancer:
p53, suicidal genes, and other targets. Anticancer
Res 17, 1471-1506. With the kind permission of Anticancer Research.
Binding sites for p53 have
been found at the origin of replication of polyomavirus with an inhibitory
effect on virus replication in vitro (Miller et al, 1995) and at the SV40 ORI
(Bargonetti et al, 1991) as well as in putative cellular origins of replication
(Kern et al, 1991).
A number of genes not
containing p53 response elements may be repressed by p53 (Ginsberg et al, 1991;
Mercer et al, 1991; Shiio et al, 1992; Seto et al, 1992).
C. Binding
of p53 to viral oncoproteins
p53 was first detected in
rodent cells transformed with SV40 in a complex with T antigen (Lane and
Crawford, 1979; Linzer and Levine, 1987). Subsequent studies have shown that
p53 can be complexed with adenovirus E1B (Sarnow et al, 1982; van den Heuvel et
al., 1990) and the E6 oncoprotein of human papilloma virus (Werness et al.,
1990). SV40 T antigen was unable to act as an initiator of SV40 DNA replication
in vitro when complexed with wt murine p53 (Wang et al, 1989) thought to act by
blocking the interaction of T antigen with DNA polymerase a (Gannon and Lane, 1987; Braithwaite et al, 1987).
What appears to be
important in understanding the involvement of p53 in tumorigenesis is that p53
is unable to transactivate the p53-inducible reporter genes in cells that
express one of these viral oncoproteins (Yew and Berk, 1992). In addition, the growth suppressive
effect of p53 protein may be mediated by its association with cellular proteins
(Fields and Jang, 1990; Raycroft et al., 1990). Negative elements that could be
required for an efficient growth shutdown leading to the reversible G0 state or to irreversible out-of-cycle
conditions such as terminal differentiation, apoptosis, and senescence, may be
affected by p53 (Bargonetti et al., 1991).
D.
Transcription repression by interaction of p53 with TBP
Although p53 activates a
number of promoters that contain p53-responsive elements, it represses
transcription from many promoters that lack p53 binding sites; central to the
promoter repression by p53 was thought to be its interaction with the TATA-box
binding protein or TBP (Seto et al, 1992; Mack et al, 1993; Truant et al,
1993). This interaction may activate transcription when TBP interacts with a
preformed p53-DNA complex or may repress transcription when p53 interacts with
DNA-bound TBP (Deb et al, 1994). However, p53 acts as a repressor only in cells
undergoing apoptosis and p53-mediated transcriptional repression is released by
adenovirus E1B or cellular Bcl-2 (Shen and Shenk, 1994; Sabbatini et al, 1995).
Both wild-type and mutant
p53 interact with C/EBP on the human hsp70 promoter (Agoff, 1993), with TFIIH
(Xiao et al, 1994), holo-TFIID (Chen et al, 1993; Liu et al, 1993) and the
TAFII40 and TAFII60 subunits of TFIID (Thut et al, 1995).
E.
Inhibition of DNA replication by wild-type p53
Several lines of evidence
suggested inhibition in DNA replication by wild-type p53 but not by
tumor-derived mutant forms of p53. Indeed, SV40 T antigen was unable to act as
an initiator of SV40 DNA replication in
vitro when complexed with p53 (Wang et al, 1989); mutant p53 was unable to
cause inhibition in the initiating functions of T antigen in vitro (Friedman et al, 1990). Inhibition in DNA replication in vivo by p53 (Braithwaite et al, 1987)
suggested that p53 might interact with cellular DNA replication initiator
proteins or other components of the replication fork. p53 also interacts with
replication protein A (RPA) implicated in DNA replication and in repair;
interaction of p53 inhibits the replication functions of RPA (Dutta et al,
1993) although interaction of p53 with RPA via its acidic domains stimulates
BPV-1 DNA replication in vitro (Li and Botchan, 1993). Immunolocalization of
p53 (also of RB and host replication proteins) at foci of viral replication in
HSV-infected cells (Wilcock and Lane, 1991) provided further evidence for a
direct interaction of p53 with proteins (or DNA sequences) at the replication
fork.
According to a second
model, p53 can cause inhibition in DNA replication by a direct interaction with
origins of replication at the DNA sequence level rather than via its
interaction with replication initiator proteins. The potential role of p53 as a
down-regulator of DNA replication in a DNA-binding-dependent manner has been
suggested from replication assays of polyoma virus in vitro (Miller et al, 1995) and from the inhibition in nuclear
DNA replication by a form of p53, truncated at its C-terminus, which is
constitutively active for DNA binding in transcription incompetent extracts
from Xenopus eggs (Cox et al, 1995).
In the experiments of Miller and coworkers (1995) wild-type p53 suppressed DNA
replication in vitro when the p53 binding site (RGC)16 from the ribosomal gene cluster was
cloned on the late side of the polyomavirus (Py) core origin; when mutated
p53-binding sites were used, the inhibition in Py replication was not observed.
In addition, RPA (able to interact directly with p53) was unable to relieve the
p53-mediated repression in Py replication. Furthermore, tumor-derived mutants
of p53 that had lost their sequence-specific DNA-binding capacity were unable
to inhibit Py replication of the construct with the wild-type oligomerized RGC
sites in vitro.
F.
Differences in biological functions between wild-type p53 and tumor-derived p53
mutants
Tumor-derived mutant forms
of p53 have lost their DNA sequence-specific binding capacities. For example
the Trp-248 and His-273 mutants of p53 have poor DNA-binding abilities and are
unable to activate transcription from constructs containing p53 binding sites
(Farmer et al, 1992).
Wild-type (wt) p53 tumor suppressor protein
negatively regulates cell growth (Hollstein et al, 1991; Prives, 1994). Whereas
the wild-type p53 acts as a tumor suppressor, several of the mutant forms
display oncogenic activities (Levine, 1993; Prives and Manfredi, 1993; Deppert,
1994). Although the wt p53 has been postulated to repress growth by activating
genes that repress growth (p21), many
of the mutant forms have lost their DNA sequence-specific binding and transcriptional
activation capacities (reviewed by Zambetti and Levine, 1993).
According to one model (see
Vogelstein and Kinzler, 1992), wt p53 is a positive regulator for the
transcription of genes that by themselves are negative regulators of growth
control and/or invasion. Indeed, p53 upregulates the genes of p21/CIP1/WAF1
(ElDeiry et al, 1993) and GADD45 (Kastan et al, 1992) whose products interact
with PCNA to inhibit its association with DNA polymerase d thus causing arrest in DNA replication (Smith et al,
1994). This feature of p53 that is central to its ability to suppress
neoplastic growth is lost by mutations on p53 that result in loss of its
ability to bind to DNA or to interact with other transcription protein factors.
Mutant p53 can transactivate genes that up-regulate
cellular growth (Deb et al, 1992; Dittmer et al, 1993) such as PCNA (Shivakumar et al, 1995), EGFR (Deb et al, 1994), multiple drug
resistance (MDR1) (Chin et al, 1992;
Zastawny et al, 1993), and human HSP70
in vivo (Tsutsumi-Ishi et al, 1995). These studies support the idea for an
oncogene function of the mutant p53 protein compared with the tumor suppressor
function of wt p53; mutation in the p53 gene may, thus, cause gain of new
functions such as transforming activation and binding to a distinct class of
promoters which are not normally regulated by wt p53 (Zambetti and Levine,
1993; Tsutsumi-Ishi et al, 1995). At the same time appearance of mutations in
the p53 gene result in the loss of function of the wt p53 (Zambetti and Levine,
1993).
The wild-type but not mutant p53 at low levels
transactivates the human PCNA
promoter in a number of different cell lines; the wild-type p53-response
element from the PCNA promoter functions in either orientation when placed on a
heterologous synthetic promoter; thus moderate elevation of p53 can induce
PCNA, enhancing the nucleotide excision repair functions of PCNA (Shivakumar et
al, 1995). Whereas low levels of wild-type p53 activate the PCNA promoter,
higher concentrations of wt p53 inhibit the PCNA promoter, and tumor-derived
p53 mutants activate the promoter (Shivakumar et al, 1995).
While the wtp53 is endowed with a 3'-to-5'
exonuclease activity, associated with the central DNA-binding domain, and
thought to function during repair, replication, and recombination, the 273His mutant of p53 has lost the exonuclease
activity (Mummenbrauer et al, 1996).
G.
Involvement of p53 in repair and control of the cell cycle
p53 controls the level of
expression of the p21 gene, encoding
a protein that inhibits the activity of cyclin-dependent kinases (CDKs); CDK
activity is essential for the phosphorylation of RB at the G1/S checkpoint of
the cell cycle resulting in the release of E2F transcription factor from RB-E2F
complexes and in the up-regulation by the released E2F of genes required for
DNA synthesis. p21 levels are reduced considerably in tumor cells that have
lost the p53 protein or contain a nonfunctional mutated form of p53 (El-Deiry
et al, 1993). In addition, the p21 inhibitor of cyclin-dependent kinases
associates with PCNA thus blocking its ability to activate DNA polymerase d; this could give rise to the abnormal control in DNA
replication or to the loss of coordination between DNA replication and cell
cycle progression seen in tumor cells. Thus the upregulation of the p21 gene by p53 acts in two different
ways causing a cascade of events.
p53 is linked directly to
homologous recombination processes via its interaction with the RAD51/RecA
protein (StŸrzbecher et al, 1996).
H. A
proposal for an efficient killing of cancer cells using p53/PAX5 expression vectors
Introduction of a null p53
mutation by homologous recombination in murine embryonic stem cells gave mice
which appeared normal but were susceptible to a variety of neoplasms by 6
months of age (Donehower et al, 1992). Relevant to the issue that p53 is dispensable
for embryonic development are the studies of Stuart and coworkers (1995)
suggesting that during early embryo development p53 is not expressed because of the suppression of its gene by Pax5;
at later stages of development Pax5
inactivation allows p53 to be
expressed and exert its control on cell growth (Figure 22).
A significant factor to be
considered in approaches aimed at transferring the wt p53 gene to tumor cells is the impairment of the wt p53 functions
by the endogenous mutant p53 expressed in tumor cells which is able to
tetramerize with wt p53; optimal results will be expected if the endogenous
mutant p53 gene is inhibited
concurrently with overexpression of the wt p53 gene. It has been proposed
(Boulikas, 1997) that effective suppression of tumor growth with p53 vectors
could be achieved by the simultaneous transfer of wt p53 plus Pax5 to cancer
cells; Pax5 is a well established supressor of the p53 gene; its effect is
exerted via a direct interaction of Pax5 with a control element in the first
exon of the p53 gene (Stuart et al,
1995). Pax5 is an homeotic protein, controlling the formation of body
structures during development; Pax5 is expressed in early embryo stages to keep
the levels of p53 low and allow rapid proliferation of embryonic tissues.
Simultaneous transfer to solid tumors of a PAX5 and p53 genes in the same
expression vector but with the wt p53 mutagenized at 2-3 nucleotides to abort
the PAX5 suppressive site was proposed as a strategy to effectively suppress
tumor cell proliferation (Boulikas, 1997).
I. p53
gene bombs that explode in cancer cells
Exogenous genes encoding
"weapons" (suicide genes) and "triggers" have been devised
whose delivery to somatic cells will affect only cancer cells. The production
of mutated forms of p53 at high levels by cancer cells (normal cells do not
have adequate amounts of wt p53 protein) is being exploited to pull a molecular
trigger resulting in the transcriptional activation of a toxic gene and in the
death of cancer cells (da Costa et al, 1996). This invention is based on the
fact that (i) powerful chimeric
transcription factors can be engineered consisting of a DNA-binding domain (DBD) and a transactivation domain (TAD) and (ii) prokaryotic or viral enzymes are able to convert nontoxic
prodrugs into toxic derivatives (suicide genes, see HSV-tk, CD and PNP further
below); the toxic derivative produced in tumor cells which are transfected can
diffuse to surrounding cells causing their killing even in
Figure 22.
Involvement of p53 and Pax5 in B cell apoptosis. Adapted from Stuart et al
(1995).
the absence of transfection of these cells, a
phenomenon known as "bystander effect".
Trigger genes in plasmids
were made up of the DNA-binding domain of GAL4 (aa 1-147) fused in frame to a
protein domain that could interact with p53; the p53-binding domain was the
84-708 aa region of SV40 T antigen or of the 305-393 aa TAD domain of p53
(which acts as a tetramer) and which is similar between wt and mutant p53
(mutations on p53 are within the DBD). The constructs included the E. coli (DeoD) gene which encodes the purine nucleoside phosphorylase (PNP)
under control of the GAL4 response element (known as upstream activating sequence
or UAS); the PNP gene can convert the 6-methylpurine deoxyribose (MeP-dR)
prodrug into the diffusible, toxic 6-methylpurine (see page 69) and can become
a powerful suicide gene under these conditions (Sorscher et al, 1994).
Transfection of cells in culture with these constructs followed by treatment of
the cells with MeP-dR resulted in the death of the cells (da Costa et al,
1996). The mechanism was based on the fact that most normal cells do not
express the p53 gene and those who do express the wt p53 are destined for
programmed cell death; therefore, cancer cells containing elevated amounts of
mutant forms of p53 were amenable to this strategy.
The 55- kDa E1B protein of
adenovirus binds to and inactivates the p53 gene; ONYX-015 is an E1B, 55-kDa
gene-attenuated adenovirus unable to replicate and show cytopathogenicity in
tumor cell lines which express a wt p53 such as in RKO and U20S carcinoma lines
but can cause cytolysis in cell lines expressing a mutated form of p53; a wide
range of human tumor cells, including numerous carcinoma lines with either
mutant or normal p53 gene sequences (exons 5-9), were efficiently destroyed
following intratumoral or intravenous administration of ONYX-015 to nude
mouse-human tumor xenografts; furthermore, combination therapy with ONYX-015
plus chemotherapy (cisplatin, 5-fluorouracil) was significantly greater than
with either agent alone. On the contrary, normal human cells were highly
resistant to cytolysis by the adenovirus (Heise et al, 1997).
J.
Transfer of the p53 gene in cell culture
Preclinical studies have
shown that both viral and plasmid vectors able to mediate high efficiency
delivery and expression of wild-type tumor suppressor p53 gene can cause
regression in established human tumors, prevent the growth of human cancer
cells in culture, or render malignant cells from human biopsies non-tumorigenic
in nude mice. Inhibition in cell proliferation was observed in cell culture and
in tumors after induction of p53
expression with adenovirus vectors (Bacchetti and Graham, 1993; Wills et al,
1994; Zhang et al, 1994).
Transfer of the wild-type
p53 gene using a defective HSV vector into a human medulloblastoma cell line
containing a mutant copy of p53 resulted in p53 expression, increased the
levels of mdm2 proteins and induced cell cycle arrest of the majority of transduced
cells (Rosenfeld et al, 1995).
Apoptosis can be induced in
cultured NCI-H 596 human non-small cell lung cancer cells, which have a
wild-type p53 gene, by EGF signaling in a p53-dependent manner; whereas
treatment of these cells with EGF plus p53 sense oligonucleotides induced
EGF-dependent and p53-dependent apoptosis within 8 hours, antisense p53 gene
therapy suppressed the induction of apoptosis. A new nucleic acid drug was
developed based on a mutated p53 antisense with a mutation at three bases
immediately 5' and 3' from the CG dinucleotides which potentiated the induction
of apoptosis and failed to suppress the induction of EGF-dependent apoptosis
(Murayama and Horiuchi, 1997).
Infection of the
androgen-independent human prostate Tsu-pr1 cell line lacking functional p53
alleles with recombinant adenovirus vectors (replication-deficient) carrying
the p53 gene under control of the CMV promoter resulted in expression of p53
and induced striking morphological changes: the cells were detached from the
substratum, condensed, and exhibited breakdown of the nuclear DNA into
nucleosome-size fragments characteristic of apoptosis; whereas control cells
were able to elicit tumors in nude mice, the AdCMV/p53-infected cells failed to
form tumors (Yang et al, 1995).
K. Animal
studies using p53 gene transfer
Intratracheal injection of
a recombinant retrovirus containing the wt p53
gene was shown to inhibit the growth of lung tumors in mice nu/nu models
inoculated intratracheally with human lung cancer H226Br cells whose p53 gene
has a homozygous mutation at codon 254 (Fujiwara et al, 1994). A number of
other studies have shown suppression in tumor cell growth and metastasis after
delivery and expression of the wt p53
gene (Diller et al, 1990; Chen et al, 1991; Isaacs et al, 1991; Wang et al,
1993).
The safety of the
adenovirus-mediated p53 transduction of the liver in normal rats and in
50%-hepatectomized animals subjected to asanguineous portal perfusion was
examined by Drazan et al (1994). The gene transfer rate in whole liver and
after hepatectomy ranged from 20% to 40%; liver regeneration and hepatocyte
function were unaffected by overexpression of p53.
Delivery of the p53 gene to malignant human breast
cancer cells in nude mice using DOTMA:DOPE 1:1 cationic liposomes (400 nmoles
liposomes/35 mg DNA) resulted in regression (60% reduction in tumor
cell volume) in 8 out of 15 animals treated; animals were receiving one
injection every 10 days (Lesoon-Wood et al, 1995). It was thought that
wild-type p53 expression (tumor cells were expressing mutant forms of p53)
upregulated p21 gene to inhibit cell growth by inhibition in cyclin-dependent
kinases but also via induction of apoptosis preferentially in cancer cells.
When a recombinant
adenovirus encoding wild-type p53 under the control of the human CMV promoter
was introduced into SK-OV-3 human ovarian carcinoma cells it increased by more
than 50% the life span of nude mice injected with these cells; control animals
in this highly aggressive ovarian xenograft model died between 25-45 days from
injection time (Mujoo et al, 1996). Adenoviral transfer of a functional p53
gene into a radiation-resistant SCCHN cell line that harbors mutant p53
restored the G1 block and apoptosis in these cells in vitro and sensitized
SCCHN-induced mouse xenografts to radiotherapy in vivo (Chang et al, 1997).
The efficacy of a
replication-deficient p53 adenovirus construct was tested against three human
breast cancer cell lines expressing mutant p53, MDA-MB-231, -468, and -435 and
was found to be highly effective against 231 and 468 cells as well as their tumor
xenografts in nude mice but not against 435 cells probably due to their low
adenovirus transduction. 37% of growth inhibition of 231 cells was due to p53,
while 49% was adenovirus-specific (Nielsen et al, 1997).
Cytotoxic T lymphocytes (CTLs) recognizing a murine
wild-type p53 were able to discriminate between p53-overexpressing tumor cells
and normal tissue and caused complete and permanent tumor eradication without
damage to normal tissue after adoptive transfer into tumor-bearing p53+/+
nude mice. CTLs, presented by the MHC class I molecule H-2Kb, were generated by
immunizing p53 gene deficient (p53-/-) C57BL/6 mice with syngeneic
p53-overexpressing tumor cells (Vierboom et al, 1997).
L.
Transfer of the p53 tumor suppressor gene to prostate cancer cells
Although primary prostate tumors have few mutations
in the p53 gene (Voeller et al, 1994;
Isaacs et al, 1994), specimens from advanced stages of the disease and
metastases as well as their cell lines frequently display mutations or
deletions at both alleles of the p53 gene (Chi et al, 1994; Dinjens et al,
1994). Three of five prostate cancer cell lines examined (TSUPr-1, PC3, DU145)
and one out of two primary prostate cancer specimens were found to harbor
mutations altering the amino acid sequence of the conserved exons 5-8 of the
p53 gene; transduction of the p53-defective cell lines with the wt p53 gene
using lipofectin showed reduction in tumorigenicity assayed from reduced colony
formation and the cells became growth arrested (Isaacs et al, 1991).
Endocrine therapy is ineffective once the prostate
cancer becomes androgen-independent; these cancers remain unresponsive to
conventional chemotherapy. Androgen-independent and metastatic prostate cancers
were established in athymic male mice by co-inoculation with the LNCaP human
prostate cancer cell line and the MS human bone stromal cell line; these tumors
became necrotic and were successfully eradicated by intratumoral injection of a
recombinant p53/adenovirus; the p53
gene was driven by the CMV promoter and the SV40 poly(A) signal placed in the
E1 region of Ad5 (Ko et al, 1996). It was suggested that in addition to the
tumor suppressor, apoptotic, and antiangiogenesis function of p53, tumor
necrosis was induced by a bystander effect or a general immune response which
attracted immune cells to cause tumor cell killing (Ko et al, 1996).
M. Clinical trials using p53 gene transfer
A human clinical trial at M.D. Anderson Cancer Center
uses transfer of the wild-type p53
gene, in patients suffering with non-small cell lung cancer and shown to have
p53 mutations in their tumors, using local injection of an Ad5/CMV/p53
recombinant adenovirus at the site of tumor in combination with cisplatin
(Roth, 1996; Roth et al, 1996; protocols #29 and 124, Appendix 1). A retroviral vector containing the wild-type p53 gene
under control of a b-actin promoter was used for multiple percutaneous
injections or direct thoracoscopic injections at the site of the tumor into
nine patients, all in advanced stages, with non-small cell lung cancers.
Patients whose conventional treatments failed were selected for a p53 mutation
in the lung tumor. Reduction in tumor volume was achieved via apoptosis
(assayed in posttreatment biopsies) in three patients, and arrest in tumor
growth in three other patients (Roth et al, 1996).
RAC-approved clinical trials (Appendix 1) using p53 cDNA transfer are #29 (treatment of non-small
cell lung cancer with p53 and antisense K-ras), #124 (intratumoral delivery of
adenoviral p53 cDNA plus cisplatin), #130 (intratumoral injection of adenoviral
p53 to treat head and neck squamous cell carcinoma), #131 (primary and
metastatic malignant tumors of the liver), #147 (percutaneous injections of
adenovirus p53 for hepatocellular carcinoma), #148 (advanced or recurrent
adenocarcinoma of the prostate), #152 (intra-tumoral injections of ad5cmv-p53
to patients with recurrent squamous cell carcinoma of the head and neck), #153
(intralesional delivery of adenovirus p53 in combination with chemotherapy in
breast cancer), #154 (intratumoral injection of adeno p53 to patients with
advanced prostate cancer), #155 (intratumoral injection of adeno p53 to
patients with advanced and metastatic bladder cancer), and #156 (adeno p53 for
non-small cell lung cancer).
XVIII. p21
and p16 in cancer gene therapy
A. Molecular action of p21
p53 upregulates the p21/CIP1/WAF1 gene (simply called
p21) (ElDeiry et al, 1993). Induction of the p21/Waf-1/Cip-1 gene causes growth arrest via inhibition of
cyclin-dependent kinases (CDKs). CDKs are upregulated by cyclins which act as
positive regulators of cell cycle progression. Cdk2, also called p33cdk2, is the master regulator
of the cell cycle at the G1/S transition point. Whereas cdk2 is expressed at
constant levels throughout the cell cycle, its activation by phosphorylation is
first detected a few hours before the onset of DNA synthesis; furthermore,
antibodies directed against Cdk2 blocked mammalian cells from entering S phase.
D1 cyclin associates with Cdk2, Cdk4, and Cdk5 to control the G1¨S transition point; the genes of cyclins D1 and E are
overexpressed or rearranged in malignancies and conditional overexpression of
human cyclins D1 and E in Rat-1 fibroblasts causes a decrease in the length of
G1 and an acceleration of the G1/S phase transition. D1 appears to be
specialized in the emergence of cells from quiescence (Go¨G1 transition) whereas cyclin E is more oriented
toward control of the G1/S transition. Cdc2, a close relative of Cdk2 and whose
pattern of phosphorylation is cell cycle-regulated, becomes associated with
cyclin B to regulate the G2¨M transition (see Boulikas, 1995a).
CDK activity is essential for the phosphorylation of
RB at the G1/S checkpoint of the cell cycle resulting in the release of E2F
transcription factor from RB-E2F complexes and in the up-regulation of genes
required for DNA synthesis by the released E2F. p21 levels are reduced
considerably in tumor cells that have lost the p53 protein or contain a
nonfunctional mutated form of p53 (El-Deiry et al, 1993).
Induction of the p21/Waf-1/Cip-1
gene also causes growth arrest via inactivation of PCNA; indeed, the p21
inhibitor of cyclin-dependent kinases associates with PCNA, the accessory of
DNA polymerases a and d , thus blocking its
ability to activate these DNA polymerases; this could give rise to the abnormal
control in DNA replication or to the loss of coordination between DNA
replication and cell cycle progression seen in tumor cells (Li et al, 1994).
B. p21 and
p16 gene transfer
Introduction of the wt p53
or of the p21 downstream mediator of p53-induced growth suppression into a
mouse prostate cancer cell line, deficient in p53, led to an association of p21
with Cdk2; this interaction was sufficient to downregulate Cdk2 by 65% (Eastham
et al, 1995). The p21 gene, driven by CMV promoter into an Adenovirus 5 vector,
was more effective than the AD5CMV-p53 vector, (harboring the p53 gene under
control of the same elements as p21), in reducing tumor volume in syngeneic
male mice with established s.c. prostate tumors; tumors were induced by
injection of 2 million cells in each animal. These studies suggested that p21 expression might have more potent
growth suppressive effect than p53 in this tumor model and that p21 may be
seriously be included in the constellation of anticancer arsenals.
Transfer of p21 is an
effective tool to lead carcinoma cells with inactivated p53 into less malignant
phenotypes. p53 is frequently inactivated by papilloma viruses in carcinomas of
the uterine cervix. Transfer of the p21 gene to HeLa cells, a widely used
uterine cervix cell line, resulted in a significant growth retardation by
blockage of G1 to S transition, reduced anchorage-independent growth and
attenuated telomerase activity (Yokoyama et al, 1997). Introduction of p21 with
adenoviral vectors into malignant cells completely suppressed their growth in
vivo and also reduced the growth of established pre-existing tumours (Yang et
al, 1997).
Transfer of p21 was used to
suppress neointimal formation in the balloon-injured porcine or rat carotid
arteries in vivo (Yang et al, 1996; Ueno H et al, 1997a). A combination therapy
in mice with simultaneous transfer of the p21 gene and of the murine MHC class
I H-2Kb gene, which induces an immune response that stimulates tumor
regression, was more effective than treatment with either gene alone (Ohno et
al, 1997).
Malignant gliomas
extensively infiltrate the surrounding normal brain and their diffuse invasion
is one of the most important barriers to successful therapy; one of the most
frequent abnormalities in the progression of gliomas is the inactivation of the
tumor-suppressor gene p16, suggesting that loss of p16 is associated with
acquisition of malignant characteristics. Restoring wild-type p16 activity into
p16-null malignant glioma cells modified their phenotype. Adenoviral transfer
of the p16/CDKN2 cDNA in p16-null SNB19 glioma cells significantly reduced
invasion into fetal rat-brain aggregates and reduced expression of matrix
metalloproteinase-2 (MMP-2), an enzyme involved in tumor-cell invasion
(Chintala et al, 1997).
XIX. Gene therapies based on transfer of the
retinoblastoma (RB) gene
A. RB and
E2F proteins in the control of the cell cycle and apoptosis
Retinoblastoma protein is a transcription factor (Lee
et al, 1987) involved in the regulation of cell cycle progression genes
(reviewed by White, 1998, this volume). The role of RB on cell proliferation
and tumor suppression arises (i) from
its association with E2F, an association disrupted by RB phosphorylation at the
G1/S checkpoint resulting in release of E2F and in the upregulation of a number
of genes required for DNA replication;
(ii) from the direct association of RB protein with a number of viral
oncoproteins or key regulatory proteins including E1A of adenovirus (Whyte et
al., 1988), SV40 large T (Ludlow et al., 1990) and the human papilloma virus E7
protein (Dyson et al., 1989). Normal
cellular targets of RB, such as the transcription factor E2F (Bagchi et al.,
1991; Chellapan et al., 1991) become dissociated from the RB protein in the
presence of these viral proteins in the cell (E1A, T antigen, E7), leading to
cell cycle progression. This
constitutes a mechanism (also the interaction of viral proteins with p53, see
above) viruses use to render infected cells continuously cycling.
(iii) RB is able to repress directly c-fos gene expression (Robbins et al., 1990) and has been proposed to
have a similar effect on c-myc
expression (Pietenpol et al., 1990).
(iv) RB also suppresses cell growth by directly repressing transcription of
the rRNA and tRNA genes by blocking the activity of RNA polymerase I
transcription factor UBF (Cavanaugh et al, 1995; reviewed by White, 1998).
Hypophosphorylated RB, but not mutant RB, was
associated with the nuclear matrix, particularly concentrated at the nuclear
periphery and in nucleolar remnants, only during early G1; the peripheral
matrix proteins lamin A and C bound RB in vitro. This association was thought
to be important for the ability of RB to regulate cell cycle progression
(Mancini et al, 1994). It is interesting that mutated p53 but not wtp53
interacts with specific types of MARs (Will et al, 1998); nuclear matrix is an
essential structure for replication transcription recombination and repair
processes intimately connected to mechanisms of carcinogenesis.
The tumor suppressor function of RB is believed to
occur by complex formation between E2F and RB or the RB-related proteins p107
and p130, a complex that down-regulates the DNA-binding activities of E2F; the
transcription activating capacity of E2F on the genes it regulates can be
repressed by interaction with RB (Nevins, 1992). Cyclin A, believed to
facilitate DNA replication, also associates with E2F; both types of complexes,
E2F-RB and E2F-cyclin A, can be dissociated by the adenovirus E1A protein. The
release of E2F by E1A results in cell cycling and this constitutes an
additional mechanism of interference of adenoviruses with the proliferation of
the infected cells; release of E2F from RB induced by E1A is critical for
transformation of cells by E1A (for references see Hiebert et al, 1995).
The p107 protein with similarities in structure and
DNA-binding properties to RB also binds cyclin A; whereas RB is complexed to
E2F during G1 the p107-cyclin A complex interacted with E2F as cells entered S
phase (Shirodkar et al., 1992).
E2F is a transcription factor that activates the
adenovirus E2 gene and a number of cellular genes that respond to proliferation
signals and that control the passage of the cell cycle through S phase such as myc and DHFR genes and contributes to the uncontrolled proliferation of
adenovirus-transformed cells (Mudryj et al., 1991; see White, 1998, this
volume). It has been speculated that the physiological function of RB (and also
of its similar protein p107) in negatively-regulating cell growth and in acting
as a tumor suppressor protein are exerted via its ability to down-regulate the
activity of E2F (Shirodkar et al., 1992); this has been subsequently confirmed
by numerous studies. RNA ligands that bind to E2F1 were selected from RNA
libraries and were used to inhibit the induction of S phase in cultured cells
(Ishizaki et al, 1996). Such molecules might find applications in cancer
therapy because of the important role of E2F proteins in the regulation of cell
cycling.
Retinoblastoma protein has
a functional domain (the pocket) for binding to transcription factor E2F
implicated in cell growth control. The
same domain is responsible for the association of RB with the adenovirus E1A,
the SV40 large T, and the human papilloma virus E7 proteins (Kaelin et al.,
1992). Using an approach for
screening lgt11 expression libraries, clones encoding for
RB-binding proteins were identified; among those are RBAP-1 and 2, or
retinoblastoma-associated proteins 1 and 2 (Kaelin et al., 1992) and RBP3
(Helin et al., 1992). RBAP-1 binds
to the RB pocket, copurifies with E2F, contains a functional transactivation
domain, and binds to E2F cognate sequences (Kaelin et al., 1992).
E2F contains a RB-binding
domain in its C-terminus (Helin et al., 1992; Shan et al., 1992). RB binds directly to the activation
domain of E2F1 and silences it, thereby preventing cells from entering S phase.
To induce complete G1 arrest, RB requires the presence of the hbrm/BRG-1
proteins, which are components of the coactivator SWI/SNF complex. This
cooperation was mediated through a physical interaction between RB and
hbrm/BRG-1. RB can contact both E2F1 and hbrm at the same time, thereby
targeting hbrm to E2F1 (Trouche et al, 1997).
E2F cooperates with p53 to
induce apoptosis (Wu and Levine, 1994) and high levels of wild-type p53
potentiate E2F-induced apoptosis in fibroblasts (Qin et al, 1994). The
physiological relevance of E2F in the apoptotic mechanism was thought to arise
from the ability of E2F to act as a functional link between p53 and RB; p53
levels increase in response to high levels of E2F (DP is required for the
association of E2F with RB); overexpression of both E2F-1 and DP-1 led to a
rapid death of (IL-3)-dependent 32D.3 myeloid cells even in the presence of
survival factors (Hiebert et al, 1995). Overexpression of exogenous E2F-1 using
a tetracycline-controlled expression system in Rat-2 fibroblasts promoted S-phase
entry and subsequently led to apoptosis (Shan and Lee, 1994).
B.
Phosphorylation of RB: the TGF-b1, IL-1,
and IL-6 connection
Work from several groups
has shown that RB is un- or under-phosphorylated in G0/G1 and becomes
phospho-rylated in its N-terminal domain during S and G2/M (Buchkovich et al.,
1989; Chen et al., 1989; DeCaprio et al., 1989; Mihara et al., 1989). Only under-phosphorylated RB interacts
with E2F (Chellappan et al., 1991). Treatment with TGF-b1 maintained RB protein in its active dephosphorylated
form, thus providing a link between RB growth suppression and growth inhibition
by TGF-b1.
Interleukin-6 (IL-6), known to mediate autocrine and
paracrine growth of multiple myeloma (MM)
cells and to inhibit tumor cell apoptosis was determined to exert this function
via phosphorylation of RB protein; this finding could explain the abnormalities
of RB protein and mutations of RB gene associated with up to 70% of MM patients
and 80% of MM-derived cell lines. Culture of MM cells with RB antisense, but
not RB sense, oligonucleotide triggered IL-6 secretion and proliferation in MM
cells; phosphorylated pRB was constitutively expressed in MM cells and IL-6
shifted pRB from its dephosphorylated to its phosphorylated form (Urashima et
al, 1996).
Interleukin-1 (IL-1) causes G0/G1 phase growth arrest
in human melanoma cells, A375-C6 via hypophosphory-lation of RB protein.
Exposure to IL-1 caused a time-dependent increase in hypo-phosphorylated RB
that correlated with an accumulation of cells arrested in the G0/G1 phase; this
was abrogated by the SV40 large T antigen which binds preferentially to
hypo-phosphorylated RB, but not by the K1 mutant of the T antigen, which is
defective in binding to RB (Muthukkumar et al, 1996).
C. Genes regulated by RB protein
RB represses a number of genes by sequestering or
inactivating the positive transcription factor E2F and seems to activate some
other genes by interacting with factors like Sp1 or ATF-2 (Rohde et al, 1996).
RB protein is a master regulator of a complex network of gene activities
defining the difference between dividing and resting or differentiated cells.
Using the method of differential display Rohde et al (1996) detected a number
of genes which were upregulated by ectopic expression of the RB gene in
RB-deficient mammary carcinoma cells including the endothelial growth regulator
endothelin-1 and the proteoglycans versican and PG40.
Introduction of the wild-type RB gene via
retrovirus-mediated gene transfer has provided several RB-reconstituted
retinoblastoma cell lines (Huang et al., 1988; Chen et al., 1992). These RB+ cell lines showed little difference in
their growth rates in culture when compared to the parental or revertant RB- cells; however, RB+ cells invariably lost their
tumorigenicity in nude mice assays (Chen et al., 1992). RB protein down-regulates its own gene and this negative
autoregulation is mediated by the transcription factor E2F; this was shown by
inserting the promoter of the RB gene 5' of the bacterial CAT reporter gene
followed by its transfection into RB+ and RB- retinoblastoma
cells: RB promoter activity was signifi-cantly decreased in RB+ cells (Shan et al., 1994).
D. Transcription factors (TFs) that regulate the RB
gene
Several mutations have been found in the promoter
region of the RB gene, suggesting that inappropriate transcriptional regulation
of this gene contributes to tumorigenesis. The presence of E2F recognition
sites in promoters of a number of growth-related genes suggested that
expression of these genes might be affected by RB. Understanding the nature and availability of TFs which regulate
the RB gene in particular cell types is instructive for a successful gene
therapy application involving transfer of RB.
An E2F recognition site lies within a region critical
for RB gene transcription; binding of E2F-1 at this site transactivates the RB
promoter; striking back, the resulting overexpression of RB suppresses
E2F-1-mediated stimulation of RB promoter activity and, thus, the expression of
RB is negatively autoregulated through E2F-1 (Shan et al, 1994). Up-regulation
of the RB gene by E2F was shown by co-transfection of RB- osteosarcoma Saos2 cells in culture with a plasmid expressing
E2F-1 under the control of the CMV immediate-early gene promoter-CAT construct:
expression of E2F-1 stimulated RB promoter activity 10-fold under conditions
where E2F-1 had little effect on c-jun,
c-myc, and EGR-1 gene expression
(Shan et al., 1994). The
autoregulation of RB gene by RB may be accomplished via a direct protein-DNA
complex formation, via protein-protein interaction regulating the activity of
other transcription factors on the promoter of the RB gene, or both.
Two distinct DNA-binding factors, RBF-1 and ATF, play
an important part in the transcription of the human RB gene. The promoter of
the human RB gene and of the mouse RB1 gene (Zacksenhaus et al., 1993) contain
binding sites for ATF, and a Sp1-like transcription factor (Mitchell and Tijan,
1989) where the RBF-1 (retinoblastoma binding factor 1) may bind (Sakai et al.,
1991). Human RB gene is also regulated by AP-1 (Linardopoulos et al, 1993), as
well by the early response transcription factor, nerve growth factor inducible
A gene (NGFI-A) which is expressed in prostate cells and binds to the site
GCGGGGGAG at -152 to -144 within the RB gene promoter (Day et al, 1993). The
ATF site of the RB promoter is a responsive element during myogenic
differentiation; RB promoter activity increased about 4-fold during
differentiation and was reduced when a point mutation was designed in the ATF
site (Okuyama et al, 1996).
pRB activates expression of the human transforming
growth factor-b2 gene through ATF-2; the human RB gene promoter is
autoregulated by RB protein via an ATF-2-like binding site at the
carboxyl-terminal domain of pRB; overexpression of RB stimulates RB promoter
activity through the ATF binding site in a variety of different cell types
(Park et al, 1994).
The candidate oncoprotein Bcl-3, previously
characterized as a member of the IkB family, activated
transcription of the RB gene, whose promoter has no typical NF-kB sites, via binding to a DNA element identical to
E4TF1/GABP site; Bcl-3 promoted tetramerization of E4TF1. Expression of the
antisense bcl-3 RNA in myoblasts suppressed induction of RB and myogenic
differentiation whereas transient expression of bcl-3 in myoblasts was shown to
induce expression of the endogenous RB (Shiio et al, 1996).
Two oncogenic point mutations at the Sp1 and ATF
sites of the RB gene promoter were identified in two separate hereditary RB
families. The Sp1 consensus site mutation was blocking the action of RBF-1,
recently identified as the human GABP/E4TF1, a transactivator from the
adenovirus early-region 4 promoter. The human GABP/E4TF1 protein enhanced the
core RB promoter activity, whereas it did not stimulate a mutant RBF-1 site and
was proposed to be the most essential transcription factor for human RB gene
activation (Clark et al, 1997).
Whereas binding of the Sp1 transcription factor is
not significantly affected by methylation of the CpG dinucleotide within its
binding site, 5'-GGGCGG (lower strand, 5'-CCGCCC) methylation of the outer C is
inhibitory (mammalian cells also have the capacity to methylate cytosines at
CpNpG sites) and in particular methylation of both cytosines mCpmCpG
inhibited binding by 95%; endogenous mCpmCpG methylation
of an Sp1 site in the CpG island promoter of the RB gene was identified by
genomic sequencing in a proportion of retinoblastoma tumors which were
extensively CpG methylated in the RB promoter (Clark et al, 1997).
E. RB gene transfer
Functional loss of the RB gene has been implicated in
the initiation or progression of several human tumor types including cancer of
the eye, bone, bladder, and prostate. The cancer suppressor activity of RB was
directly demonstrated by the introduction of a normal RB gene into
retinoblastoma cells that have lost the RB function (inability to be
phosphorylated because of mutations at the appropriate sites) by mutation at
both alleles; this led to the suppression of the neoplastic phenotype and loss
of the tumorigenicity of RB cells in nude mice (Huang et al, 1988). Expression
of the normal RB gene into the human prostate carcinoma cell line DU145,
mediated by recombinant retrovirus integration, also resulted in loss of its tumorigenic
ability in nude mice (Bookstein et al, 1990). Studies with tumor cells
reconstituted with RB ex vivo and implanted into immunodeficient mice, as well
as with germline transmission of a human RB transgene into tumor-prone Rb+/-
mice have demonstrated cancer suppression (see Riley et al, 1996).
DU145 cells express a shorter protein lacking 35
amino acids from exon 21 due to a 105 nucleotide in-frame deletion (Bookstein
et al, 1990). The human bladder carcinoma cell line J82 contains a mutated RB
protein with exactly these features (Horowitz et al, 1989); this 35 amino acid
stretch is required for complexation with T antigen and E1A. However, the two
cell lines have lost exon 21 of RB because of a different type of mutation: J82
cells have a point AG to GG mutation in the intron 20-splice acceptor site but
the type of mutation in DU145 leading to exon 21 loss is different (Bookstein
et al, 1990).
Intratumoral infection of spontaneous pituitary
melanotroph tumors arising in immunocompetent Rb+/- mice with a
recombinant adenovirus carrying the RB cDNA inhibited the growth of tumors,
re-established innervation by growth-regulatory dopaminergic neurons, and
prolonged the life spans of treated animals (Riley et al, 1996).
Retrovirus-mediated gene transfer of RB to the breast
carcinoma cell lines MDA-MB468 and BT549, both of which harbor partial RB gene
deletions as well as point mutations of their p53 genes, restored its
expression in cells, reduced their ability to grow in soft agar, and their
tumorigenicity in nude mice, although it did not significantly altered growth
rate in culture (Wang et al, 1993).
Future therapeutic approaches using the RB gene are
directed toward inhibition in cell proliferation (such as to inhibit neointima
formation and smooth muscle cell proliferation in arterial diseases, see
Arterial injury below and Chang et al, 1995) rather that aggressive suppression
and apoptosis of solid tumors; p53 is a better gene than RB for tumor
eradication.
XX. Induction of apoptosis for cancer gene therapy
A. Apoptosis as an essential process
Apoptosis has become a basic tool in developing
cancer research in establishing new anticancer strategies. The health of a
multicellular organism depends both on the ability of the body to produce new
cells but also on the ability of certain type of cells to perish,
self-destruct, when they become superfluous or severely damaged. Apoptosis, or
programmed cell death, is a biological process associated with pronounced
morphological changes, chromatin condensation, drop in pH, and intranucleosomal
DNA degradation by which a cell actively commits suicide. Virtually all tissues
have apoptotic cells; salient examples in the adult are: the eye lenses which
consist of apoptotic cells that replaced their cytoplasm with crystallin;
intestinal wall cells which migrate to the tip of the finger-like projections
over several days where they die; ineffectual T cells which mature in thymus
and which would attack the bodyÕs own tissues are eliminated by apoptosis
before entering the bloodstream; skin cells migrate from the deepest layers to
the surface where they commit suicide forming the outer layer of the skin.
Apoptosis is an essential process during embryogenesis: mammals eliminate
neuron cells as the nervous system is formed; tadpoles delete their tails by
apoptosis (reviewed by Duke et al, 1996).
Virus-transformed as well as severely X-ray-damaged
or UV-damaged cells are similarly eliminated from the tissue via apoptosis; if
they are left they can form malignant cells. Initiated cancer cells may lead to
tumor development only when a dysfunction in their apoptotic pathway takes
place. Although the biochemical aspects of cell death are fraught with the
problem of cause versus effect, the role of apoptosis in neoplasia and its regulation
by a number of oncogenes and p53 has emerged. Apoptosis is essential for normal
development and homeostasis; deregulation in the positive control of apoptosis
is associated with cancer and autoimmune disease whereas deregulation in the
negative control of apoptosis is associated with degenerative diseases
(reviewed by White, 1993; Duke et al, 1996).
B. Molecular mechanisms for apoptosis: p53, Bax,
Bcl-2, c-Myc and other proteins
Apoptosis is of special interest in gene therapy not
only of cancer but of other diseases such as arterial disease. Apoptosis is a
complex process involving a significant number of apoptotic and antiapoptotic
mechanisms. The cytotoxic (killer) T lymphocytes of the immune system of the
infected organism bind to virus-infected cells inflicting their eradication
with two different type of proteins: Perforin is a transmembrane molecule
transferred from the killer T cell to the membrane of the infected cells
forming holes on the membrane of the target cell allowing uptake of proteases
called granzymes that activate ICE-like proteases to induce apoptosis. A number
of antiviral drug development strategies are based on blockage of the activity
of antiapoptotic viral proteins.
Expression of a number of genes induce apoptosis;
their protein products include adenovirus E1A (Debbas and White, 1993; Lowe and
Rudley, 1993) and c-Myc (Hermeking and Eick, 1994; Wagner et al, 1994). A
number of proteins when expressed at sufficient amounts block apoptosis; these
include Bcl-2 and E1B 19 kDa protein of adenovirus (Debbas and White, 1993;
Chiou et al, 1994). Exposure of cells to a variety of growth factors including
IL-3, IL-6, and erythropoietin, acting as survival factors, inhibit induction
of apoptosis (Johnson et al, 1993; Yonish-Rouach et al, 1993; Canman et al,
1995).
The role of p53 in these molecular processes has been
discussed in previous pages in this review. The involvement of p53 in apoptosis
is thought to occur via upregulation of bax
and downregulation of bcl-2 genes by
wt p53 but not by mutated p53 proteins; Bax protein induces apoptosis and its
upregulation triggers the apoptotic mechanism in cells which display elevated
levels of p53 as a result, for example, of DNA damage. Down-regulation of Bcl-2
has a similar effect on the induction of apoptosis. p53 may induce apoptosis
independently of transcription, although the G1 arrest by p53 requires
transcription of p53 targets (reviewed by Ko and Prives, 1996). Induction of
the apoptotic pathway by p53 was proposed to involve: (i) transcriptional induction of redox-related genes; (ii) formation of reactive oxygen species;
and (iii) the oxidative
degradation of mitochondrial components (Polyak et al, 1997). The potential of
p53 in cancer gene therapy is discussed above.
While p53 and E1A activate apoptosis, Bcl-2 and E1B
19k proteins inhibit apoptosis. All four protein molecules act upstream of Bax
which is a potent inducer of apoptosis: both the cellular Bcl-2 and the 19 kDa
protein E1B of adenovirus are able to interact with Bax inhibiting its
involvement in induction of apoptosis (Han et al, 1996; Figure 1 on page 9). E1A acts upstream of p53 by increasing the
half-life of p53 resulting in an accumulation of p53 molecules in the nucleus
(Lowe and Ruley, 1993); increased levels of p53 are then believed to upregulate
the bax gene (Figure 1). The survival factors IL-3 and IL-6 appear to prevent
p53-dependent apoptosis (see White, 1993).
p53 induces apoptosis after exposure to UV
irradiation (Ziegler et al, 1994) and hypoxia (Graeber et al, 1996); this acts
as a protective mechanism for the removal of severely damaged cells from the
body which could become initiated cancer cells and progress to tumors.
Spontaneous or radiation-induced apoptosis mediated by p53 has been shown to
act for the removal of cells from the gastrointestinal tract in mice (Merritt
et al, 1994) and the skin after sunburn (Ziegler et al, 1994). Epidermal growth
factor (EGF) has induced apoptosis in various cancer cell lines via a novel
signal transduction pathway of EGF mediated through p53 (Murayama and Horiuchi,
1997).
c-myc
expression, normally induced in proliferating hematopoietic cells by mitogens,
drops dramatically by mitogen withdrawal leading to cell arrest in G1. During deregulated c-myc expression,
c-myc levels were not down-regulated
upon mitogen withdrawal; instead, DNA synthesis continued resulting in
apoptosis but not in growth arrest. The
transforming segment of c-Myc was responsible for induction of apoptosis (see
White, 1993).
Pax5 is a repressor of expression of the p53 gene
interacting directly with a regulatory region within exon 1 of the p53 gene. At
early stages during pre-B cell development the levels of Pax5 are high and p53
is down-regulated; however, later in development Pax5 levels drop and the p53
gene is activated; this process was proposed to lead to the decision of B cells
to enter apoptosis or differentiate into plasma cells (Stuart et al, 1995).
Down regulation of the Cu2+/Zn2+ superoxide dismutase (SOD1) induced oxidative stress and
apoptosis (Troy et al, 1996). A great deal of oxidative damage during the
procedures for ex vivo-modification of cells induces their apoptosis; transfer
of the Cu2+/Zn2+ superoxide dismutase to ex vivo modified
cells increased their survival after implantation (see Nakao et al, 1995). This
demonstrates the importance of blocking apoptotic pathways during cell
manipulation for successful ex vivo gene therapy.
Gene therapy for cancer could involve restoration of
the apoptotic pathway in cancer cells leading to their suicidal death; this
could be effected by overexpression of the bax
gene, by suppression of the endogenous bcl-2
gene (see below), or by transfer of the wt p53 gene.
C. Role of tumor necrosis factor (TNF)
The tumor necrosis factor-a (TNF-a) is a cytokine produced
by macrophages, monocytes, lymphoid cells, fibroblasts and other cell types in
response to inflammation and infection. TNF-a
is produced by lipopolysaccharide (LPS)-stimulated macrophages; the molecular
pathways leading to TNF-a production in these specialized cells involves activation by LPS of several kinases
including the extracellular-signal-regulated kinases 1 and 2 (ERK1 and ERK2),
p38, Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK), as well
as activation of the immediate upstream MAPK activators MAPK/ERK kinases 1 and
4 (MEK1 and MEK4) and of MEK2, MEK3, and MEK6 (Swantek et al, 1997).
TNF-a binds to two type of
specific receptors, TNFR1 and TNFR2, causing their trimerization and leading to
activation of a number of kinases (ceramide-activated kinase, IkB kinase, Raf-1, Jun N-terminal kinases or JNKs,
p38/Mpk2). Activation of Raf-1, JNK, and p38/Mpk2 contribute to the induction
of AP-1 whereas activation of IkB kinase is leading to
the activation of the transcription factors NF-kB.
This activation leads further to upregulation of genes and induction of other
cytokines, metalloproteinases, and immunoregulatory proteins (see Liu et al,
1996 and the references cited therein).
TNF can induce apoptotic death or necrosis in some
tumor cells; this effect of TNF could be mediated by activation of
sphingomyelinases and phospholipases, synthesis of metabolites of arachidonic
acid, generation of free radicals, changes in intracellular calcium, generation
of DNA strand breaks and activation of poly(ADP-ribosyl)ation, or activation of
ICE-like proteases.
TNF-a, IL-1b, IFN-g, and vitamin D3 after
binding to their transmembrane receptors stimulate the production of the second
messager ceramide from sphingomyelin in the plasma membrane by activating
sphingomyelinase; this results in a cascade of signal transduction events that
result in down regulation of c-myc and induction of apoptosis, to terminal
differentiation, or to RB-mediated cell cycle arrest (Figure 23).
IL-1 signaling leads to NF-kB activation and to protection against TNF-induced
apoptosis. The IL-1R-associated kinase (IRAK) is homologous to Pelle of
Drosophila. Two additional proximal mediators, both associating with the IL-1R
signaling complex, were required for IL-1R-induced NF-kB activation: IRAK-2, a Pelle family member, and
MyD88, an adaptor molecule containing a death domain (Muzio et al, 1997).
Treatment of different cell types with TNF-a results in the activation of the MEKK1 pathway of
protein kinases ultimately resulting in AP-1 transcription factor activation
and in the upregulation of several cytokine genes. TNF-a-stimulation also results in the activation of NF-kB and inhibition of apoptosis (Figure 24). A TNF-responsive
Figure 23. A pathway leading to the
induction of growth arrest and apoptosis by the cytokines TNF-a, IL-1b, and IFN-g. The
pathway is conserved between mammalian cells and yeast. Adapted from Nickels
and Broach (1996). From Boulikas T (1997)
Gene therapy of prostate cancer: p53, suicidal genes, and other targets. Anticancer Res 17, 1471-1506.
Reproduced with the kind permission from Anticancer Research.
serine/threonine
protein kinase termed GCK-related (GCKR) most likely signals via
mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase
(ERK) kinase kinase 1 (MEKK1) to activate the SAPK pathway (Shi and Kehrl,
1997).
D. NF-kB as
anti-apoptotic molecule and TNF-a signaling
Activation of NF-kB
is believed to lead to the activation of antiapoptotic genes that have not been
fully identified. The antiapoptotic role of NF-kB
at the molecular level and the TNF-a connection consists of
the following events; signaling by TNF-a induces trimerization
of its receptors, an event causing three different cascades: (i) Activation of IkB kinase and activation of NF-kB, a pathway which prevents cell death. A key step for NF-kB activation leading
to the activation of the stress-activated protein kinase (SAPK, also called
c-Jun N-terminal kinase or JNK) is the recruitment to the TNF receptor of TNF
receptor-associated factor 2 (TRAF2).
(ii) induction of apoptosis via a different pathway involving activation of
sphingomyelinase in plasma membrane and generation of ceramide leading to EGFR
activation and induction of apoptosis; (iii) activation of MEKK1 and JNK
protein kinases which is not linked to apoptotic death but to AP-1 activation (Figure 24). The antiapoptotic function
of NF-kB may
involve activation of the manganese superoxide
dismutase and of the zinc finger protein A20; expression of these genes is
induced by TNF and each of them provides protection against apoptosis (Liu et
al, 1996).
bcl-2 upregulation during progression of prostate
cancer was implicated in the acquisition of the androgen-independent growth; a
strong antioxidant that interferes with activation of NF-kB in prostate carcinoma cells, potentiated TNF-a-stimulated apoptosis signaling through a
bcl-2-regulated mechanism; based on these studies, modulation of the NF-kB survival signaling was proposed to be used to
clinical advantage in the treatment of prostate cancer patients (Herrmann et
al, 1997).
Transgenic mice lacking the p65 (RelA) subunit of NF-kB displayed increased apoptosis and degeneration in
the liver providing further support to an apoptotic function of NF-kB (Beg et al, 1995). The TNF-induced death of mouse
primary fibroblasts expressing deregulated c-Myc was inhibited by transient
overexpression of the p65 subunit of NF-kB, which increased NF-kB activity in the cells (Klefstrom et al, 1997). Rel (a protooncogene, member of the NF-kB family) is implicated in both positive and negative
regulation of GM-CSF expression in a variety of cell types (Gerontakis et al,
1996).
The elucidation of IL-1, TNF, IFN and other signaling
pathways would lead to the discovery of new drugs causing specific inhibition;
for example, members of the IL-1 signaling cascade may provide therapeutic
targets for inhibiting IL-1-induced inflammation (Muzio et al, 1997).
Figure 24. TNF-a signaling
via trimerization of its receptors (TNF-aR1), is
causing: (i) activation of IkB kinase
and activation of NF-kB, a
pathway which prevents cell death via activation of the manganese superoxide dismutase and of the zinc
finger protein A20. (ii) induction
of apoptosis via second message ceramide (see Figure 23) and (iii) activation
of JNK leading to AP-1 activation and up-regulation of cytokine genes.
E. Interleukin-1b converting enzyme (ICE) and apoptosis
The human interleukin-1b
converting enzyme (ICE) is a cysteine-rich protease that can cleave the
inactive 31 kDa precursor of IL-1b to generate the active
cytokine; it has similarities to the C.
elegans CED-3 protein. This protease plays a central role in apoptosis; the
exact role and the involvement of IL-1b have not been
elucidated; it is believed that signals from IL-1b,
TNF-a, vitamin D3, and interferon-g, which induce an antiproliferative response,
converge on sphingomyelin of plasma membrane activating a sphingomyelinase
which generates a ceramide second messenger (Figure 23); in S. cerevisiae,
this leads to signal transduction via activation both of a cytoplasmic protein
phosphatase 2A and a protein kinase leading to down-regulation in c-myc expression and induction of
apoptosis as well as RB-mediated cell cycle arrest via EGFR activation (Nickels
and Broach, 1996).
At least 10 ICE-like proteases have been identified
which mediate apoptotic death after their induction by a number of stimuli (see
Martin and Green, 1995); these are divided into three families: (i) the ICE/CED3 family, including ICE
itself; (ii) the CPP32/Yama family;
and (iii) the Ich-1/Nedd2 family;
they all contain the conserved QACRG
pentapeptide in which the central cysteine participates in proteolytic
catalysis (see JŠnicke et al, 1996). Activation of these proteases by induction
of apoptosis results in the cleavage of a large number of key regulatory
proteins including among others poly(ADP-ribose) polymerase or PARP (Lazebnik
et al, 1994), RB (JŠnicke et al, 1996), PKCd (Emoto et al, 1995), Gas2
affecting microfilament reorganization (Brancolini et al, 1995), the
DNA-dependent protein kinase (Casciola-Rosen et al, 1995), and the sterol
regulatory element binding proteins (SREBPs) catalyzed by CPP32 ICE-like
protease (PARP et al, 1996). Since cleavage of a single protein has not been
shown to cause cell death it is not clear how many substrate protein molecules
need to be cleaved. In addition different apoptotic pathways may exist and may
operate in different cell types.
Expression of the murine ICE cDNA in Rat-1 cells induced programmed cell death and this
phenomenon could be reversed by overexpression of the bcl-2 oncogene (Miura et al, 1993). Expression of members of the
family of cysteine proteases related to ICE have been shown to be necessary for
programmed cell death in a number of organisms (Yuan et al, 1993).
Overexpression of murine ICE or of
the ICE-like proteases NEDD-2/ICH-1 and Yama/apopain induced apoptosis (Miura
et al, 1993). Mice lacking ICE were resistant to apoptosis induced by Fas
antibody (Kuida et al, 1995).
F. Role of poly(ADP-ribose) polymerase (PARP)
PARP is a central mediator of genome integrity and
transmits signals from DNA damage to recruit locally DNA repair activities
(Zardo et al, 1998; Quesada, 1998, this volume). An additional role of PARP is
its involvement in apoptosis causing suppression of an apoptotic endonuclease;
PARP is cleaved by an ICE-like protease during TNF-induced apoptosis (Lazebnik
et al, 1994). Cleavage of PARP would abort these pathways resulting in loss of
recruitment of DNA repair enzymes at damaged sites but also in loss in the
inhibitory function of poly(ADP-ribose) groups on key regulatory enzymes (DNA
ligase, topoisomerase). It is unlikely that PARP proteolysis by an ICE-like
protease is a primary event since PARP-deficient mice show normal resistance to
DNA damaging agents (Wang et al, 1995).
G. Apoptosis in autoimmune disease and ischemic heart
disease
T cells are produced by bone marrow and then migrate
to the thymus gland where they mature. The cytotoxic or killer T cells directed
against foreign bodies are released in the bloodstream; a specific apoptotic
mechanism eliminates T cells directed against specific antigens on healthy
cells. However, the body allows some mildly self-reactive lymphocytes to
circulate; although harmless, exposure to a microbe or food antigen can
stimulate them causing an expansion in their proliferation and resulting in a
mild autoimmune disease. Such mild autoimmune reactions usually disappear when
the stimulating antigen is cleared away; in more severe autoimmune disease,
however, these lymphocytes survive longer inducing apoptosis and
self-destruction in healthy cells in various tissues.
A number of classical diseases may originate by
autoimmune mechanisms including initiation of atherosclerosis by apoptotic
death of the epithelial cells in the arterial wall, diabetes by destruction of
the pancreatic cells, lupus erythematosus, rheumatoid arthritis, and others.
The mechanism via which T lymphocytes directed against self antigens defy
apoptosis is not known; the mechanism might involve overexpression of the Bcl-2
gene in these lymphocytes or down-regulation of a gene encoding for the Fas
ligand that sends a death message to the lymphocyte (Weih et al, 1996; reviewed
by Duke et al, 1996).
Excessive necrotic death in cells of the coronary
artery wall results by oxygen and glucose deprivation after blockage of a blood
vessel feeding a segment of the heart (also the brain in stroke). Destructive
free radicals are then produced during inflammation of the area which can cause
apoptotic or necrotic death in cells in the surroundings. Since both brain and
heart cells in the adult are not regenerated, Biotech Companies (for example
Genentech) are focusing in developing drugs that block free radical formation,
inhibit ICE-like proteases, or inhibit apoptosis via other mechanisms.
The progressive loss of neuron cells in senile or
other brain diseases such as AlzheimerÕs disease, ParkinsonÕs disease,
HuntingtonÕs disease, and amyotrophical lateral sclerosis may ensue by
apoptosis. Etiologic factors may include excessive levels of neurotransmitters,
low levels of NGF, free radical-mediated damage, and deregulation in the
expression of genes encoding apoptotic regulators during aging. Deregulation in
apoptosis may also have a share in the induction of osteoporosis.
XXI. Genes
involved in the regulation of apoptosis as targets for gene therapy
Many of the molecular controllers of apoptosis
including cytokine signaling pathways (TNF-a,
IL-1b), tumor suppressor proteins (p53), viral proteins
(E1A of adenovirus), cellular oncoproteins (Myc), proteins that control the
cell cycle (E2F), apoptosis inducers (Bax) and antiapoptotic molecules (Bcl-2,
NF-kB) could constitute potential targets for
pharmacological intervention for the treatment not only of cancer but of other
human disease. Although for cancer treatment it is desirable to induce
apoptosis, the opposite effect, that is inhibition of apoptotic pathways is
desirable in the gene therapy of heart disease and degenerative brain disease
(see below).
A. Gene therapy that targets bcl-2
Bcl-2 protein is overexpressed in a variety of human
leukemias because of translocation of its gene to the immunoglobulin locus;
Bcl-2 is associated with the outer surface of the mitochondrion and appears to
be involved in scavenging oxygen radicals. Overexpression of the bcl-2 gene in tumors is thought to be
responsible for the poor response of the tumors to antineoplastic drugs and
radiation therapy blocking apoptosis of the tumor cells. Bcl-2 can interact
with members of the Bcl-2 family including Bax, Bcl-X-S, Bcl-X-L, and Mcl-1 but
also with heterologous protein molecules including BAG-1, Raf-1, and R-Ras.
Introduction of the bcl-2 gene into human diploid breast epithelial MCF10A cells
(containing the wild-type p53 gene)
resulted in suppression in p21 gene
expression although the level of expression of p53 was not affected; these studies suggested that Bcl-2 may
inhibit the functional activity of p53 protein and might regulate the
commitment of cells to commit suicide or proliferate (Upadhyay et al, 1995).
Overexpression of the bcl-2 gene in tumors is thought to be responsible for the poor
response of the tumors to antineoplastic drugs and radiation therapy blocking
apoptosis of the tumor cells; therefore, down-regulation of the bcl-2 gene specifically in tumor cells
could induce apoptosis. Primary untreated human prostate cancers were found to
express significant levels of this apoptosis-suppressing oncoprotein; this is a
striking difference with normal prostate secretory epithelial tissue not
expressing Bcl-2 (Raffo et al, 1995). Transfection of LNCaP human prostate
cancer cells with a plasmid expressing bcl-2
rendered these cells highly resistant to a variety of apoptotic stimuli (serum
starvation or treatment with phorbol ester) and induced earlier and larger
tumors in nude mice. The ability of Bcl-2 to protect prostate cancer cells from
apoptotic stimuli correlated with the ability of the cells to form
hormone-refractory prostate tumors in nude mice (Raffo et al, 1995).
The Bcl-2 oncoprotein suppresses apoptosis and, when
overexpressed in prostate cancer cells, makes these cells resistant to a
variety of therapeutic agents, including hormonal ablation. Overexpression of
BCL-2 is common in non-Hodgkin lymphoma leading to resistance to apoptosis and
promoting tumorigenesis. Therefore, bcl-2 provides a strategic target for the
development of gene knockout therapies to treat human prostate cancers (Dorai
et al, 1997) and non-Hodgkin lymphomas (Webb et al, 1997).
Down-regulation of Bcl-2 can be accomplished with
antisense. In patients with relapsing non-Hodgkin lymphoma, BCL-2 antisense
therapy led to an improvement in symptoms; antisense oligonucleotides targeted
at the open reading frame of the BCL-2 mRNA showed effectiveness against
lymphoma grown in laboratory animals and has entered human clinical trials. The
first study was conducted on nine patients with BCL-2-positive relapsed
non-Hodgkin lymphoma using a daily subcutaneous infusion of 18-base, fully
phosporothioated antisense oligonucleotide administered for 2 weeks (Webb et
al, 1997). A local inflammation at the infusion site was noted. A reduction in
tumour size was observed in two patients (one minor, one complete response)
using computed tomography scans; in two other patients, the number of
circulating lymphoma cells decreased during treatment. In four patients, serum
concentrations of lactate dehydrogenase fell, and in two of these patients symptoms
improved (Webb et al, 1997).
A divalent hammerhead ribozyme, constructed by
recombining two catalytic RNA domains into an antisense segment of the coding
region for human bcl-2 mRNA was able to rapidly degrade bcl-2 mRNA in vitro; it
was then tested for its ability to eliminate bcl-2 expression from
hormone-refractory prostate cancer cells. When this hammerhead ribozyme was
directly transfected into cultured prostate cancer cells (LNCaP derivatives),
it significantly reduced bcl-2 mRNA and protein levels within 18 hr of
treatment and induced apoptosis in a low-bcl-2-expressing variant of LNCaP, but
not in a high-bcl-2-expressing LNCaP line (Dorai et al, 1997).
B. Bcl-xs
Many cancers overexpress a member of the Bcl-2 family
of inhibitors of apoptosis, such as Bcl-2 and Bcl-xL. Members of the Bcl-2
family were found to be essential for survival of cancer cells derived from
solid tissues including breast, colon, stomach, and neuroblasts (Clarke et al,
1995). On the contrary, Bcl-xs is a dominant negative repressor of Bcl-2 and
Bcl-xL; thus, Bcl-xs induces apoptosis. Transient overexpression of Bcl-xs in
MCF-7 human breast cancer cells, which overexpress Bcl-xL, with a
replication-deficient adenoviral vector induced apoptosis in vitro;
intratumoral injection of the bcl-xs adenovirus on solid MCF-7 tumors in nude
mice showed a 50% reduction in size with evident apoptotic cells at sites of
injection (Ealovega et al, 1996).
An adenovirus vector expressing bcl-xs specifically
and efficiently killed carcinoma cells arising from multiple organs including
breast, colon, stomach, and neuroblasts even in the absence of an exogenous
apoptotic signal such as x-irradiation. In contrast, normal hematopoietic
progenitor cells and primitive cells capable of repopulating SCID mice were not
killed by the bcl-xs adenovirus. Thus, transfer of the bcl-xs gene could be
used in killing cancer cells contaminating the bone marrow of patients
undergoing autologous bone marrow transplantation (Clarke et al, 1995).
C. E2F-1 and TNF-a gene transfer
E2F cooperates with p53 to induce apoptosis; high
levels of wild-type p53 potentiate E2F-induced apoptosis in fibroblasts. The
physiological relevance of E2F in the apoptotic mechanism is thought to arise
from the ability of E2F to act as a functional link between p53 and RB; p53
levels increased in response to high levels of E2F. Targeted disruption of the
E2F-1 gene yields transgenic animals with an excess of mature T cells due to a
defect in lymphocyte apoptosis (Field et al, 1996).
Overexpression of the transcription factor E2F-1
could induce apoptosis in quiescent rat embryo fibroblasts in a p53-dependent
manner; however, Hunt et al (1997)
have shown that overexpression of the E2F-1 gene after adenoviral transfer can
mediate apoptosis in the absence of wild-type p53: adenovirus-mediated transfer
of the E2F-1 gene under control of the CMV promoter to human breast and ovarian
carcinoma cell lines resulted in the induction of significant morphological
changes in four of the five cell lines that had mutations in the p53 gene
within 48 h of transduction characteristic of apoptosis.
Retroviral vector-mediated transfer of the TNF-a gene into the DNA of human tumor cells induced
apoptosis in high- TNF-a-producing clones generated from a human lymphoma
T-cell line (ST4); the apoptotic death of the cells was associated with a
downregulation of the apoptosis-preventing gene, bcl-2, while the expression of
bax and p53 genes persisted (Gillio et al, 1996).
D. E6, E7 of human papillomavirus (HPV)
E6 and E7 of HPV possess transforming ability, have
been shown to interact with the cellular tumor suppressors p53 and RB (Werness
et al, 1990; Dyson et al., 1989) and are believed to play a central role in
HPV-induction of cervical carcinogenesis as well as in the maintenance of the
malignant phenotype. Viruses have developed strategies to shut down protein
synthesis in the host and subdue its protein synthesizing machinery to produce
progeny virus when infecting cells. Because virus-infected cells commit suicide
to protect the organism from further infection viruses have evolved mechanisms
to prevent apoptosis of the host cell ensuring their propagation; E6 protein
interacts with p53 to exclude p53 molecules from their apoptotic functions and
to inhibit apoptosis in HPV-infected cells thus giving to HPV a proliferation
advantage.
27-mer phosphorothioate oligodeoxynucleotides
(oligos) targeting the ATG translational start region of HPV-16 E6 and E7
sequences showed antiproliferative effects in all HPV-16-positive cell lines
tested and in primary cervical tumor explants while the endometrial and two
ovarian primary tumors as well as the HPV-negative C33-A cell line and
HPV-18-positive cell line HeLa were relatively insensitive to the HPV-16 oligos
(Madrigal et al, 1997).
E. Prevention of apoptosis for gene therapy of heart
disease and for ex vivo manipulations of therapeutic cells
As induction of apoptosis is the desired effect for
the gene therapy of cancer, prevention of apoptosis by gene therapy can fight
heart disease. Cardiomyocyte death results from heart ischemia proceeding via
necrosis and from reperfusion which induces additional cardiomyocyte death by
apoptosis; prevention of apoptosis would constitute an important target for
fighting heart disease. Prevention of apoptosis should also solve a major
problem in cell culture cells which are subject to oxidation damage during
their manipulation for ex vivo gene
transfer and most important during the step of reimplantation, encapsulation in
biopolymer membranes for surgical implantation, and similar processes.
Prevention of apoptosis could be effected by transfer and overexpression of the
bcl-2 gene. Also prevention of
oxidative damage during reimplantation of ex
vivo-modified cells could be reduced by transfer and overexpression of the
Cu/Zn superoxide dismutase gene (Nakao et al, 1995).
Overexpression of bcl-2 delayed onset of motor neuron
disease and prolonged survival in a transgenic mouse model of familial
amyotrophic lateral sclerosis (Kostic et al, 1997).
XXII. E1A and HER-2/neu (c-erbB-2) in cancer gene
therapy
A. HER-2/neu
The human epidermal growth factor receptor-2 (HER2),
a membrane tyrosine kinase highly expressed in many epithelial tumors, could be
a target for cancer gene therapy.
The HER-2/neu (also called c-erbB-2) proto-oncogene is overexpressed in
many human cancer cells, including those of breast cancer and ovarian cancer
correlating with lower survival rate in ovarian cancer patients; amplification
or overexpression of HER-2/neu has also been observed in human lung cancer and
has been correlated with poor prognosis and chemoresistance.
A reversible transformation of NIH3T3 fibroblasts by
overexpression of the HER2/c-erbB2 receptor tyrosine kinase under control of a
tetracycline-responsive promoter has been demonstrated in tissue culture;
induction of HER2 expression resulted in cellular transformation in vitro and
treatment of transformed cells with the effector anhydrotetracyline
switched-off HER2 expression and induced morphological and functional changes
characteristic for non-transformed cells (Baasner et al, 1996).
B. E1A-based gene therapy
E1A-based gene therapy approaches are now in clinical
trials (see below); the molecular mechanism behind this approach is that the
E1A protein of Adenovirus 5 represses HER-2/neu transcription and functions as
a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. Breast cancer
cells that overexpress HER-2/neu are more resistant to chemotherapeutic agents
such as paclitaxel (Taxol) and docetaxel (Taxotere) than those that do not
overexpress HER-2/neu; paclitaxel sensitivity correlated with HER-2/neu
expression level in a panel of mouse fibroblasts expressing different levels of
HER-2/neu; downregulation of HER-2/neu expression by E1A sensitized the cells
to paclitaxel. Transfer the E1A gene into two human breast cancer cell lines
that overexpress HER-2/neu and E1A gene transfer sensitized these cells to the
drug by repressing HER-2/neu expression (Ueno NT et al, 1997).
Increased HER-2/neu expression led to more severe
ovarian malignancy and increased metastatic potential in animal models; the
adenovirus 5 E1A gene repressed HER-2/neu gene expression and suppressed growth
of human ovarian cancer SKOV-3 cells, which overexpress HER-2/neu, in cell
culture (Yu et al, 1995). Intraperitoneal injection of SKOV-3 cells into female
nu/nu mice elicited tumors and the animals died within 160 days of severe tumor
symptoms; cationic liposome-mediated delivery of the E1A gene into
adenocarcinomas that developed in the peritoneal cavity and on the mesentery of
the mice significantly inhibited growth and dissemination of ovarian cancer
cells; about 70% of the treated mice survived at least for 365 days (Yu et al,
1995).
Regulatory regions derived from the 5' flank of the
human prostate-specific antigen (PSA) gene were inserted into adenovirus type 5
DNA to drive the expression of the E1A gene; infection of cells in culture with
this recombinant adenovirus was able to drive the expression of the E1A gene
only in cell lines which expressed PSA such as the human LNCaP cells but not in
human DU145 cells which do not express PSA; the recombinant adenovirus
destroyed large LNCaP tumors (1x109 cells) and abolished PSA production in
nu/nu mouse xenograft models after a single intratumoral injection (Rodriguez
et al, 1997).
A replication-deficient adenovirus containing the E1A
gene, Ad.E1A+,
was used to transduce E1A into HER-2/neu-overexpressing and low expressing
human lung cancer cell lines and shown a better therapeutic efficacy in
HER-2/neu-overexpressing cells. The cell culture studies were then extended to
animal studies: tumor-bearing mice established by intratracheal injection of
lung cancer cells overexpressing HER-2/neu and treated by i.v. tail injections
of Ad.E1A+ showed suppression of the intratracheal
lung cancer growth. However, no significant tumor suppression effect was
observed in mice bearing a low HER-2/neu-expressing cell line
with the same regimen (Chang et al, 1996).
C. Clinical trials with E1A and c-Erb-B2
Liposome-mediated E1A gene transfer suppressed tumor
development and prolonged survival of mice bearing human breast cancer cells
overexpressing HER-2/neu. These studies resulted in the initiation of a phase I
clinical trial using an E1A-liposome complex administered to patients with
HER-2/neu-overexpressing breast or ovarian cancer (Protocol 205 in Table 4 of following article, pages
203-206). The principal investigators are Drs. Hortobagyi, Lopez-Berstein, and
Hung at MD Anderson Cancer Center, Houston, Texas). The safety of this regimen
was shown by intraperitoneal injection of E1A/liposomes in normal mice and at
cumulative doses 5 to 40 times the DNA-lipid starting dose proposed for the
phase I clinical trial (Xing et al, 1997). A Phase I multicenter study of
intratumoral E1A gene therapy using cationic liposome gene transfer is also in
course for patients with unresectable or metastatic solid tumors that
overexpress HER-2 /neu (protocol 209, see page 205).
Delivery of an anti-erbB-2 single chain (sFv)
antibody gene for previously treated ovarian and extraovarian cancer patients
is in clinical trials using adenoviral gene delivery (protocol #133). A
clinical trial for tumor vaccination with HER-2
/Neu using a B7 expressing tumor cell line prior to treatment with HSV-tk
gene-modified cells is in phase I for ovarian cancer (protocol #96, page 165).
XXIII. Suicidal genes for cancer therapy (prodrug
gene therapy)
A. Molecular mechanism of cell killing with HSV-tk
gene and ganciclovir (GCV)
Expression of genes encoding prodrug-activating
enzymes can increase the susceptibility of tumor cells to prodrugs, and may
ultimately achieve a better therapeutic index than conventional chemotherapy (Table 3). Direct suppression of tumor
growth by cytotoxic gene therapy is a successful gene transfer approach. This
approach has promise for a variety of other applications where excess cell
proliferation is detrimental and has also been used to restrict intimal
hyperplasia of the arterial wall and smooth muscle cell growth to limit
restenosis after artery angioplasty (see below).
Cancer cells can be induced to be conditionally
sensitive to the antiviral drug ganciclovir after their transduction with the
thymidine kinase (tk) gene from the
herpes simplex virus (HSV); ganciclovir (GCV) is the
9-{[2-hydroxy-1-(hydroxymethyl)-ethoxy]methyl}guanine (Field et al, 1983); it
is converted by HSV-tk into its
monophosphate form which is then converted into its triphosphate form by
cellular enzymes and is then incorporated into the DNA of replicating mammalian
cells leading to inhibition in DNA replication and cell death (Moolten, 1986;
Borrelli et al, 1988; Moolten and Wells, 1990). It is only viral TK, not the
mammalian enzyme, that can use efficiently ganciclovir as a substrate and this
drug has been synthesized to selectively inhibit herpes virus replication
(Field et al, 1983); indeed, the mammalian TK has a very low affinity for this
guanosine analog. The toxicity of ganciclovir is manifested only when cells
undergo DNA replication and it is not harmful to normal nondividing cells. This
treatment strategy has been used for hepatocellular carcinoma (Huber et al,
1991; Su et al, 1996), fibrosarcoma, glioma (Culver et al, 1992, see below),
adenocarcinoma (Osaki et al, 1994), prostate cancer (Eastham et al, 1996) and
many other cancers.
B. Treatment gliomas in rats with HSV-tk plus ganciclovir
Brain tumors have the privilege of escaping
immunologic rejection; therefore brain tumors are inaccessible to cancer
immunotherapy. Culver and cowor-
Table 3. Prodrugs and enzymes used for
their activation
|
Prodrug-activating enzyme |
Prodrug |
Toxic substance it is converted to |
|
Thymidine
kinase from HSV |
9-{[2-hydroxy-1-(hydroxymethyl)-ethoxy]methyl}guanine
or ganciclovir (GCV) |
GCV
monophosphate |
|
Cytosine
deaminase (CD) from E. coli |
5-fluorocytosine
(5FC) |
5-fluorouracil
(5FU) |
|
Purine
nucleoside phosphorylase (PNP) from E.
coli |
6-methylpurine-2Õ-deoxyriboside
(MeP-dR) |
6-methylpurine
(a very toxic adenine analog) |
|
Purine
nucleoside phosphorylase (PNP) from E.
coli |
Arabinofuranosyl-2-fluoroadenine
monophosphate (F-araAMP) commercially known as fludarabine |
A very
toxic adenine analog |
|
Human
deoxycytidine kinase (dCK) |
Cytosine
arabinoside (ara-C) |
A toxic
drug inducing lethal strand breaks in DNA |
|
Nitroreductase
from E. coli |
5-(aziridin-1-yl)-2,4-dinitrobenzamide
(CB1954) |
A potent
dysfunctional alkylating agent which crosslinks DNA |
kers
(1992) took advantage of the fact that retroviral vectors require DNA synthesis
for stable integration into the host genome to target gliomas in rats. Murine
fibroblasts were transduced with a retroviral vector expressing the HSV-tk gene (see above); the tumor cell mass
was then infiltrated by intratumoral injection of the HSV-tk-producing fibroblasts. This treatment gave a
continuous local infusion of retroviral vector from the injected fibroblasts,
integrating into the dividing cells of the growing brain tumor but not into the
nondividing normal cells in the surroundings. Treatment of rats at day 5 after
transplantation with ganciclovir (GCV) resulted in the complete regression of
the tumor cell mass; this was thought to be induced by killing of cells that
respond to signals promoting angiogenesis in the immediate vicinity of the
tumor; vascular endothelial cells in the normal brain tissue, exhibiting
cycling at a low rate, apparently were not affected. Other proliferating
tissues, such as intestinal epithelium, thymus, and bone marrow, which might
also uptake the retroviral HSV-tk vector
and then be destroyed during GCV treatment were not affected by this approach
over a 30 day period of treatment with GCV (Culver et al, 1992).
A replication-defective, highly purified retroviral
vector at titers of 108 colony forming units/mL was used to treat 9L
gliosarcoma cells in rat brain. Animals with established 9L tumors treated with
intralesional injection of the HSV-tk retrovirus
followed by GCV treatment showed at day 26 that 29% (4/14) had no tumor and 50%
(7/14) of the animals had < 1% tumor volume; substantial numbers of CD4+ and CD8+ lymphocytes infiltrated the tumors of animals treated with
HSV-tk and GCV; the former tumor bed
in cured animals contained cell debris, immune cells, and fibroblasts without
signs of damage to the adjacent brain tissue (Kruse et al, 1997).
C. The bystander effect of HSV-tk/GCV
During HSV-tk/GCV treatment of brain tumors products
from the dying cells in the brain tumor killed nearby non-HSVtk-transduced
cancer cells without affecting normal cells, an effect described as
"bystander" antitumor effect (Culver et al, 1992). The bystander
effect of the HSV-tk plus GCV system
appears to be powerful and significant, circumventing the low efficiency of
transduction in vivo with recombinant
retroviruses. Because of this effect, the low-level percentage of cells that
can be transduced with a retrovirus can cause the elimination of a much larger
percentage of proliferating cells in their surroundings (Kimura et al, 1996).
In vitro, the ÒbystanderÓ effect works by transfer of
cytotoxic small molecules between cells via gap junctions. In order to
understand the Òbystander effectÓ mechanism during which adjacent nontransduced
tumor cells are killed, Yamamoto et al (1997) used Renca cells from a renal
carcinoma cell line transduced with a retroviral vector bearing the HSV-tk gene to inoculate BALB/c mice. After
complete regression of inoculated tumors with GCV treatment, the animals were
challenged with nontransduced tumor cells. In these animals, tumor-specific
cytotoxic CD8+ T cells were
efficiently induced which promoted the rejection or significant growth
inhibition of challenged tumor cells.
In a similar experiment, set to assess the Òbystander
effectÓ in vivo, mixtures of HSV-tk-transduced and nontransduced oral squamous carcinoma
cells were implanted subcutaneously in the left flank of nude mice, and naive
HSV tk- cells were implanted subcutaneously in the right
flank. Treatment with GCV eradicated the tumors in the left flank consistent
with a predicted bystander effect but also resolved or arrested the growth of
the naive tumors in the right flank. The histology of regressing tumors from
the right flank showed an infiltration of lymphoid cells suggesting that an
immune-related antitumor response accounted for the distant bystander effect
(Bi et al, 1997; see also Ramesh et al, 1998 this volume).
The induction of higher levels of HSV-tk expression does not augment the
sensitivity to GCV: adenoviral vectors that expressed HSV-tk at different
efficiencies from CMV versus RSV promoters did not display a significant
difference in antitumor effects; thus, increasing the HSV-TK enzyme levels per
cell above a minimal threshold level will not be effective in cell killing with
GCV. To enhance the therapeutic responses of the HSV-tk/GCV system one needs to
improve other parameters such as to use higher doses of GCV, to enhance the
"bystander effect," to engineer mutant HSV-tk genes with higher
substrate affinities, or to discover vectors with increased transduction
efficiencies (Elshami et al, 1997).
Suicide gene therapy may be useful not only for
short-term tumor regression mediated by direct cell killing and bystander
effect, but may also exert a therapeutic vaccination effect resulting in
long-term tumor regression and prevention of recurrence (Yamamoto et al, 1997).
D. Additional examples of tumor eradication with
HSV-tk/GCV
Chen et al (1996) used a recombinant adenoviral
vector containing the HSV-tk gene for the treatment of metastatic colon
carcinoma in the mouse liver; the HSV-tk alone exhibited substantial
regression, although all treated animals suffered from subsequent relapses.
Delivery of the HSV-tk + mouse IL-2 genes in adenoviral vectors to the hepatic
tumors induced an effective antitumor immune response which nevertheless waned
with time, and the treated animals eventually succumbed to hepatic tumor
relapse; however, after combination treatment with HSV-tk, mouse IL-2, and
mouse GM-CSF a fraction of the animals developed long-term antitumor immunity
and survived for more than 4 months without tumor recurrence (Chen et al,
1996).
Microinjection of the HSV-tk gene, under control of a-fetoprotein enhancer and albumin promoter, in a
linear form flanked by the adeno-associated virus ITRs into pronuclei of mouse
embryos led to transgenic animals expressing preferentially HSV-tk into adult liver cells; this led to
an approach for the treatment of hepatocellular carcinomas (Su et al, 1996).
Subcutaneous tumors induced by injection of RM-1 (mouse prostate cancer) cells
in mice followed by injection of HSV tk in
an adenovirus vector and treatment with ganciclovir for 6 days showed reduction
in tumor volume (16% of control) and higher apoptotic index in tumor cells
(Eastham et al, 1996). Recombinant adenoviruses carrying the HSV-tk gene under
control of the CMV promoter displayed a significant cell killing efficiency for
the eradication of brain tumors and leptomeningeal metastases in rats (Vincent
et al, 1997).
Pancreatic cancer is the fifth leading cause of
cancer death in the United States. In order to treat peritoneal dissemination,
one of the most common complications of the malignancies of the digestive
system such as gastric or pancreatic cancers, mice were intraperitoneally
(i.p.) inoculated with the human pancreatic cancer cell line PSN-1; i.p.
transfer of the HSV-tk suicidal gene under control of the potent hybrid CAG
promoter was achieved with a DNA-lipopolyamine complex given eight days from
the injection of cancer cells; animals were treated with GCV for 8 days; 8 out
of 14 mice treated with HSV-tk and
GCV were free of tumors on day 24. The gene transfer method resulted in the
transduction of tumor nodule cells and not in normal organs as shown by reverse
transcription polymerase chain reaction (RT-PCR) analysis as well as by
transfer of the lacZ gene under similar conditions and localization of the blue
staining; HSV-tk was expressed in about 10% of tumor cells but not in the
normal pancreas or in the small intestine (Aoki et al, 1997).
A murine pancreatic ductal adenocarcinoma cell line
was used to induce intrahepatic solid tumors into the left lateral liver lobe;
intratumoral injection of an adenovirus vector carrying the HSV-tk gene under
control of the RSV promoter in combination with intraperitoneal administra-tion
of ganciclovir caused a significant reduction in tumor volume and necrosis;
because pancreatic cancer patients have an overall low survival since
metastases have already taken place at the time of diagnosis and because
surgical resection of pancreatic cancers does not significantly change the
clinical outcome even in combination with chemotherapy, gene therapy might
offer an effective approach in the near future (Block et al, 1997).
HSV-tk gene transfer was successfully used to
eradicate adenocarcinoma-derived peritoneal carcinomatosis, a common clinical
situation which, in most cases cannot be controlled by surgery or chemotherapy.
DHD/K12 colon carcinoma cells stably expressing the HSV-tk gene were injected intraperitoneally to rats leading to the
development of peritoneal carcinomatosis within 2-3 weeks from injection (Figure 25A). Treatment of these animals
with GCV (Figure 25C) resulted in
the eradication of the peritoneal tumor nodes. It ought to be emphasized,
however, that the same spectacular results are not expected when treating
tumors in patients; tumor cells in patients need first to be transduced with
the HSV-tk gene whereas the cells
used to elicit these tumors in animals were already transduced with the HSV-tk gene in cell culture and most or all
cells were expressing the viral thymidine kinase.
Retrovirus-mediated transfer of HSV-tk was used to kill proliferating cells
in rabbit models of proliferative
vitreoretinopathy (PVR); traction retinal detachment results from
proliferation of retinal pigment epithelial, glial, macrophages, and fibroblast
cells in the vitreous cavity of the eye forming contractile membranes on both
surfaces of the retina; PVR may ensue after retinal surgery or trauma and can
be induced in rabbit models by surgical vitrectomy to facilitate cell
attachment to the retina. Injection, into the vitreous cavity, of rabbit dermal
fibroblasts transduced in vitro with
retroviral vectors carrying the HSV-tk
gene was used to preferentially kill
proliferating cells for PVR in rabbit models; all eyes received 0.2 mg GCV on
the following day and on day 4; significant inhibition of PVR was observed thus
providing a novel therapeutic strategy for this disease (Kimura et al, 1996).
E. Expression of cytosine deaminase (CD) gene from E. coli and treatment with
5-fluorocytosine
Another suicide gene approach has been the expression
of the cytosine deaminase (CD) from E.
coli; mammalian cells, unlike certain bacteria and fungi, do not posses
this enzyme. The CD protein normally catalyzes the conversion of cytosine to
uracil but has been exploited for the conversion of the prodrug
5-fluorocytosine (5FC) into the toxic 5-fluorouracil (5FU); treatment of cells,
transfected with this construct, with 5FC resulted in the conversion of the 5FC
into the antitumor drug 5FU into CD-expressing tumor cells (Mullen et al, 1992;
Austin and Huber, 1993; Huber et al, 1993; 1994; Richards et al, 1995).
This approach has been used for the treatment of
primary and metastatic hepatic tumors based on the overexpression of the
suicidal CD gene under control of the
regulatory regions of the tumor marker gene carcinoembryonic antigen (Richards
et al, 1995, see below).
Szary et al (1997) have developed a model for tumor
radiosensitization using the CD gene/5FC system; when melanoma cells were
transfected with the CD gene, subsequent treatment with 5FC sensitized the
cells to radiation damage; 5FC did not change the radiosensitivity of parental,
nontransfected cells; increased toxicity to radiation damage was thought to
arise from 5-fluorouracil generated by CD.
Figure 25. Eradication of peritoneal
carcinomatosis with HSV-tk plus GCV. Intraperitoneal injection to rats of
DHD/K12 colon carcinoma cells stably expressing the HSV-tk gene caused peritoneal carcinomatosis at day 21 (A). The animal whose intraperitoneal
cavity is shown in (B) was treated
with HBSS buffer alone and the animal shown in (C) was treated with GCV for 5 days at 150mg/Kg. The letter ÒTÓ
indicates the peritoneal tumor nodes. From Lechanteur C, Princen F, Bue SL,
Detroz B, Fillet G, Gielen J, Bours V, and Merville M-P (1997) HSV-1 thymidine
kinase gene therapy for colorectal adenocarcinoma-derived peritoneal
carcinomatosis. Gene Ther 4,
1189-1194. Reproduced with the kind permission of the authors (Vincent Bours,
University of Lige, Belgium) and of Stockton Press.
Infection of the human breast cancer cell line,
MDA-MB-231, with a recombinant adenovirus expressing the Escherichia coli CD resulted in high levels of cytosine deaminase
enzyme activity and infected cells became 1000-fold more sensitive to 5-FC than
cells infected with a control adenovirus; only 10% of infected cells in a
population were needed to induce complete cytotoxicity of noninfectious cells
exposed to 5-FC via bystander effects. Direct injection of the CD-adenovirus
into human breast tumor xenografts in nude mice, followed by daily
intraperitoneal injection of 5-FC was sufficient to inhibit tumor growth (Li et
al, 1997).
F. Bacterial purine nucleoside phosphorylase (PNP)
gene
Another suicide gene/prodrug couple is the E. coli DeoD gene which encodes the
purine nucleoside phosphorylase (PNP). The E.
coli PNP, unlike the mammalian endogenous PNP, can utilize certain
adenosine analogs as substrates including nontoxic purine nucleosides
converting them to very toxic adenine analogs; these substrates include
6-methylpurine-2Õ-deoxyriboside (MeP-dR) and arabinofuranosyl-2-fluoroadenine
monopho-sphate (F-araAMP) commercially known as fludarabine. This enzyme
converts the 6-methylpurine deoxyribose (MeP-dR) prodrug into the diffusible,
toxic 6-methylpurine and can become a powerful suicide gene under these
conditions (Sorscher et al, 1994).
The significant advantages in eradicating
experi-mentally-induced human tumors in nude mice with this system were: (i) the bystander effect was 2-3 orders of
magnitude higher than with HSV-tk/GCV and tumor eradication could be seen only
after 3 doses of PNP/MeP-dR treatment, (ii)
the MeP-dR and F-araAMP crossed readily the cell membrane unlike GCV, and (iii) PNP/MeP-dR could kill both proliferating
and nonproliferating tumor cells as has been demonstrated by eradication of the
slowly-growing D54MG glioma tumors expressing the bacterial PNP gene in nude
mice after treatment with MeP-dR (Figure
26; Parker et al, 1997).
G. Deoxycytidine kinase/ara-C and
nitroreductase/5-(aziridin-1-yl)-2,4-dinitrobenzamide
The human deoxycytidine kinase (dCK) can
phosphorylate the prodrug cytosine arabinoside (ara-C), a cytidine analog, and
catalyze its conversion into a toxic drug inducing lethal strand breaks in DNA.
Although ara-C is a potent antitumor agent for hematologic malignancies it is
ineffective against solid tumors; transduction of the dCK cDNA with adenovirus and retrovirus into the 9L gliosarcoma
cell line followed by establishing intradermal and intracerebral gliomas in
syngeneic rats demonstrated the efficacy of systemic ara-C treatment of the
animals in eradicating these tumors (Manome et al, 1996).
The
prodrug 5-(aziridin-1-yl)-2,4-dinitrobenzamide (CB-1954) is a weak,
monofunctional alkylating agent which can be activated by Escherichia coli nitroreductase to a potent dysfunctional
alkylating agent which crosslinks DNA. Transduction of colorectal and
pancreatic cancer cell lines with the nitroreductase gene using a retroviral
vector rendered them 50 to 500-fold more sensitive than parental cells to
CB1954; concentrations of CB1954 which were minimally toxic to nontransduced
cells achieved 100% cell death in a 50:50 mix of parental cells with transduced
cells expressing nitroreductase due to "bystander" cell killing
(Green et al, 1997).
H. Preferential expression of suicidal genes in
cancer cells using promoters/ enhancers from tumor-specific genes
The principle of VDEPT (virus-directed enzyme
/prodrug therapy) was used to target hepatocellular carcinoma using the
regulatory region from the tumor-specific a-fetoprotein gene to
drive the Varicella zoster thymidine kinases gene (Huber et al, 1991).
A similar gene therapy approach has been developed
for the treatment of primary and metastatic hepatic tumors based on the
overexpression of the suicidal gene cytosine deaminase (CD) from E. coli under
control of the regulatory regions of the tumor marker gene carcinoembryonic
antigen (CEA) (Richards et al, 1995);
this created a chimeric gene that was specifically expressed in neoplastic
cells. Development of this strategy has necessitated the identification of the
regulatory regions of
Figure 26. A nude mouse xenograft model was
developed bearing malignant gliomas by s.c. injection of D54MG human cells or
D54MG human cells transduced and expressing E.
coli PNP which are called D54-PNP cells; tumors were successfully
eradicated with MeP-dR treatment. Representative animals from each of 4 groups
at completion of the study (62 days) are shown: Group 1: nude mice were injected with D54MG cells, vehicle treated.
Group 2: nude mice were injected
with D54MG cells, MeP-dR treated. Group
3: nude mice were injected with D54-PNP cells, vehicle treated. Group 4: nude mice were injected with
D54-PNP cells, MeP-dR treated. From Parker WB, King SA, Allan PW, Bennett LLJr,
Secrist JAIII, Montgomery JA, Gilbert KS, Waud WR, Wells AH, Gillespie GY, and
Sorscher EJ (1997) In vivo gene therapy of cancer with E. coli purine nucleoside phosphorylase.
Hum Gene Ther 8, 1637-1644. With the
kind permission from the corresponding author (Eric Sorscher, University of
Alabama at Birmingham) and Mary Ann Liebert, Inc.
the
CEA gene; isolation of 14.5 kb of 5'
flanking sequences for this gene followed by subcloning into luciferase pGL2
basic vectors and testing for luciferase activity in transfected LoVo, SW1463,
Hep3B, and HuH7 cell lines (the first two express CEA whereas the other two do not) has identified the CEA promoter between bases -90 and +69,
and two enhancers one at -13.6 to -10.7 and the other at -6.1 to -4.0 kb
(Richards et al, 1995); these sequences were able to sustain high levels of
expression of the CD gene into CEA-expressing cell lines.
Regulatory sequences from the CEA gene (-322 to +111 bp) were also used to express the HSV
thymidine kinase gene in pancreatic and lung neoplasms (Dimaio et al, 1994;
Osaki et al, 1994).
XXIV. Transfer of drug resistance genes
A. Principles and genes used
An attractive approach to circumvent
chemotherapy-induced myelosuppression is the use of gene-transfer technology to
introduce new genetic material into hematopoietic cells. Protection of bone
marrow progenitor cells by introduction of a drug resistance gene allows larger
and curative doses of chemotherapy to be administered to the patient as was
shown in several pre-clinical studies. Drug resistance genes under experimental
consideration are shown on Table 4.
Clinical trials are now under way to evaluate the potential use of two gene
sequences: MDR1 (protocols #43, 44, 59, 89, and 100) and O6-methylguanine
DNA methyltransferase (#101 see Appendix
1) (see also Lee et al, 1998, this volume).
Dose-limiting hematopoietic toxicity produced by the
cytosine nucleoside analogue cytosine arabinoside (Ara-C) is one of the major
factors that limit its use in the treatment of neoplastic diseases. Deamination
of Ara-C by cytidine deaminase results in a loss of its antineoplastic
activity. Transfer of human cytidine deaminase into murine fibroblast and
hematopoietic cells conferred drug resistance to Ara-C protecting them from
drug toxicity (Momparler et al, 1996). It is worth mentioning that
apolipoprotein B mRNA editing involves the deamination of cytidine by the
cytidine deaminase catalytic subunit that creates a new termination codon and
produces a truncated version of apo-B (apo-B48); the cytidine deaminase
catalytic subunit (apo-B mRNA-editing enzyme catalytic polypeptide 1) of the
multiprotein editing complex has been identified (Yamanaka et al, 1995).
B. Mechanism of MDR1 resistance
A great deal of our knowledge of basic insights on
drug uptake and molecular mechanisms of drug action were elucidated from the
study of resistance of tumor cells to chemotherapeutic agents. The
P-glycoprotein or p170 encoded by the multidrug resistance MDR1 gene uses the energy of ATP to extrude a variety of drugs
apparently unrelated; the only chemical similarity is that they contain
condensed aromatic rings and have a positive charge at neutral pH; these drugs,
most of which are effective against a variety of human tumors, include
molecules found in nature such as colchicine, doxorubicin (also called
adriamycin, member of the anthracycline family), actinomycin D, vinblastine,
etoposide, taxol, vinca alcaloids, and epipodophyllotoxins collectively called
MDR-type of drugs (reviewed by Gottesman and Pastan, 1988; see Lee et al, 1998
this volume).
Cell lines resistant to drugs accumulate far less
amounts of drug compared with parental cells because of overexpression of the MDR1 gene; development of multidrug
resistance by tumor cells poses a major impediment to successful cancer
chemotherapy. A number of cell lines with multidrug resistance have been
derived like KB and K562 cells (Marie et al, 1991; Fardel et al, 1995). The P-glycoprotein
is a 1280 amino acid molecule in human cells (Chen et al, 1986) or 1276 amino
acid molecule in mouse cells with 80% sequence similarity to the human protein
(Gros et al, 1986). P-glycoprotein has 12 hydrophobic domains grouped into
pairs representing transmembrane domains. The molecule has a 500 amino acid
duplication; each duplicated segment possesses an ATP-binding site on the
cytoplasmic side; it also has several site of glycosylation near the N-terminus
to the exterior side. Its gene is amplified in multidrug resistant
Table 4. Drug resistance gene designs
|
Drug resistance gene |
Confers resistance to |
Reference |
|
MDR1
(multidrug resistance) |
Daunomycin,
doxorubicin, taxol |
Galski et
al, 1989; Podda et al, 1992; Sorrentino et al, 1992 (see below) |
|
Mutant
dihydrofolate reductase |
Methotrexate
(MTX) |
Williams
et al, 1987; Corey et al, 1990; Li et al, 1994; Zhao et al, 1997 |
|
Glutathione
transferase |
DNA
alkylating agents |
reviewed
by Maze et al, 1997 |
|
O6-methyl
guanine transferase |
Nitrosoureas |
Allay et
al, 1995 |
|
Cytidine
deaminase |
Cytosine
arabinoside (Ara-C) |
Momparler
et al, 1996 |
|
Aldehyde
dehydrogenase |
Cyclophosphamide |
reviewed
by Koc et al, 1996 |
cell
lines accompanied by an increased expression of the 4,500 to 5,000-nt in size
mRNA for P-glycoprotein (Chen et al, 1986).
Rates of drug influx for lipid-soluble drugs are
proportional to drug concentrations in the medium; P-glycoprotein alone or in
conjunction with other cellular components seems to transport drugs to the
exterior of the cell, a mechanism pronounced in drug-resistant cell lines.
Consistent with the presence of a membrane-bound, exchangeable pool of drug and
a cytoplasmic, non exchangeable pool, P-glycoprotein was proposed to directly
interact via its hydrophobic transmembrane domains with the membrane-associated
drug molecules (anthracyclins, vinca alcaloids) to mediate their efflux to the
extracellular milieu (Gros et al, 1986). Doxorubicin, an inhibitor of
topoisomerase II which is a major nuclear matrix component, has been shown to
interact with hydrophobic regions in calmodulin; calmodulin is also a nuclear
matrix protein. Photoaffinity-labeled analogs of vinblastine showed direct
binding of this drug to P-glycoprotein (Safa et al, 1986).
Expression of P-glycoprotein is consistently low in
bone marrow cells rendering them particularly sensitive to certain MDR-type of
anticancer drugs; chemotherapy with these drugs largely depletes or wipes off
bone marrow pluripotent stem cells from patients (myelosuppression). One
approach to this problem has been removal and deep-freezing of bone marrow
samples from cancer patients prior to chemotherapy; in a second phase CD34+
cells are isolated from the frozen bone marrow specimen using negative
selection on soybean agglutinin plates followed by a positive selection on
plates coated with anti-CD34+ antibody (Ward et al, 1994) which are
then reimplanted to the patient or are simply injected intravenously and find
their way to the bone marrow where they implant; this is a costly undertaking.
Gene therapy approaches are being aimed at
transferring the MDR1 gene under the
control of a strong promoter/enhancer into bone marrow stem cells; transfected
stem cells, from which all B and T cells are derived, would be rendered
resistant to chemotherapeutic drugs used to treat cancer patients and allow
administration of higher doses of these drugs. Furthermore, even if a small
percentage of cells are successfully transfected, these cells could be expanded
by selection with MDR-drug. The same approach could be used to express a nonselectable
gene such as the b-globin gene to treat sickle cell anemias and
thalassemias inserted in the same construct with the MDR1 gene as has been suggested by Ward and coworkers (1994).
C. Transfer of the MDR1 gene into bone marrow cells
The purpose of this approach is to overexpress the MDR1 gene in bone marrow cells in ex vivo or in vivo protocols in order to render stem cells resistant to cancer
chemotherapy; this will prevent destruction of the bone marrow stem cells
during treatment of cancer patients with antineoplastic drugs for killing tumor
cells. Transfer of the MDR1 cDNA into primary human hematopoietic progenitor
cells of cancer patients undergoing high-dose chemotherapy will protect the
bone marrow from the dose-limiting cytotoxicity of cytostatic agents.
Transgenic mice expressing the human MDR cDNA in their bone marrow cells were
resistant to doxorubicin (Galski et al, 1989; Mickisch et al, 1991). Retroviral
transfer of MDR1 resulted in high
level expression of both RNA and P-glycoprotein; taxol-treatment of mouse bone
marrow cells killed those that had not been transfected and resulted in an
enrichment of the cells containing the human gene (Sorrentino et al, 1992;
Podda et al, 1992). Transfer of the MDR1 gene via a retrovirus into human CD34+
cells, isolated from bone marrow and stimulated with IL-3, IL-6, and stem cell
factor, showed that 20-70% of the CFU-GM or BFU-E cells contained the
transferred MDR1 gene by PCR analysis
(Ward et al, 1994).
AAV and cationic liposomes have been used for the
transfer of the human MDR1 cDNA to NIH-3T3 cells followed by selection of
successfully transfected cells based on the drug-resistant phenotype conferred
by the P-glycoprotein efflux pump; a single intravenous injection of the
bicistronic vector complexed to cationic liposomes into recipient mice,
achieved delivery of MDR1 and human
glucocerebrosidase cDNAs in all the organs tested (Baudard et al, 1996).
Eckert et al (1996) have designed novel retroviral
vectors termed SF-MDR and MP-MDR which significantly elevated survival of
transduced primary human hematopoietic progenitor cells under moderate doses of
colchicine and paclitaxel in vitro when compared with a conventional
MoMuLV-based vector; the novel vectors were based on the spleen focus-forming
virus or the myeloproliferative sarcoma virus for the enhancer DNA sequence and
the murine embryonic stem cell virus for the leader.
A bicistronic retroviral vector (HaMID) containing a
modified human MDR-1 cDNA and a mutant human dihydrofolate reductase cDNA bearing
a leucine to tyrosine substitution at codon 22 was constructed and used to
transduce the human CEM T lymphoblastic cell line as well as primary murine
myeloid progenitors; HaMID-transduced cells were highly resistant in the
presence of 25 nM taxol and 100 nM trimetrexate simultaneously while control
cells were entirely growth inhibited (Figures
27, 28; Galipeau et al, 1997).
Several
human clinical trials, approved by RAC and FDA, are under way with the
long-term goal of transferring the MDR1
gene into bone marrow cells of advanced cancer patients using retroviral
infection. A human gene therapy protocol (#100) for chemoprotection of patients
treated for testicular cancer with high doses of carboplatin and etoposide
proposes to use transplantation of these patients with autologous peripheral
blood stem cells (drawn, purified and cryopreserved prior to chemotherapy
treatment) and transduced with the MDR1
Figure 27. Structure of the retroviral
vectors used to deliver the MDR1 and DHFR genes. The vectors are based on the
Harvey murine sarcoma virus. A single transcript (arrow) is initiated in the
retroviral 5Õ LTR promoter. HaMDR1sc (top) contains the MDR1sc cDNA and
HaDHFR(L22Y) (middle) contains a mutant DHFR cDNA. The bicistronic (two-gene)
vector HaMID (bottom) contains both MDR1 and DHFR genes. From Galipeau J,
Benaim E, Spencer HT, Blakley RL, Sorrentino BP (1997) A bicistronic retroviral vector for protecting hematopoietic
cells against antifolates and P-glycoprotein effluxed drugs. Hum Gene Ther 8, 1773-1783. Reproduced
with kind permission from the authors and Mary Ann Liebert, Inc.
Figure 28. Growth inhibition assays
comparing the effect of 25 nM taxol, 100 nM trimetrexate (TMTX) alone and in
combination on CEM cells transduced with HaDHFR(L22Y), HaMDR1sc, or HaMID.
Drug-selected CEM cells were washed and seeded at 1x105 cells/ml in
2 ml of media containing the indicated concentrations of drugs. After 72 hr,
the percentage of growth was calculated by dividing the number of cells at each
drug concentration by the number of cells present in control medium (100%
growth). Quadruplicate experiments are shown. aCells preselected in
100 nM trimetrexate. bCells preselected in 25 nM taxol. From
Galipeau J, Benaim E, Spencer HT, Blakley RL, Sorrentino BP (1997) A bicistronic retroviral vector
for protecting hematopoietic cells against antifolates and P-glycoprotein
effluxed drugs. Hum Gene Ther 8,
1773-1783. Reproduced with kind permission from the authors and Mary Ann
Liebert, Inc.
cDNA.
Similar protocols (#43, 44, 59, 89) use CD34+ autologous bone marrow
cells retrovirally-transduced with MDR1 cDNA for hemoprotection of patients
treated for ovarian, brain, or breast cancers (Appendix 1).
XXV. Antisense gene therapy of cancer.
Among
a variety of approaches to gene therapy of cancer, antisense oncogene gene
therapy is a strategy aiming at correcting genetic disorders of cancer through
correction of the abnormal expression of oncogenes implicated in signal
transduction and control of proliferation. A number of protocols have been
approved using antisense gene or oligonucleotide delivery. Protocol 29 uses a
combination of p53 cDNA and K-ras antisense for non-small cell lung cancer.
Protocol 41 uses antisense Rev for AIDS, protocol 91 antisense RRE decoy gene
and protocol 168 uses antisense TAR and transdominant Rev protein genes for HIV
infections. Protocol 64 uses antisense c-fos or antisense c-myc for breast
cancer. Protocol 82 uses intraprostate injection of antisense c-myc for
advanced prostate cancer. Protocol 162 uses TGF-§2 antisense gene-modified
autologous tumor cells for malignant glioma. And, protocol 189 uses antisense
Insulin-like Growth Factor I for glioblastoma (see below).
A. Antisense c-fos and c-myc
Because c-fos proto-oncogene has been implicated as a
regulator of estrogen-mediated cell proliferation, antisense c-fos has been
used to cause an inhibition of s.c. tumor growth and invasiveness of cells the
growth of which depends on estrogen. Ex vivo transduction of MCF-7 human breast
cancer cells with antisense c-fos, regulated by mouse mammary tumor virus
control elements and delivered by a retroviral vector, produced expression of
anti-fos RNA, decreased expression of the c-fos target mRNA, induced
differentiation, and inhibited s.c. tumor growth and invasiveness in breast
cancer xenografts in nude mice; a single injection of anti-fos inhibited i.p.
MCF-7 tumor growth in athymic mice with a corresponding inhibition of c-fos and
TGF-b1 (Arteaga and Holt, 1996). A phase I clinical study
for the treatment of metastatic breast cancer uses in vivo infection with
breast-targeted retroviral vectors expressing antisense c-fos or antisense
c-myc RNA (Holt et al, 1996; protocol #64, Appendix
1, page 163).
B. Antisense insulin-like growth factors I and II and
their receptors
Insulin-like growth factors I and II (IGF-I and -II)
are expressed preferentially in bone tissue and contribute to bone metastases
of cancer cells expressing IGF receptors. Prostate cancer cells express IGF-I
receptor; this favors metastasis to bone, the most frequent tissue for prostate
metastasis. An antisense IGF-IR construct, under control of the ZnSO4-inducible
metallothionein-1 promoter, was engineered by reverse transcription-PCR on
total RNA with primers specific for the 0.7 kb cDNA of IGF-IR and subcloned
into episomal vectors in the antisense orientation. Transfection of the
construct into prostate cancer PA-III cells in culture was able to reduce
dramatically the expression of IGF-IR after induction of the cells with ZnSO4 (Burfeind et al, 1996). This inhibition
resulted in reduction in expression of both uPA and tPA; whereas PA-III cells
were able to induce large tumors in nude mice, PA-III cells transfected with
the antisense vector either developed tumors 90% smaller or remained tumor
-free for long times postinjection (Burfeind et al, 1996).
Lafarge-Frayssinet et al (1997) have developed a
strategy for inducing a protective immunity by tumor cells transfected by the
IGF-I antisense vector: the hepatocarcinoma cell line LFCI2-A, expressing both
IGF I and II, produces voluminous tumors when injected subcutaneously into
syngeneic rats; when LFCI2-A cells were transfected with an episomal vector
expressing IGF-I antisense RNA, the cells became poorly tumorigenic exhibited a
4-fold increase of the MHC class I antigen, and, when injected subcutaneously,
inhibited the growth of the parental tumoral cells or induced regression of
established tumors; this loss of tumorigenicity and protective immunity was not
observed after transfection with the IGF-II antisense vector
(Lafarge-Frayssinet et al, 1997). Cationic lipid-mediated transfer of antisense
cDNA for IGF I is in clinical trial for glioblastomas (protocol #189 in Table 4 in Martin and Boulikas, 1998,
this volume, page 203).
C. Antisense ras gene transfer for pancreatic tumors
K-ras point mutations occurs at a characteristically
high incidence in human pancreatic cancers. Stable expression of a plasmid
expressing antisense K-ras RNA into pancreatic cancer cells with K-ras point
mutations (AsPC-1 and MIAPaCa-2) resulted in a significant suppression of cell
growth; the effect of antisense treatment was not found in cells with a
wild-type K-ras gene (BxPC-3). When the AsPC-1 cells with the K-ras point
mutation were inoculated into the intraperitoneal cavity of nude mice, followed
3 days later by i.p. treatment with the antisense K-ras in a liposome complex,
only 2 of 12 mice showed any evidence of tumors on day 28 compared with 9 out
of 10 control mice that developed peritoneal dissemination and/or solid tumors
on the pancreas (Aoki et al, 1995).
D. Antisense oligonucleotides to metallothionein
Abdel-Mageed and Agrawal (1997) have inhibited the
expression of metallothionein (MT) gene using an 18-mer MT antisense
phosphorothioate oligomer (complementary to a region 7 bases downstream from
the AUG translational start site of the human MT-IIA gene) to elicit
antiproliferative effects in breast carcinoma MCF7 cells; indeed, there is an
increased MT gene expression in breast cancer which is associated with
metastasis and poor prognosis of the disease; overexpression of MT potentiated
the growth of MCF7 cells, whereas downregulation of MT elicited
antiproliferative effects. Transfection of MCF7 cells with the antisense
oligomer inhibited cell growth by 50-60% and induced morphological changes
suggestive of apoptotic cell death at 72 hours posttransfection compared to
cells transfected with a random 18-mer; the antisense oligomer induced
chromatin cleavage into oligonu-cleosomal fragments, a 2-fold increase in the
levels of c-fos and p53 transcripts, a 2.5-fold decrease in c-myc transcripts,
and a decrease in Bcl-2 protein levels compared to random oligomer-transfected
cells.
On the contrary, the expression of MT was 2.5-fold
elevated after transfection of the cells with an expression plasmid
encompassing the human MT-IIA cDNA, constitutively driven by b-actin promoter and this was associated with a 2-fold
increase in cell multiplication (Abdel-Mageed and Agrawal, 1997)
E. Other antisense approaches
Transfer of an antisense cyclin G1 construct was used
to inhibit osteosarcoma tumor growth in nude mice. Overexpression of the cyclin
G1 gene is frequently observed in human osteosarcoma cells, and its continued
expression is essential for their survival. This modality resulted in a
decrease in the number of cells in S and G2/M phases of the cell cycle
concomitant with an accumulation of cells in the G1 phase (Chen et al, 1997). Figure 29 shows that nude mice treated
with the antisense cyclin G vector (panel A) have smaller tumors that animal
treated with a control vector (panel B). The results of the measurements of the
size of the tumor in treated and control animals are shown in C.
Figure 29. Photographs of nude mice treated with antisense cyclin G
vector (panel A) have smaller tumors
that animal treated with a control vector (panel
B). Panel C: the relative tumor
size (% of day 0 tumor size divided by 100) is plotted, on the vertical axis,
as a function of time (days), plotted on the horizontal axis. From Chen DS, Zhu
NL, Hung G, Skotzko MJ, Hinton DR, Tolo V, Hall FL, Anderson WF, Gordon EM (1997) Retroviral vector-mediated
transfer of an antisense cyclin G1 construct inhibits osteosarcoma tumor growth
in nude mice. Hum Gene Ther 8,
1667-1674. Reproduced with kind permission from the authors and Mary Ann
Liebert, Inc.
The replication and expression of hepatitis B virus
(HBV) could be inhibited through antisense gene transfer and this could become
a new method for clinical gene therapy against HBV; infection of the human
hepatoblastoma cell line 2.2.15, which expresses HBV surface antigen and
releases HBV particles, with retroviral vectors carrying an antisense preS/S or
preC/C genes of HBV inhibited expression of the surface antigen (Ji and St
1997).
Phosphorothioate antisense oligos directed against
c-myc and p53 in different cell lines (CAOV-3, SKOV-3, and BG-1) were shown to
have both antiproliferative and stimulatory activity, as single agents and in
combination; it was concluded that further in vitro studies are needed before
considering clinical trials with these agents in gynecologic cancers (Janicek
et al, 1995).
Transfection of antisense cDNA constructs
encom-passing different regions of the c-erbB-2 gene in the lung carcinoma cell
line Calu3, which overexpresses the c-erbB-2 oncogene, reduced significantly
anchorage-independent growth and tumor size in nude mice (Casalini et al,
1997).
Antisense oligonucleotides
against PCNA and cdc2 kinase transferred into injured arterial walls by
protein-liposomes greatly reduced mRNA levels for those genes and inhibited
neointima formation of the injured artery for 8 weeks; double-stranded
oligonucleotides containing the consensus sequence for E2F binding sites also
inhibited the growth of smooth muscle cells and prevented neointima formation
(Kaneda et al, 1997). Antisense oligonucleotides to angiotensinogen1-receptor
mRNA and to angiotensinogen mRNA reduced blood pressure (Tomita et al, 1995;
Phillips, 1997; Phillips et al, 1997).
XXVI. Triplex gene therapy
A. Molecular mechanisms for triplex formation
Natural purine.pyrimidine
sequences in regulatory regions of genes in eukaryotic cells with a mirror
symmetry can form triple-helical structures; in addition, purine-rich segments
in DNA unable to form triple helices on their own can be targeted by DNA or RNA
oligonucleotides able to form triplex structures with their target DNA and
these unusual structures can inhibit transcription factor binding,
transcription initiation, and nuclear enzymatic activities. Understanding the
advantages, limitations and pitfalls for using oligonucleotides as gene
bullets, development of strategies for boosting their therapeutic efficiency,
their covalent linkage to DNA damaging molecules to hit a specific genomic DNA
sequence, and improvements to the methods for their delivery to cells could
make reality their use as tools of micro-targeting specific genomic sites and
as pharmacogenomic drugs.
Formation of triple helical DNA was found to take
place on AT- and GC-rich stretches. A pyrimidine third strand oligonucleotide,
studied by NMR and other approaches, interacts with purine residues in the
major groove of the target duplex in a parallel orientation (Moser and Dervan,
1987; Rajagapol and Feigon, 1989; de los Santos et al, 1989) whereas a purine
oligonucleotide binds in an antiparallel orientation relative to the purine
strand in the duplex (Cooney et al, 1988; Kohwi and Kowhi-Shigematsu, 1988;
Beal and Dervan, 1991). In this case G can recognize GC pairs and A or T can
recognize AT pairs. Specificity is provided from T.AT and C+GC base
triplets where the bases of the third polypyrimidine strand establish Hoogsteen
base pairing with the purine strand of the duplex (Hoogsteen, 1959; Rajagopal
and Feigor, 1989).
The H form is the structural basis for S1-nuclease
hypersensitivity (Mirkin et al, 1987). A restriction fragment from a human U1
gene containing the sequence d(C-T)18.d(A-G)18 under
supercoiling and pH less than or equal to 6.0 showed S1 hyperreactivity in the
center and at one end of the (C-T)n tract, and continuously from the
center to the same end of the (A-G)n tract providing strong support for a
triple-helical model (Johnston, 1988).
Homopyrimidine oligodeoxyribonucleotides with EDTA-Fe
attached at a single position bound the corresponding homopyrimidine-homopurine
tracts within large double-stranded DNA by triple helix formation and cleaved
at that site (Moser and Dervan, 1987). Studies from the group of Claude HŽlne
have similarly focused on the development of artificial scissor
oligonucleotides based on triplex technology (Praseuth et al, 1988; Perrouault
et al, 1990). However, the feasibility of employing this exciting in vitro
technology to animal studies has not yet been demonstrated.
Intramolecular or intermolecular triple helices could
be recognized by specific proteins that stabilize triplex structures and might
play a role in gene regulation; a protein from HeLa cell nuclear extracts was
identified that binds to a 55 nucleotide-long DNA oligomer that could fold on
itself to form an intramolecular triple helix of the Py Pu x Py motif (Guieysse
et al, 1997).
Triplex-forming oligophosphoramidates containing
thymines and cytosines or 5-methyl cytosines (5' T4CT4C6T
3') bind strongly to a 16 base pair oligopurine.oligopyrimidine
sequence of HIV proviral DNA even at neutral pH and are remarkably stable
compared to oligonucleotides with natural phosphodiester linkages. The
phosphoramidate oligomers induced an efficient arrest of both bacteriophage and
eukaryotic transcriptional machineries (SP6, T7 or Pol II) under conditions
where the phosphodiester oligos had no inhibitory effect and blocked the RNA
polymerases at the triplex site (Giovannangeli et al, 1996).
Oligonucleotide-directed triplex formation has been
shown to inhibit binding of transcription factors to their cognate DNA
sequences. A 21 bp homopurine element insert flanking a single Sp1 site in the
adenovirus E4 promoter was used to study the effect of oligo targeting on transcriptional
efficiency in vitro; assembly of the triple helical complex repressed basal
transcription by rendering the triplex target inflexible and by blocking
assembly of the promoter into initiation complexes; Sp1 was unable to cause
derepression (Maher et al, 1992). Thus DNA triplexes can inhibit transcription
initiation not only when directed to a TF binding site occluding its binding
but also to a flanking region by other possible repression mechanisms including
stiffening of the double helix (Maher et al, 1992).
B. Triplex targeting of IGF-I
Oligonucleotide-directed triple helix formation
targeted toward IGF-I to inhibit its expression was studied following stable
transfection of C6 rat glioblastoma cells with a plasmid from which an RNA was
transcribed that coded for the third strand of a potential triple helix. A
plasmid encoding the oligopurine variant of the triple helix but not the
oligopyrimidine or a control sequence caused a dramatic reduction of IGF-I RNA
and protein levels in cultured cells, morphological changes, and increased
expression of protease nexin I and MHC class I molecules; the transfected cells
displayed a reduced capacity for tumor growth when injected in nude mice
(Shevelev et al, 1997).
XXVII. Gene transfer to some characteristic tissues
or cell types
A. Transduction of hematopoietic stem cells (HSCs)
Hematopoietic stem cells (HSCs), which can be
isolated with high speed flow-cytometric cell sorting from fetal or adult bone
marrow and cytokine-mobilized peripheral blood, have extensive self renewal and
multilineage repopulating potential; HSCs are being used as an hematopoietic
graft to treat cancer patients undergoing high dose chemotherapy which
eradicates HSCs; GM-CSF treatment of the patient can enhance mobilization of
true HSCs; furthermore, HSCs can be stably transduced at high efficiency
(32-75%) by co-culture with a cell line producing recombinant retroviruses
containing the neomycin-resistant gene and are targets for hematopoietic
cell-based gene therapy especially for the treatment of patients with multiple
myeloma (Chen et al, 1995).
The efficiency of gene transfer into monkey
pluripotent hematopoietic stem cells (PHSCs) is at least one order of magnitude
lower than what has been achieved in mice because primate PHSCs seem to require
quite different culture conditions for their maintenance and transduction than
mouse PHSCs. Successful retroviral vector-mediated gene transfer into monkey
PHSCs supported maintenance of the long-term repopulating ability of autologous
monkey grafts and has closed the gap between gene transfer experiments in mouse
models and primates opening the door to the clinical application of bone marrow
gene therapy to humans (Van Beusechem and Valerio, 1996).
Retroviral vectors pseudotyped with vesicular
stomatitis G glycoprotein (VSV-G) and expressing a murine cell surface protein,
B7-1, were used to infect the human T-cell line Jurkat and human peripheral
blood lymphocytes (PBLs); the transduction efficiency of PBLs with the
pseudotyped vector reached a maximum of 16-32% at an moi of 40 (Sharma et al,
1996). Introduction of a mutant H-ras gene (along with a neomycin resistance
gene) into normal human bone marrow progenitor cells with a retrovirus followed
by selection in cell culture with G418 suggested that expression of mutant
H12-ras resulted in enhanced proliferation of early myeloid cells at the
expense of differentiation (Maher et al, 1994).
Dendritic cells (DCs) which are the most potent
antigen-presenting cells (APCs) for the initiation of antigen-specific T-cell
activation can be highly enriched from peripheral blood-adherent leukocytes by
short-term culture in the presence of IL-4 and GM-CSF; adenoviral vectors
expressing luciferase, b-galactosidase, IL-2, and IL-7 readily transduced
human DCs compared to other methods (Arthur et al, 1997).
Transduction of hematopoietic stem cells with human
IL-1Ra cDNA was used to alleviate symptoms of RA; the HSCs were subsequently
injected into lethally irradiated mice; all of the mice survived and over 98% of
the white blood cells in these mice produced biologically active human IL-1Ra
type from 2-13 months after transplantation; the animals had the human IL-1Ra
protein in their sera for at least 15 months (Boggs et al, 1995).
B. Gene transfer to the brain
Several molecular approaches, including gene transfer
with retroviral, adenoviral and herpes simplex virus vectors, as well as
antisense vectors, and antisense oligonucleotides have been shown to have in
vitro and in vivo activities against brain tumor cells. These approaches are
especially important for the treatment of glioblastomas which remain incurable
despite an aggressive combination regimens using surgery, radiation, and
chemotherapy (reviewed by Yung, 1994).
Intrathecal transplantation of polymer-encapsulated
cell lines genetically engineered to release the human ciliary neurotrophic
factor (CNTF) provided a means to deliver CNTF continuously behind the
blood-brain barrier and bypass the immunologic rejection of allogeneic cells;
for example, transduction of mouse C2C12 myoblasts with human CNTF followed by
membrane encapsulation and intrathecal implantation in adult rats could
partially rescue motor neurons from axotomy-induced cell death (Deglon et al,
1997).
Since adult brain cells are nonproliferative, they
are refractory to retroviral infection that could deliver the tyrosine
hydroxylase gene to the brain to alleviate degeneration at the nigrostriatal
pathway in Parkinson disease (PD). Implantation of immortalized fibroblasts,
primary fibroblasts, or myoblasts, stably transfected in culture with the TH
gene (Jiao et al, 1993) or direct injection of lipofectin-plasmid DNA complexes
containing the TH gene under the influence of the SV40 promoter/enhancer (Cao
et al, 1995) reduced behavioral abnormalities in PD animal models. A 7 kb
region encompassing the TH promoter was able to confer expression of b-galactosidase in catecholaminergic cell types in the
substantia nigra pars compacta compared to other regions of the brain after
HSV-1-mediated transfer to adult rat brains (Song et al, 1997).
C. Gene transfer to hepatocytes
Hepatocytes are responsible for the production of
many therapeutically important proteins such as LDL-R which clears LDL from the
serum and the blood clotting Factors VIII and IX which are defective in
hemophiliacs. Portal vein, rather than systemic intravenous injection, has been
used to transduce preferentially hepatocytes (or liver macrophages, known as
Kuppfer cells). For example, the Factor IX gene was delivered to a portal vein cannulated
into a splenic vein in animals previously subject to two-third hepatectomy and
resulted in the expression of low levels of factor IX for up to about 5 months;
0.3-1% of hepatocytes were found to be transduced (Kay et al, 1993).
An adenovirus LDL-R cDNA, infused into the portal
vein of rabbits deficient in LDL receptor, resulted in the expression of human
LDL-R protein in the majority of hepatocytes that exceeded the levels found in
human liver by at least 10-fold (Kozarsky et al, 1994). According to an ex vivo
protocol, cultured hepatocytes from a FH patient were transduced ex vivo with
the LDL receptor gene and transplanted by infusion into the portal vein of the
patient (Wilson et al, 1992; Grossman et al, 1994).
Delivery of a 5.6 kb genomic clone or of a 834-bp
cDNA clone encoding the kallikrein gene into the portal vein or tail vein of
spontaneously hypertensive rats resulted in significant reduction of their
blood pressure for about 5-6 weeks (Chao et al, 1996). Portal vein injection of
the human kallistatin cDNA in an adenoviral vector into spontaneously
hypertensive rats resulted in a significant reduction of blood pressure for 4
weeks; this method resulted in the transduction not only of liver but also of
spleen, kidney, aorta, and lung (Chen et al, 1997).
Hepatocyte Growth Factor (HGF) is the most potent
mitogen of mature hepatocytes; transfer of the human HGF gene into a
recombinant retroviral cell line produced HGF in the supernatant which was
correctly processed and biologically active; primary mouse and human
hepatocytes could be transduced with the supernatant of transfected cells and,
thus, this cell line should be useful for in vivo liver gene therapy (Pages et
al, 1996a).
D. Gene transfer to the embryo
Introduction of normal genes in utero or in the early postnatal period could become a successful
approach to correct genetic defects; several studies have shown that adenoviral
or retroviral vector-mediated gene transfer during the ebryonic or neonatal
period results in prolonged gene expression. Gene transfer (or gene disruption)
has been extensively studied in preimplantation embryos giving rise to
transgenic animals difficient in a specific protein (e.g. Smith et al, 1995;
Fong et al, 1995; Shalaby et al, 1995).
Gene transfer to the embryo has shown the importance
of the promoter, large genomic regulatory regions, cell-cell interactions and
gene switch taking place during embryogenesis in maintaining transgene
expression in different tissues; results obtained in embryos reflect the in
vivo patterns of tissue-specific expression which could be useful to direct
efforts in promoter choices for somatic gene transfer to the adult (as is the
case for most gene therapy applications). Furthermore these studies provide the
foundation of a new era where genetic manipulation of the embryo could
permanently correct monogenic genetic disorders such as hemophilias,
thalassemias and others.
The promoter of the tie gene, which encodes a receptor tyrosine kinase that is
expressed in the endothelium of blood vessels, was used to drive the expression
of a luciferase reporter gene construct; in cultured cells the luciferase
activity was not restricted to endothelial cells. In contrast, in transgenic
mice expression of the reporter b-galactosidase was
restricted to endothelial cells undergoing vasculogenesis and angiogenesis; in
adult transgenic mice, tie promoter
activity in lung and many vessels of the kidney was as high as in the vessels
of the corresponding embryonic tissues, whereas in the heart, brain and liver, tie promoter activity was downregulated
and restricted to coronaries, cusps, capillaries, and arteries (Korhonen et al,
1995).
A retroviral VEGF expression vector was used to
infect quail ebryo and to increase the level of VEGF during critical periods of
avian limb bud growth and morphogenesis. Overexpression of VEGF in the limb bud
exclusively resulted in hypervascularization as reflected by an increase in
vascular density from an augmentation of the VEGF signaling mechanism in a
permissive environment; vascular permeability was also dramatically increased
leading to local edema (Flamme et al, 1995).
An avian leukosis virus (ALV)-based retroviral vector
system was used for the efficient delivery of genes into preimplantation mouse
embryos; a subset of the integrated proviruses expressed the delivered
chloramphenicol acetyltransferase (CAT) reporter gene either from the
constitutive viral promoter contained in the long terminal repeat or from the
internal nonviral tissue-specific promoter in different sets of experiments.
Thus, many of the sites that are
accessible to viral DNA insertion in preimplantation embryos were thought to be
incompatible with expression in older animals (Federspiel et al, 1996).
Baldwin and coworkers (1997) have found that the
expression of lacZ gene under control of CMV or RSV promoter transferred to
early, postgastrulation mouse embryos gave tissue-specific patterns of
expression which depended on the type of promoter used. Embryos were injected
into the mesoderm of the neural fold (A
in Figure 30) and b-galactosidase activity was detected in the head
Figure 30.(A) E7.25
(1-2 somite) mouse embryos were injected via a micropipette inserted directly
into the mesoderm of the neural fold (nf).
Thus, all head fold mesoderm and neural epithelium were directly exposed to the
recombinant adenovirus carrying the LacZ reporter gene (aip, anterior intestinal portal; ys, yolk sac; epc,
ectoplacental cone).
(B) Following 36 h in culture, b-galactosidase
activity was detected in the head process and pharyngeal arches of the embryo;
a smaller amount of b-galactosidase
activity was detected within the outflow tract (ct) of the developing heart (1
and 2, first and second pharyngeal
arches, v, ventricle).
(C) Low and (D) high
magnification dual immunofluorescent photomicrographs of a sagittal section
through the head and heart of an embryo stained with a polyclonal antibody to b-galactosidase
(red) detected by a
rhodamine-conjugated second antibody as well as a monoclonal antibody to
PECAM-1 (CD-31) (green) which is
specific for endothelial cells and is detected by a fluorescein-conjugated
secondary antibody. Despite exposure of all cell types within the head fold of
the embryo b-galactosidase activity is
restricted to a subpopulation of endothelial cells within the aortic sac (as) and first pharyngeal arch artery (pha); (m, myocardium; e,
endocardium). From Baldwin HS, Mickanin C, and Buck C (1997) Adenovirus-mediated gene transfer during initial organogenesis
in the mammalian embryo is promoter-dependent and tissue-specific. Gene Ther 4, 1142-1149. Reproduced with
the kind permission of the authors (H Scott Baldwin, ChildrenÕs Hospital of
Philadelphia) and Stockton Press.
process
(B in Figure 30); sagittal sections through the head and heart of the
embryos (c, d) were stained for b-galactosidase (red)
and for endothelial cells (green);
the micrographs show that while not all endothelial cells demonstrated b-galactosidase activity (green only), b-galactosidase was restricted to endothelial cell
populations (yellow).
DIVISION THREE: GENE THERAPY OF HUMAN DISEASE OTHER
THAN CANCER
XXVIII. Ex vivo gene therapy
A. Ex vivo (and in vivo) gene therapy on animal
models
A number of experimental approaches for the gene
therapy of human disease are first being tested on animal models (preclinical
trials) before receiving approval for phase I clinical trials on humans. A
number of animal models have been developed such as hemophiliac dogs, rats with
high blood pressure, rabbits with coronary heart disease, nude or SCID mice
bearing a variety of human cancers, mice with symptoms resembling those of
ParkinsonÕs disease patients etc. Then, gene transfer has been used to treat
these animals and alleviate the symptoms. The success of these studies is a
prelude for their approval as a gene therapy technology on human patients.
Ex vivo techniques although cumbersome are safer,
because all genetic manipulations occur outside the body and cells may be
extensively screened prior to implantation. According to ex vivo protocols cells from the mammalian body are removed,
cultured, transduced with therapeutically important genes, and reimplanted into
the body of the same individual. A representative number of such studies on
animal models are summarized on Table 5.
Some examples will be mentioned here. More
information can be found in the specialized sections of this review. Ex vivo
gene therapy for PD was performed on animal models with TH deficiency using
implantation of immortalized rat fibroblasts releasing L-dopa (Wolff et al,
1989), or using primary fibroblasts (Fisher et al, 1991) and myoblasts (Jiao et
al, 1993) stably transfected in culture with the TH gene. Retroviral vectors have successfully treated
mucopolysaccharidosis VII by implantation of ex vivo modified mouse skin
fibroblasts to mice (Moullier et al, 1993). Surgical implantation of factor
VIII gene-transduced primary mouse fibroblasts into the peritoneal cavity in
SCID mice resulted in correction of hemophilia A (Dwarki et al, 1995). Ex vivo
transduction of primary myoblasts in mice with the factor IX gene followed by
transplantation of the transduced cells led to partial correction of hemophilia
B (Dai et al, 1992; Yao et al, 1994).
Intraarticular injection of syngeneic synovial cells
transduced with the IL-1R antagonist protein gene alleviated the symptoms of
arthritis (Bandara et al, 1993). Similarly, ex vivo retroviral transfer of the
secreted human IL-1Ra cDNA to primary synoviocytes followed by engraftment in
ankle joints of rats with induced arthritis significantly suppressed the
severity of the disease (Makarov et al, 1996; see also Ghivizzani et al, 1997).
To demonstrate feasibility of the ex vivo FH therapy, three baboons underwent a
partial hepatectomy, their hepatocytes were isolated, cultured, transduced with
a retrovirus containing the human LDL-R gene, and infused via a catheter
(Grossman et al, 1992).
An important number of studies on cancer
immunotherapy have been performed on animal models (For example, see Vieweg et
al, 1994; Wiltrout et al, 1995; Caruso et al, 1996; Bramson et al, 1996; Tahara
et al, 1996; Zhang et al, 1996; Rakhmilevich et al, 1997; Aruga et al, 1997;
Clary et al, 1997; Ju et al, 1997)
Studies with tumor cells reconstituted with RB ex
vivo and implanted into immunodeficient mice have demonstrated cancer
suppression (see Riley et al, 1996). Transfer of the Cu2+/Zn2+ superoxide dismutase into ex vivo
modified cells protected the cells from oxidative damage during manipulation
and increased their survival after implantation (Nakao et al, 1995). Ex vivo
transfer of the MDR1 gene in bone
marrow cells has been used to render stem cells resistant to cancer
chemotherapy (Lee et al, 1998, this volume). Ex vivo transduction of MCF-7
human breast cancer cells with antisense c-fos produced expression of antifos
RNA, and inhibited s.c. tumor growth and invasiveness in breast cancer
xenografts in nude mice (Arteaga and Holt, 1996).
Direct in vivo injection of a gene (intratumoral,
intravenous, etc) must be distinguished from ex vivo gene therapy methods. Some
representative direct in vivo studies to animals using genes are summarized on Table 6.
B. Ex vivo gene therapy on humans
The first person to be treated ex vivo was a
4-year-old suffering with ADA deficiency in 1990 (see ADA deficiency below).
The US Patent Office has issued in 1995 a patent covering all ex vivo gene therapy to French Anderson,
Steven Rosenberg, and Michael Blaese; the technique was developed at NIH in the
1980s and an exclusive license to this work has been awarded to Gene Therapy
Inc, (Rockville, Maryland). Of the 220 protocols for Clinical Trials approved
by NIH's Recombinant DNA Advisory Committee (RAC), a significant number (over
100) use ex vivo gene therapy
applications (see Gavaghan, 1995). Ex vivo protocols are marked In Vitro
in Appendicx 1 and Table 4 in following article (pages
203-206). Also protocols proposing immunotherapy use ex vivo transduction of
cells from cancer patients with cytokine genes and immunization of the patient
with the transduced cells (Appendix 1).
Transduction of cells in vitro with adenoviruses makes the patients own cells antigenic
leading to their destruction by T lymphocytes thus eliminating the therapeutic
effect after reimplantation (e.g. Yang et al, 1994). It was thought that this
antigenicity arises from the adenoviral proteins expressed in transduced cells;
however, recent data have demonstrated that antigenicity could also arise from
the expression of the therapeutic recombinant protein (see above).
Ex vivo approaches have concentrated on correction of
mutated genes involved in purine metabolism including adenosine deaminase (ADA)
deficiency in severe combined immunodeficiency (SCID) patients, PNP (purine
nucleoside phosphorylase) deficiency, and the therapy of Lesh-Nyhan syndrome
caused by a deficiency in hypoxanthine-guanine phosphoribosyltransferase
(HG-PRT). The first human trial to be approved for ex vivo gene therapy was for
the treatment of ADA deficiency which began in 1990 (Karlsson, 1991; Ferrari et
al, 1991). Ex vivo studies include
transfer of factor IX gene in skin fibroblasts from hemophilia B patients in
China followed by subcutaneous injection of the cells to the patient (Wilson et
al, 1992; reviewed by Anderson, 1992). From 1990-1992, a clinical trial was
initiated using retrovirus mediated transfer of the 1.5 kb ADA gene cDNA to T
cells from two children with severe combined immunodeficiency following
multiple transplantations of ex vivo
modified blood cells; the vector was integrated and the ADA gene was expressed
for long periods (Blaese et al, 1995; Bordignon et al, 1995).
A clinical protocol for the therapy of amyotrophic
lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells;
the membrane is implanted intrathecally to provide human ciliary neurotrophic
factor (Deglon et al, 1996; Pochon et al, 1996). An ex vivo clinical trial on
humans, homozygous for mutations in the LDL receptor gene, is performed using
cultured hepatocytes from the patient which are transduced ex vivo with the LDL
receptor gene and transplanted by infusion into the portal vein of the patient
(Wilson et al, 1992; Grossman et al, 1994).
Cancer immunotherapy uses transfer of cytokine genes
(IL-2, IL-7, IFN-g, GM-CSF) to autologous (cancer patientÕs) cells
followed by immunization of the patient to elicit activation of tumour-specific
T lymphocytes capable of rejecting tumour cells from the patient, especially on
immunoresponsive malignancies such as melanomas, colorectal carcinomas, and
renal cell carcinomas (Uchiyama et al, 1993; Chang et al, 1996; Finke et al,
1997; Das Gupta et al, 1997; Mahvi et al, 1997).
Table 5. Ex vivo studies on animal models
|
Gene target |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
|
ADA |
SCID
(severe combined immunodeficiency) |
Retrovirus |
Immunodeficiient
mice were injected with peripheral blood lymphocytes from ADA- patients transduced with a retroviral
vector for human ADA |
Restoration
of immune functions (presence of human immunoglobulin and antigen-specific T
cells) |
Ferrari
et al, 1991 |
|
bcl-2 |
prostate
cancer |
|
bcl-2 expressing LNCaP human prostate
cancer cells are rendered highly resistant to apoptotic stimuli |
LNCaP-bcl-2 cells induced earlier, larger,
and hormone-refractory prostate tumors in nude mice |
Rafo et
al, 1995 |
|
Factor IX |
hemophilia
B |
|
Injection
of transduced primary myoblasts into the muscle |
Factor IX
was being synthesized and delivered to the circulation for over 6 months |
Dai et
al, 1992 |
|
Factor IX |
hemophilia
B |
retr |
Transplantation
of retrovirus-transduced keratinocytes |
Human
factor IX was detected in the bloodstream of nude mice in small quantities
for one week |
Gerrard
et al, 1993, |
|
Factor IX |
hemophilia
B |
retrovirus |
Mouse
primary myoblasts were infected with retrovirus expressing the canine factor
IX under control of mouse muscle creatine kinase and human CMV promoter;
myoblasts were injected into the hindlegs of recipient mice; secreted canine
factor IX was monitored in the plasma |
Sustained
expression of factor IX for over six months without any apparent adverse
effects on the recipient mice; however, the levels of the factor IX protein
secreted into the plasma (10 ng/ml for 107 injected cells) were not sufficient to be of therapeutic
value; 100 times higher amounts of factor IX were needed |
Dai et
al, 1992; Yao et al, 1994 |
|
Factor
VIII |
Hemophilia
A |
transferrin |
Transfection
of fibroblasts and myoblasts with B-domain-deleted factor VIII gene followed
by implantation into mice |
Therapeutic
levels of factor VIII in the blood of the animals for 24 hours |
Zatloukal
et al, 1994 |
|
Factor
VIII |
Hemophilia
A |
Retrovirus |
Mouse
primary fibroblasts infected with a recombinant retrovirus containing factor
VIII gene deleted at the B domain |
Therapeutic
levels of factor VIII in blood of animals for 1 week after surgical
implantation into the peritoneal cavity in SCID mice of 15 million cells in
the form of neo-organs |
Dwarki et
al, 1995 |
|
Growth
hormone (human) |
none |
mice
electroporation |
Ex vivo modified C2C12 cells with the hGH gene under control of the
inducible UAS promoter and a synthetic hybrid steroid receptor (TAXI),
activating transcription from the inducible promoter after treatment with the
synthetic nontoxic drug inducer RU486; transplanted in mouse muscle |
This
model allows up to 100-fold induction of the hGH gene and can be finely tuned
to lower levels of induction |
Delort
and Capecchi, 1996 |
|
Growth
hormone (human, hGH) |
general |
retr |
Injection
of genetically engineered myoblasts into mouse muscle |
hGH could
be detected in serum for 3 months; myoblasts were fused into preexisting
multinucleated myofibers that were vascularized and innervated |
Dhawan et
al, 1991 |
|
HSV-tk |
glioma |
Retr |
To
directly transfer HSV TK gene and
kill transduced proliferating brain tumor cells with ganciclovir without
affecting nondividing normal cells |
Murine
fibroblasts transduced ex vivo with HSV TK retroviral vectors caused complete
regression of gliomas in rat brain after intratumor injection |
Culver et
al, 1992 |
|
HSV-tk |
pancreatic
cancer |
retrovirus |
BXPC3
primary human pancreatic adenocarcinoma cells were transduced with retroviral
vector carrying the HSV-tk gene driven by the CEA promoter; engrafted
subcutaneously into nude mice eliciting pancreatic tumors |
Animals
treated with 0.1 mg/Kg ganciclovir exhibited a significant reduction in tumor
growth |
DiMaio et
al, 1994 |
|
HSV-tk |
proliferative
vitreoretinopathy (PVR) |
retrovirus-transduced
rabbit dermal fibroblasts |
Traction
retinal detachment results from proliferation of retinal pigment cells in the
vitreous cavity of the eye; PVR may ensue after retinal surgery or trauma and
can be induced in rabbit models by surgical vitrectomy. |
Significant
inhibition of PVR (killing of proliferating cells in the retina) was observed
in rabbit PVR models after injection into the vitreous cavity of rabbit
dermal fibroblasts transduced in vitro;
all eyes received 0.2 mg GCV on the following day and on day 4; |
Kimura et
al, 1996 |
|
IL-1
-receptor antagonist protein gene |
Rheumatoid
arthritis (RA) |
Retr |
Synovial
cells were surgically removed from joints of animals with experimental
arthritis, cultured, transduced with the IL-1 -receptor antagonist protein
gene and reimplanted into the respective donors by intraarticular injection |
Improvement
in RA symptoms |
Bandara
et al, 1993 |
|
IL-1
receptor antagonist (IL-1Ra) |
Rheumatoid
arthritis (RA) |
Retr |
Degradation
of cartilage in RA is stimulated by IL-1; to inhibit IL-1; RA synovial
fibroblasts transfected with the IL-1Ra gene were coimplanted with normal
human cartilage in SCID mice |
IL-1Ra expression
protected the cartilage from chondrocyte-mediated degradation. |
Otani et
al, 1996; Makarov et al, 1996; Muller-Ladner et al, 1997b |
|
IL-2;
GM-CSF |
prostate
cancer |
|
Dunning
rat R3327-MatLyLu prostate tumor model (an anplastic androgen-dependent,
nonimmunogenic tumor that metastasizes to the lymph nodes and the lung);
cytokine (IL-2)-secreting human tumor cell preparations (tumor vaccines) were
used for the treatment of advanced human prostate cancer in rats |
All
animals with subcutaneously established tumors were cured; the cancer vaccine
induced immunological memory that protected the animals from subsequent tumor
challenge; GM-CSF was less effective than IL-2. |
Vieweg et
al, 1994 |
|
LDL
receptor |
Familial
hypercholesterolemia (FH) |
Retr |
Watanabe
heritable hyperlipidemic rabbit (deficient in both alleles of LDL receptor
gene); establish hepatocyte culture from animal liver; transduce with LDL
receptor gene responsible for LDL internalization into hepatocytes to reduce
blood serum cholesterol; transplant hepatocytes into the animal |
30-40%
decrease in serum cholesterol that persisted for 4 months |
Chowdhury
et al, 1991 |
|
Nerve
Growth Factor (NGF) |
Alzheimer's
disease |
rat and
primate |
Delivery
of NGF by ex vivo-modified allogeneic cells surrounded by a semipermeable
membrane and implanted intrathecally |
Release
of NGF by the implant which is not subject to immunologic rejection due to
the membrane |
Kordower
et al, 1994 |
|
XPD
(ERCC2) |
xeroderma
pigmentosum (XP) |
Retr |
To
transduce ex vivo human keratinocytes and produce skin grafts on
immunodeficient mice; use it on XP patients as reconstructive surgery to
alleviate cancers in UV-exposed areas |
The
retroviral vector carrying the XPD gene and neoR under control of SV40
enhancer fully complemented the DNA repair deficiency of primary skin
fibroblasts |
GšzŸkara
et al, 1994; Carreau et al, 1995 |
|
TH (Tyrosine hydroxylase) |
Parkinson's
disease (PD) |
Retrovirus |
Rat
fibroblasts transduced with tyrosine hydroxylase (TH) produced and released
L-dopa to the culture medium; |
When
grafted to the striatum of Fischer rats with a prior 6-hydroxydopamine
lesion, primary fibroblasts containing the TH transgene survived for 10
weeks, continued to express the transgene, and reduced rotational asymmetry. |
Wolff et
al, 1989 |
|
TH |
Parkinson
disease (PD) |
|
Overexpress
TH that converts tyrosine to L-DOPA to alleviate degeneration of dopaminergic
nigrostriatal neurons (DNN) in PD rat models; unilateral destruction of DNN
in animals with 6-hydroxydopamine and administration of apomorphine caused PD
rats to turn contralaterally (7 or more rotations/min). |
Implantation
of transgenic immortalized fibroblasts and myoblasts intracerebrally improved
rotational behavior |
Fischer
et al, 1991 |
|
TH |
Parkinson's
disease (PD) |
HSV |
Infection
of 6-hydroxydopamine-lesioned rats, used as a model of PD, with a defective
herpes simplex virus type 1 vector expressing TH |
Conversion
of endogenous striatal cells into L-dopa-producing cells |
During et
al, 1994 |
|
TH |
Parkinson's
disease (PD) |
Lipofectin |
To
alleviate the symptoms of PD in TH-deficient rats (PD animal models; perform
colateral rotations at 15 rounds/min upon administration of apomorphine) |
Primary
muscle cells were transduced with TH cDNA under control of CMV promoter; 10
million cells were injected into brains of TH-deficient rats; this resulted
in 75% decrease in the number of rotations/min for more than 6 months |
Jiao et
al, 1993 |
Table 6. In vivo somatic gene transfer strategies to animal
models
|
Gene target or delivered |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
|
HSV TK
and ganciclovir |
hepatocellular
carcinoma |
AAV mice |
To
preferentially kill hepatocellular carcinoma cells by the suicadal gene HSV
TK (driven by the a-fetal
protein (AFP) enhancer and albumin promoter) with ganciclovir |
Selective
killing of AFP-positive cells in culture; transgenic mice were established by
injection of AAV ITRs, neoR, and HSV
TK genes as a linear DNA fragment; HSV TK was expressed predominantly in
adult liver. |
Su et al,
1996 |
|
Prostaglandin
G/H synthase |
acute lung
injury |
Cat lipid
rabbit |
Rabbits
intravenously transfected with the PGH synthase gene |
Increased
plasma levels of prostacyclin and PGE2; protection of lungs in rabbits
against endotoxin-induced inflammation, pulmonary edema, release of
thromboxane B2, and pulmonary hypertension |
Conary et
al 1994 |
|
Ornithine
transcarbamylase (OTC) |
OTC-deficiency |
Adenovirus |
iv
injection of recombinant adenovirus to spf-ash
mice (OTC-deficient) |
Correction
of enzyme deficiency in OTC-deficient mice for over 1 year. |
Stratford-Perricaudet
et al, 1990 |
|
a1-antitrypsin |
a1-antitrypsin-deficiency
in lung |
Adenovirus |
The
adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia of
cotton rat respiratory pathway |
Both in
vitro and in vivo infections have shown production and secretion of a1-antitrypsin by the lung cells for over 1 week |
Rosenfeld
et al, 1991 |
|
a1-antitrypsin |
a1-antitrypsin-deficiency
in liver |
Cat lipid
mice |
Protect
connective tissue from the lytic action of the leukocyte neutrophil elastase;
plasmid was encapsulated into negatively-charged liposomes containing
phoshpatidylcholine |
Small
liposomes were much more effective in delivering the a1-antitrypsin
gene to mouse hepatocytes in vivo. |
Ali–o et
al, 1996 |
|
a1-antitrypsin
(AT, human) |
acute and
chronic lung diseases. |
Cat lipid |
Aerosol
and intravenous transfection to lungs of rabbits |
Human a1AT mRNA and protein were detected for at least 7 days;
immunohistochemical staining showed a1AT
protein in the pulmonary endothelium following intravenous administration, in
alveolar epithelial cells following aerosol administration, and in the airway
epithelium by either route |
Canonico
et al, 1994 |
|
CFTR |
Cystic
fibrosis (CF) |
Adenovirus |
To
alleviate the symptoms of CF |
Expression
of CFTR after intratracheal instillation into lungs of cotton rats;
expression between days 2-10 |
Rosenfeld
et al, 1992 |
|
CFTR
(cystic fibrosis transmembrane conductance regulator) |
Cystic
fibrosis (CF) |
Cat lipid |
To
express the normal CFTR gene in lungs of Edinburgh insertional mutant mouse
(cf/cf) after delivering CFTR cDNA-liposome complexes into the airways by
nebulization. |
Full
restoration of cAMP related chloride responses in some animals; human CFTR
cDNA expression in the same tissues |
Alton et
al, 1993 |
|
CFTR |
Cystic
fibrosis (CF) |
Lipofectin |
To
express the human CFTR gene in lungs in CFTR-deficient transgenic mice by
tracheal instillation of lipofectin-plasmid |
Successful
transfer of the CFTR gene to
epithelia and to alveoli deep in the lung leading to correction of the ion
conductance defects found in the trachea of transgenic mice |
Hyde et
al, 1993. |
|
CFTR |
CF |
Lipofectin |
Transduction
of airway epithelial cells in normal mice by intratracheal instillation of a
plasmid carrying the CFTR gene
under control of the Rous sarcoma virus promoter |
Airway
epithelial cells were the major target and site of expression of CFTR |
Yoshimura
et al, 1992 |
|
CFTR cDNA
(human) |
Cystic
fibrosis (CF) |
AAV |
Intratracheal
instillation into neonatal New Zealand white rabbits |
Epithelial
expression of the human CFTR fusion protein was detected using antisera to
both the human CFTR R domain and the amino-terminal epitope at up to 6 weeks
after vector inoculation, a time coinciding with the completion of the
alveolar phase of lagomorph lung development |
Rubenstein
et al, 1997 |
|
p53 |
lung
cancer |
retrovirus |
Lung
tumors were elicited in nu/nu mice after intratracheal inoculation with human
lung cancer H226Br cells whose p53 gene has a homozygous mutation at codon
254 |
Intratracheal
injection of a recombinant retrovirus containing the wt p53 gene was shown to
inhibit the growth of the tumor |
Fujiwara
et al, 1994 |
|
MHC class
I HLA-B7 heavy chain gene plus b2-microglobulin
|
|
Cat
lipid:DNA 1:5 mice |
To give a
complete Class I molecule with heavy and light chains; MHC class I HLA-B7
heavy chain gene has an internal ribosome entry site; the b2-microglobulin
was driven by RSV promoter |
Experiments
in mice showed rapid (1 day) destruction of the plasmid in tissues; femtogram
amounts only in muscle at 6 months postinjection |
Lew et
al, 1995 |
|
CCK
(cholecystokinin) |
congenital
audiogenic epileptic seizures (AS) |
Lipofectin
(DOTMA:DOPE) |
To
suppress audiogenic epileptic seizures by cholecystokinin octapeptide (CCK-8)
injected intracerebroventricularly (i.c.v.) |
AS in
rats was markedly reduced between day 3 and 4. |
Zhang et
al, 1992 |
|
hirudin |
restenosis;
arterial injury |
adenovirus |
Virus-injured
rat carotid arteries; hirudin (from medicinal leech) is a potent protein
inhibitor of thrombin; thrombin converts fibrinogen to fibrin and also stimulates
smooth muscle cell proliferation during neointima formation in the arterial
walls |
35%
reduction in neointima formation in hirudin cDNA-transduced arterial wall
cells in vivo |
Rade et
al, 1996 |
|
HSV-tk |
arterial
injury; restenosis |
Adenovirus |
To kill
preferentially the smooth muscle cells and reduce neointima formation in the
arterial wall |
47%
reduction in I/M area ratio following local delivery of HSV-tk and systemic
ganciclovir therapy |
Ohno et
al, 1994; Guzman et al, 1994 |
|
RB |
atherosclerosis,
restenosis, arterial injury |
Adenovirus |
To
inhibit vascular smooth muscle cell (VSMC) proliferation after arterial
injury |
42%
reduction in I/M area ratio |
Chang et
al, 1995a |
|
p21 |
atherosclerosis,
restenosis, arterial injury |
Adenovirus |
To
inhibit vascular smooth muscle cell (VSMC) proliferation after arterial
injury; p21 protein functions both by inhibiting cyclin dependent kinases
(CDKs) required for the initiation of S phase and by binding to and
inhibiting PCNA |
Over-expression
of human p21 inhibited growth factor-stimulated VSMC proliferation and
neointima formation in the rat carotid artery model of balloon angioplasty in
vitro by arresting VSMCs in the G1 phase of the cell cycle |
Chang et
al, 1995b |
|
ras |
arterial
injury |
|
Transfer
of ras transdominant negative mutants to rats in which the common carotid
artery was subjected to balloon injury |
Reduced
neointimal formation |
Indolfi
et al, 1995 |
|
TGF-b |
arterial
injury |
|
TGF-b accelerates wound healing and inhibits epithelial and
smooth cell proliferation; loss of functional TGF-b receptors in cancer cells |
Inhibition
in epithelial and smooth cell proliferation |
Grainger
et al, 1995 |
|
TGF-b1 |
Rheumatoid
arthritis (RA) |
Retr |
Mice with
induced arthritis |
Effective
in lowering inflammation of joints with already established arthritis and
inhibiting the spreading of the disease to other joints in mice |
Chernajovsky
et al, 1997 |
|
Gene target or delivered |
Human disease |
Method |
Goal/rationale |
Results |
Reference |
|
LDL
receptor |
Familial
hypercholesterolemia (FH) |
Adeno |
Infusion
of adenovirus human LDL-R cDNA into the portal vein of rabbits deficient in
LDL receptor |
Human LDL
receptor protein was produced in the majority of hepatocytes that exceeded
the levels found in human liver by at least 10-fold |
Kozarsky
et al, 1994 |
|
Very low
density lipoprotein receptor (VLDL-R) |
Familial
hypercholesterolemia (FH) |
Adeno |
LDL-R
knockout mice |
A single
intravenous injection resulted in reduction in total cholesterol by
approximately 50% at days 4 and 9; marked reduction in the intermediate
density lipoprotein/low density lipoprotein (IDL/LDL) |
Kobayashi
et al, 1996; Kozarsky et al, 1996 |
|
HSV
TK+ganciclovir (GCV) |
Gliomas |
Retr |
Treatment
of rats with cerebral glioma; intratumoral stereotaxic injection of murine
fibroblasts (G418-selected) producing a retroviral vector with the HSV TK
gene |
Tretament
with GCV 5 days postinjection resulted in complete regression of gliomas |
Culver et
al, 1992 |
|
HSV TK
plus ganciclovir |
prostate
cancer |
Adenovirus
mouse |
Ganciclovir
is converted by HSV TK into its triphosphate form which is then incorporated
into the DNA of replicating mammalian cells leading to inhibition in DNA
replication and cell death; it is only viral TK, not the mammalian enzyme,
that can use efficiently phosphorylated ganciclovir as a substrate |
Subcutaneous
tumors induced by injection of RM-1 (mouse prostate cancer) cells followed by
injection of HSV TK and treatment with ganciclovir for 6 days showed
reduction in tumor volume (16% of control) and higher apoptotic index in
tumor cells |
Eastham
et al, 1996 |
|
HSV TK
plus ganciclovir |
adenocarcinoma |
|
Carcinoembryonic
antigen-producing human lung cancer cells |
Cell
type-specific expression of herpes simplex virus thymidine kinase gene |
Osaki et
al, 1994 |
|
TH |
PD |
Cat lipos
rat |
Overexpress
TH to alleviate degeneration of dopaminergic nigrostriatal neurons (DNN) in
PD rat models |
Direct
injection of lipofectin-TH expression plasmid on nigra-lesioned side
generated L-DOPA locally and decreased contralateral rotations. |
Cao et
al, 1995 |
|
rat glial
cell line-derived neurotrophic factor (rGDNF), |
PD |
AAV |
To
protect nigral dopaminergic neurons in the progressive Sauer and Oertel
6-hydroxydopamine (6-OHDA) lesion model of Parkinson's disease (back-labeled
fluorogold-positive neurons in the substantia nigra) |
94% cell
protection; 85% of tyrosine hydroxylase-positive cells |
Mandel et
al, 1997 |
|
|
|
|
|
|
|
|
Factor IX |
Hemophilia
B |
Adenovirus
mice |
Correction
of FIX defect by injection of recombinant adenovirus hosting the canine FIX
gene into hind leg muscle of mice |
Establishment
of factor IX levels in the blood in nude mice for 300 days; only for 10 days
in normal mice; transduced cells were removed by cell-mediated as well as
humoral immune responses; cyclophosphamide or cyclosporin A immunosuppression
maintained FIX protein for 5 months |
Dai et
al, 1995 |
|
Factor IX |
Hemophilia
B |
Adenovirus
mice in vivo |
Correction
of the factor IX gene |
Therapeutic
plasma levels of factor IX in mice |
Smith et
al, 1993 |
|
Factor IX |
Hemophilia
B |
Retrovirus
dogs in vivo |
Expression
of factor IX gene in liver in hemophilia B dogs |
1% of hepatocytes
were transduced with a retroviral vector carrying the canine factor IX gene
injected into the portal vein (2/3 hepatectomy was required); low therapeutic
levels of factor IX |
Kay et
al, 1993 |
|
Factor IX |
Hemophilia
B |
Adenovirus
dogs in vivo |
Establishment
of the blood serum factor IX levels in hemophilic B dogs by infection with
recombinant adenovirus vectors delivering the Factor IX gene and treatment
with cyclosporin A |
Treatment
with cyclosporin A suppressed T cell activation; T cells attack the adenovirus-transduced
cells eliminating them from the body; Cycl A tretment led to prolonged Factor
IX levels in the blood of hemophilic dogs |
Kay et
al, 1994; Fang et al, 1995 |
|
Factor IX |
Hemophilia
B |
AAV |
|
Successful
transduction of the mouse liver in vivo after a single administration;
persistent, curative concentrations of functional human factor IX can be
achieved |
Snyder et
al, 1997 |
|
Gene target or delivered |
Human disease |
Method |
Goal/rationale |
Results |
Reference |
|
Factor IX |
Hemophilia
B |
AAV |
Intramuscular
injection into hindlimb muscles of C57BL/6 mice and Rag 1 mice |
Presence
of hF.IX protein by immunofluorescence staining of muscles harvested 3 months
after injection in both strains of mice; no plasma FIX in immunocompetent
mice; Rag 1 mice which lack functional B and T cells, displayed therapeutic
levels (200-350 ng/ml) of F. IX in the plasma in addition to F.IX in muscle
cells |
Herzog et
al, 1997 |
|
Factor X |
Hemophilia
B |
Retr |
Delivery
to rat hepatocytes in vivo during liver regeneration; under control of a1-antitrypsin promoter |
10% to
43% of normal human factor X levels in 4 rats; expression remained stable for
more than 10 months in two rats |
Le et al,
1997 |
|
p53 |
breast
carcinoma MDA-MB-435 cells |
DOTMA:DOPE |
Nude mice
inoculated with breast carcinoma cells (have mutated p53) |
Iv
injection of p53 gene under control of b-actin
promoter and intron every 10-12 days resulted in more than 60% reduction in
tumor volume |
Lesoon-Wood
et al, 1995 |
|
Cdc2
kinase and PCNA |
Restenosis |
liposome-Sendai
virus |
Delivery
to rat carotids after balloon injury; inhibition of Cdc2 kinase and PCNA with
antisense oligonucleotides using PS:PC:Chol liposomes |
Whereas
antisense cdc2 kinase or PCNA alone failed to have an effect, combination of
the two antisense oligos significantly reduced neointima formation and smooth
muscle cell proliferation after balloon injury |
Morishita
et al, 1993 |
|
vascular
endothelial growth factor (VEGF) |
restenosis
|
naked
plasmid |
VEGF
promotes endothelial cell proliferation to accelerate re-endothelialization
of the artery reducing intimal thickening |
VEGF gene
expression using ELISA or RT-PCR was detected for 3-14 days after a single
transfer using a hydrogel/polymer-coated ballon angioplasty catheter to
induce simultaneous injury and delivery of plasmid to the femoral artery in
rabbits. |
Isner et
al, 1996 |
|
Kallikrein |
hypertension |
naked
plasmid |
Tissue
kallikrein is a serine proteinase cleaving the kininogen to produce the
vasoactive kinin peptide; kinin causes smooth muscle contraction and
relaxation, increase in vascular permeability, and vasodilatation |
Significant
reduction in blood pressure in spontaneously hypersensitive rats after a
single delivery of naked DNA to portal vein which lasted for 5-6 weeks. |
Chao et
al, 1996 |
|
Kallikrein |
hypertension |
Adeno |
|
Sustained
delay in the increase in blood pressure from day 2 to day 41 post injection
(iv) into spontaneously hypertensive rats; human tissue kallikrein mRNA was
detected in the liver, kidney, spleen, adrenal gland, and aorta. |
Jin et
al, 1997 |
|
Tissue
kallikrein-binding protein (HKBP) or kallistatin |
hypertension |
Adeno |
Kallistatin,
a serine proteinase inhibitor, may function as a vasodilator in vivo |
Delivery
of the human kallistatin cDNA/CMV by portal vein injection resulted in a
significant reduction of blood pressure of hypertensive rats for 4 weeks. |
Chen et
al, 1997 |
|
Human
endothelial NO synthase (eNOS) gene |
hypertension |
|
Blood
pressure is controled by the endothelium-derived nitric oxide (NO) in
peripheral vessels |
Significant
reduction of systemic blood pressure for 5 to 6 weeks. |
Lin et
al, 1997 |
|
Antisense
oligonucleotides to AT1-receptor mRNA and to angiotensinogen mRNA |
hypertension |
Liposomes |
Angiotensinogen,
produces angiotensin I in the liver (component of the renin-angiotensin
system); mutations in the angiotensinogen (AT) gene are associated with
hypertension |
Antisense
oligonucleotides delivered to rat liver via the portal vein diminished the
expression of hepatic angiotensinogen mRNA and reduced blood pressure. |
Tomita et
al, 1995; Phillips, 1997; Phillips et al, 1997 |
|
Endothelial
basic FGF (bFGF) |
hypertension |
|
Subphysiological
amounts in blood vessels of
spontaneously hypertensive rats |
Restored
the physiological levels levels of bFGF in the vascular wall and corrected
hypertension |
Cuevas et
al, 1996 |
|
Atrial
natriuretic peptide (ANP) gene |
hypertension |
|
Chronic
infusion of ANP causes natriuresis, diuresis, and hypotension |
Significant
reduction of systemic blood pressure in young hypertensive rats (4 weeks
old); the effect continued for 7 weeks. |
Lin et
al, 1995 |
|
IL-2 |
prostate
cancer |
liposomes |
Direct
transfer of the IL-2 gene under
control of the CMV promoter with or without the AAV inverted terminal repeats
|
Plasmid
DNA containing the AAV inverted terminal repeats showed 3-10 fold higher
levels of gene transfer and IL-2
expression compared with constructs lacking the AAV sequences. |
Vieweg et
al, 1995 |
|
mouse
leptin cDNA |
obesity |
Adeno |
ob/ob
mouse (which is genetically deficient in leptin and exhibits both an obese
and a mild non-insulin-dependent diabetic phenotype) |
Dramatic
reductions in both food intake and body weight, as well as in normalization
of serum insulin levels and glucose tolerance |
Muzzin et
al, 1996 |
|
rat
leptin cDNA/CMV |
obesity |
Adeno |
Wistar
rats infused with 8 ng/ml adeno/leptin cDNA for 28 days |
Animals
became hyperleptinemic; 30-50% reduction in food intake; gained only 22 g
over the experimental period versus 115-132 gained by control animals |
Chen et
al, 1996 |
|
VEGF165 |
cancer
(vascularization) |
calcium
phosphate |
Expression
of VEGF165 in rat C6 glioma cells and subcutaneous
injection of the transduced cells in athymic mice. |
Tumors
from cells expressing VEGF grew slower than tumors developed from
nontransduced C6 cells, were highly vascularized, and contained varying
degrees of necrosis and eosinophilic infiltrate |
Saleh,
1996 |
|
cGMP
phosphodiesterase-b (PDE-b) gene |
retinal
degeneration |
AAV |
To treat
retinal degeneration due to recessive mutation in the endogenous gene |
Intraocular
injection of AAV-PDE-b cDNA
increased retinal expression of immunoreactive PDE protein; treated eyes
showed increased numbers of photoreceptors and a two-fold increase in
sensitivity to light |
Jomary et
al, 1997 |
XXIX. Gene therapy of HIV
A. Mechanism of HIV-1 entry into T cells and
macrophages
Targets of human immunodeficiency virus (HIV) are
helper T cells and macrophages; macrophage-tropic HIV-1 isolates represent the
most prevalent phenotype isolated from individuals shortly after seroconversion
during the asymptomatic period of the disease; tropism is determined by
specific sequences in the third variable loop (V3 domain) of gp120 coat protein
of HIV-1. The CD4 receptor on both macrophages and T cells is the primary
receptor mediating HIV-1 entry into the cell; however, HIV-1 was unable to
infect CD4+ T cells of mice engineered to express human CD4
(reviewed by DÕSouza and Harden, 1996). Thus, a second chemokine receptor was
thought to be necessary for HIV entry into immortalized T cell lines.
The second receptor for entry of HIV-1 into T cells
and macrophages is CCR-5, a b-chemokine receptor; CCR-5 is a seven
transmembrane-domain glycoprotein of the chemokine superfamily of receptors
related to the receptor of IL-8 (G protein-coupled proteins that transduce
signals from the cell surface to the interior of cells). The b-chemokines RANTES, MIP-1a, and MIP-1b inhibited replication
of M-tropic isolates of HIV-1 and were found to be major HIV-suppressive
factors produced by CD8+ T cells. The V3 loop of gp120 determines
interaction with the chemokine receptor. CD4, in addition to providing a
docking surface for the gp120 glycoprotein of HIV-1 promotes exposure of the V3
domain on gp120 that can interact with the chemokine receptor CCR-5 (Scarlatti
et al, 1997; reviewed by DÕSouza and Harden, 1996).
A small number of individuals (1% in populations of
European descent but much lower in non-Caucasian populations) remain uninfected
despite multiple high risk exposures; such individuals have a homozygous defect
in the CCR-5 receptor gene which
consists of a 32-bp deletion in the region encoding the second extracellular
loop of the receptor; the defective protein is not detected at the cell
surface; this defect prevents the proper interaction and entry of HIV-1 into
their T cells and macrophages (Liu et al, 1996). This defect precludes
infection from HIV-1 from all routes. The disease progresses much slower in
heterozygotes for the 32-bp deletion (18% in populations of European descent)
who are not protected from HIV-1 infections. This finding offers the hope of
reconstituting the immune system of HIV-infected individuals with CD34+
stem cells from fetal cord blood or stem cells and lymphoid tissue from
individuals who carry the homozygous deletion in the CCR-5 gene, an approach to
deal with the immune rejection problems in patients with heart and kidney
transplants.
The identification of chemokine receptors and their
role in HIV-1 infections has closed a major gap in AIDS research; transgenic
animals can now be produced expressing both human CD4 and chemokine receptors
to evaluate the efficacy of AIDS therapeutics and testing vaccines; new
prophylactic or therapeutic vaccines can be designed by immunization with
portions or the entirety of CCR-5 and/or gp120 to generate appropriate
antibodies (DÕSouza and Harden, 1996). Inactivation of the CCR-5 co-receptor to
mimic the natural resistance of the CCR-5-defective individuals, in cultured
lymphocytes, rendered them viable and resistant to macrophage-tropic HIV-1
infection (Yang et at, 1997).
B. Therapeutic strategies against HIV
A number of therapy strategies emerged soon after
identification of HIV as the etiologic agent of AIDS. Virtually every stage in
the viral life cycle and every viral gene product is a potential target. Albeit major efforts for the combat of
HIV have focused on the development of antiviral drugs and preventive vaccines,
a number of studies have been aimed at eliminating HIV with gene therapy. The
intracellular immunization approach (Baltimore, 1988) has prompted the advent
of molecular tactics for inhibiting replication and infection of HIV (Trono et
al, 1989; Malim et al, 1989). Four main targets have been defined in HIV
therapeutics: (i) viral RNAs using
ribozymes and antisense RNAs; (ii) viral
proteins using RNA decoys, trans-dominant viral proteins, intracellular
single-chain antibodies, and soluble CD4;
(iii) infected cells aimed at eliminating those with transfer and
expression of suicide genes; and (iv) the
immune system by in vivo immunization (see Corbeau et al, 1996). Such gene
therapeutic approaches can be combined with potent antiretroviral drugs
especially the potent reverse transcriptase and protease inhibitors (Junker et
al, 1997).
The elucidation of the chemokine receptor mechanisms
for entry of HIV-1 into T cells and macrophages provides new tactics for
intervention at the level of interaction of gp120 with CCR-5. Inactivation of
the CCR-5 gene might be achieved (i) with triplex oligonucleotide
technologies once critical transcription factor binding sites in the regulatory
region of the gene have been determined;
(ii) with saturation of the blood of infected individuals with ligands,
selected from peptide libraries, that block the extracellular domains of the
CCR-5 receptor and preclude interaction with gp120; (iii) with antagonists of RANTES (see above) that lack chemotactic
activity but can block HIV infections (Arenzana-Seisdedos et al, 1996).
Specificity for the ablation of HIV Tat-expressing
cells has been achieved through the use of the promoter element from the long
terminal repeat (LTR) of HIV (Venkatesh et al, 1990; Caruso et al, 1992).
C. Gene therapy against HIV in cell culture
Strategies for HIV gene therapy include the
inactivation of the CCR-5 coreceptor which is accomplished by targeting a
modified CC-chemokine to the endoplasmic reticulum to block the surface
expression of newly synthesized CCR-5 (Yang et al, 1997). A different gene
therapy strategy proposed is targeting Tat, an early regulatory protein that is
critical for viral gene expression and replication and which transactivates the
LTR of HIV-1 via its binding to the
transactivation response element (TAR); Tat also superactivates the HIV-1
promoter via activation of NF-kB in a pathway involving
protein kinase C and TNF-a; combinations of
the NF-kB inhibitors, pentoxifylline and Go-6976, with a
stably expressed anti-Tat single-chain intracellular antibody suppressed HIV-1
replication and LTR-driven gene expression (Mhashilkar et al, 1997). Production
of recombinant retrovirus containing the HSV-tk gene coupled to the HIV-2 promoter and Tat responsive region (TAR)
has been used on human and mouse cells in culture for the specific elimination
of HIV Tat-expressing cells; since the HIV-2 promoter can sustain a
considerable level of basal expression in the absence of its activator, Tat, a
number of modifications were made to the HIV-2 promoter in order to minimize
toxicity to non-infected cells.
Retroviruses export unspliced, intron-containing RNA
to the cytoplasm of infected cells despite the fact that intron-containing
cellular RNAs cannot be exported; this export pathway is a critical step in the
HIV-1 life-cycle. In HIV-1 this is accomplished through an interaction between
the viral regulatory Rev protein and the Rev response element (RRE) RNA. In the
absence of Rev, these intron-containing HIV-1 RNAs are retained in the nucleus.
The nuclear export sequence (NES) LQLPPLERLTL has been identified on Rev that
is responsible for its export to the cytoplasm (see Boulikas, 1998, this volume
for more details). Targeting of Rev has provided a framework for novel interventions
to reduce virus production in the infected host. Because disruption of either
Rev or the RRE will completely inhibit HIV-1 replication, an anti-HIV-1
intracellular immunization strategy was developed based on RRE region-specific
hammerhead ribozymes and on the intracellular expression of an anti-HIV-1 Rev
single chain variable fragment (Sfv), which specifically targets the Rev
activation domain. This combination resulted in a potent inhibition of HIV-1
replication in cell culture that holds promise as a future therapeutic regimen
(Duan et al, 1997). To disable Rev function, primary T cells or macrophages
were transduced with a recombinant AAV carrying an anti-Rev single-chain
immunoglobulin (SFv) gene or an RRE decoy gene or with combinations of the two
genes to disrupt the interaction between Rev and the RRE; when the transfected
cells were then challenged by either clinical or laboratory HIV-1 isolates,
this genetic antiviral strategy effectively inhibited infection (Inouye et al,
1997).
A synergic effect of anti-Tat and anti-Rev molecules
was found when the RRE sequence was cloned 3' to a tat transdominant negative
mutant (tat22/37) gene; for this strategy Jurkat cells were transduced with the
recombinant retroviruses containing the tat22/37 gene and an RRE decoy in
different positions or the tat22/37 and the RevM10 transdominant negative
mutant genes to produce monoclonal and polyclonal cultures expressing the
integrated genes; none of these recombinant constructs inhibited virus
replication at a high multiplicity of infection (MOI) and combination of tat
and rev mutants was ineffective in inhibiting HIV-1 replication at both low and
high MOIs; however, at a low MOI, two cell clones containing tat22/37 and the
RRE decoy in 3' position showed a long lasting protection against virus
replication and in two cell clones, expressing the RevM10 mutant alone, the
HIV-1 replication was efficiently blocked (Caputo et al, 1997).
IL-16 is secreted by activated CD8+ T
lymphocytes and acts on CD4+ T lymphocytes, monocytes and
eosinophils. Recently, the C-terminal 130-amino acid portion of IL-16 was shown
to suppress HIV-1 replication in vitro. HIV replication was inhibited by as
much as 99% in HIV-1-susceptible CD4+ Jurkat cells following
transfection and expression of the C-terminal 130-amino acid portion of IL-16;
the mechanism of HIV-1 inhibition by IL-16 was not at the level of viral entry
or reverse transcription, but at the expression of mRNA (Zhou et al, 1997).
The in vitro antiviral efficacy of two gene therapy strategies
(trans-dominant RevM10 and Gag antisense RNA) were tested in combination with
the clinically relevant reverse transcriptase inhibitors AZT and ddC or the
protease inhibitor indinavir by Junker et al (1997). The combination of RevM10
or Gag antisense RNA with antiviral drugs inhibited HIV-1 replication 10-fold
more effectively than the single antiviral drug regimen alone in retrovirally
transduced human T cell lines after inoculation with high doses of HIV-1HXB3 in
the presence or absence of inhibitors. The level of anti-HIV-1 activity of the
psi-gag antisense sequence correlated with the length of the antisense
transcript and maximal anti-HIV efficacy was observed with complementary
sequence more than 1,000 nucleotides long, whereas transcripts less than 400
nucleotides long failed to inhibit HIV-1 replication in a T-cell line and in
primary peripheral blood lymphocytes (Veres et al, 1996).
The HSV-1 and HSV-2 virion host shutoff gene (vhs),
each of which encodes a protein that accelerates the degradation of mRNA
molecules leading to inhibition of protein synthesis, was used as a suicide
gene for HIV gene therapy to inhibit replication of HIV; an infectious HIV
proviral clone was cotransfected into HeLa cells together with the vhs gene
under control of the CMV IE promoter; HSV-1 vhs gene driven by the HIV LTR
inhibited HIV replication more than 44,000-fold in comparison to a mutant vhs
gene (Hamouda et al, 1997).
The specificity of the Vpr protein for the HIV-1
virus particle was exploited to develop an anti-HIV strategy targeting the
events associated with virus maturation; nine cleavage sites of the Gag and
Gag-Pol precursors were added to the C terminus of Vpr and the chimeric Vpr
genes were introduced into HIV-1 proviral DNA to assess their effect on virus
infectivity; the chimeric Vpr containing the cleavage sequences from the
junction of p24 and p2 completely abolished virus infectivity (Serio et al,
1997).
D. Gene therapeutic strategies for AIDS
A gene therapy strategy to combat acquired immunodeficiency
syndrome (AIDS) in individuals already infected with HIV-1 has been directed
toward GM-CSF mobilized peripheral blood CD34+ cells isolated from
HIV-1-infected individuals and transduced with retroviral vectors containing
three different anti-HIV-1-genes: (i)
the Rev binding domain of the RRE (RRE decoy) carrying also the NeoR
gene, (ii) a double hammerhead
ribozyme vector targeted to cleave the tat and rev transcripts (L-TR/TAT-neo),
and (iii) the RevM10
transdominant negative mutant gene. After selection with G418, transduced
cultures displayed up to 1,000-fold inhibition of HIV-1 replication following
challenge with HIV-1 (Bauer et al, 1997).
A safe strategy to gene therapy of AIDS aimed at
reducing the virus load in HIV-1-infected individuals was developed by Nakaya et al (1997). The Rev protein shifts
RNA synthesis to viral transcripts by binding to the RRE within the env gene.
Anti-Rev chimeric RNA-DNA oligonucleotides, consisting of 29 or 31 nucleotides,
were designed to inhibit the Rev regulatory function and as decoys on HIV-1
replication; anti-Rev oligonucleotides containing an RNA "bubble"
structure of 13 oligonucleotides (that bound to Rev with high affinity) were
found to reduce more than 90% of the HIV-1 production from infected human
T-cell lines and from healthy donor-derived peripheral blood mononuclear cells;
control oligonucleotides without the bubble structure, that bound to Rev with
considerably less affinity, did not reduce HIV-1 production (Nakaya et al,
1997).
E. Gene therapy of HIV with ribozymes
Antisense, ribozyme, or RNA aptamers, must be
efficiently transcribed, stabilized against rapid degradation, folded
correctly, and directed to the part of the cell where they can be most
effective. Among (i) antisense RNA, (ii) hairpin and hammerhead ribozymes, and
(iii) RNA ligands (aptamers) for Tat and Rev RNA binding proteins, Rev-binding
RNAs but not the others, efficiently
blocked HIV-1 gene expression when tested in expression cassettes based on the
human tRNA(met) and U6 snRNA promoters. In situ localization of both tRNA and
U6 promoter transcripts revealed primarily punctate nuclear patterns (Good et
al, 1997).
Isolation of an RNA aptamer that can bind with high
affinity to Tat protein, including two TAR-like RNA motifs for higher-affinity
binding to Tat peptides provided a novel therapeutic strategy against HIV
(Yamamoto et al, 1998, this volume).
A hairpin ribozyme specific for simian
immuno-deficiency virus (SIV) and HIV-2 was used to inhibit viral replication
in T lymphocytes derived from transduced CD34+ progenitor cells.
Retroviral transduction of rhesus macaque CD34+ progenitor cells
with the SIV-specific ribozyme ÒgeneÓ and the selectable marker neomycin
phosphotransferase (NeoR) gene, followed by expansion and selection
with the neomycin analog G418, rendered CD4+ T cells (derived from
the transduced CD34+ hematopoietic cells) highly resistant to
challenge with SIV; CD4+ T cells exhibited up to a 500-fold decrease
in SIV replication, even after high multiplicities of infection (Rosenzweig et
al, 1997).
Monomeric (targeting one site) and multimeric
(targeting nine highly conserved sites) hammerhead ribozyme genes both directed
against the HIV-1 envelope (Env) mRNA were stably expressed in a human CD4+
T lymphocyte cell line; whereas the monomeric ribozyme caused a delay in HIV-1
replication, the multimeric ribozyme caused complete inhibition in HIV-1
replication for up to 60 days after infection (Ramezani et al, 1997).
A multitarget ribozyme of an unusually large size
(3.7 kb) had a notable antiviral potential which may lead to a gene therapy
approach; this ribozyme, directed against multiple sites within the gp120
coding region of HIV-1 RNA, co-localized with unspliced HIV-1 pre-mRNA and/or
genomic HIV-1 RNA in the nucleus catalyzing the reduction of all spliced and
unspliced HIV-1 RNAs; the same ribozyme functioned as a mRNA for a chimeric
CD4/Env protein in the cytoplasm (Paik et al, 1997).
Antisense oligonucleotides for HIV (anti-TAT) coupled
with the influenza HA-2 protein-derived N-terminal fusogenic peptide have
improved 5- to 10-fold their antiviral potency (Bongartz et al, 1994).
F. Novel therapies based on HIV vectors
A major drawback in the gene therapy of HIV has been
the poor efficiency of gene transfer in vivo; especially important for HIV,
most recombinant retroviruses transduce poorly cells harboring HIV, such as
monocytes and macrophages, which are nondividing. Transfection of a fibroblast
cell line with a HIV vector, bearing a deletion of the major packaging sequence
has provided an HIV-1 packaging cell line which produced a large amount of
HIV-1 structural proteins and non-infectious mature particles with normal
reverse transcriptase activity but lacked RNA. When this cell line was stably
transfected with an HIV-1-based retroviral vector virions were produced capable
of transducing CD4-positive cells with efficiencies up to 105 cells per ml (Corbeau et al, 1996).
For more details see VI. HIV vectors for gene
transfer.
E. Clinical trials involving HIV
Gene therapy approaches directed against viral
targets have been successful at inhibiting HIV-1 replication in cultured human
cells; however, clinical trials involving gene therapy directed at HIV-1 are
still in their infancy (reviewed by Gottfredsson and Bohjanen, 1997). Treatment
of HIV-1 infections using gene therapy for intracellular immunization
strategies is currently being tested in clinical trials. The first RAC-approved
phase I study on HIV was to evaluate the safety of cellular adoptive
immunotherapy using genetically modified CD8+ HIV-specific T cells
in HIV seropositive individuals (protocol #15, Appendix 1). The significant number of ongoing clinical trials
directed against HIV can be found on protocols 24, 40, 47, 52, 55, 73, 78, 79,
81, 85, 86, 88, 91, 94, 105, 108, 116, 117, and 168 in Appendix 1.
XXX. Familial hypercholesterolemia (FH)
A. Molecular mechanisms for FH
FH is an autosomal dominant disorder caused by a
defect in the low density lipoprotein (LDL) receptor gene. LDL receptor on
hepatocytes clears LDL from the serum; patients with one abnormal LDL receptor
allele suffer premature coronary disease and myocardial infarction whereas
patients with two abnormal alleles have extraordinarily high levels of
cholesterol and accelerated atherosclerosis developing life-threatening
coronary artery disease in early childhood. One type of mutation in the LDL
receptor gene has incurred by Alu-Alu recombination deleting several exons and
thus producing a truncated receptor molecule with loss of function (Lehrman et
al, 1987).
Treatment of patients with FH is accomplished through
the administration of drugs that stimulate the expression of LDL receptor from
the normal allele in order to lower the plasma level of LDL; however this
regimen is not effective for the treatment of homozygous deficient patients,
especially those that retain less than 2% of residual LDL-R activity. A more
direct approach has been to correct the deficiency of hepatic LDL receptor by
transplanting a liver that expresses normal levels of LDL receptor; three
patients that survived this procedure normalized their serum LDL-cholesterol
(see Wilson et al, 1992 for references).
B. Gene therapy of FH: experiments in cell culture
A transmissible retroviral vector containing a
full-length human cDNA for the LDL-R was used to infect fibroblasts from the
Watanabe heritable hyperlipidemic (WHHL) rabbit which expressed the human
receptor efficiently, as indicated by RNA and ligand blotting studies
(Miyanohara et al, 1988). The number of hepatocytes that could be transduced by
retroviruses bearing the therapeutic gene was one of the limiting steps that
could impair the success of this strategy; addition of human hepatocyte growth
factor (HGF) to hepatocytes allowed marked increase in the transduction
efficiency in mouse (up to 80%) and human (40%) hepatocytes (Pages et al,
1995). Transduction of the human LDL-R cDNA under the transcriptional control
of the liver-type pyruvate kinase promoter allowed high and tissue specific
expression of the gene in primary hepatocytes; a second vector with a
housekeeping promoter corrected the LDL-R deficiency in fibroblasts from a FH
patient (Pages et al, 1996b).
C. Gene therapy of FH: experiments on animals
Liver is the preferred target organ for gene
transfer-mediated treatment of FH. The presence of unique receptors at the
cellular membrane of hepatocytes forms the basis for transfer strategies based
on receptor targeting (reviewed by Sandig and Strauss, 1996). An authentic
animal model used in FH gene therapy is the Watanabe heritable hyperlipidemic
rabbit which is homozygous for FH and has a deletion in a cysteine-rich region
of the LDL receptor gene; this renders the receptor completely dysfunctional
(Yamamoto et al, 1986); these animals display high levels of serum cholesterol,
diffuse atherosclerosis, and die prematurely. Liver tissue was removed from
such animals and the cultured hepatocytes were transduced with retroviruses
carrying the rabbit LDL receptor
gene; the genetically corrected cells were transplanted into the animal from
which they were derived. This treatment resulted in a 30-40% reduction in serum
cholesterol that lasted for at least 4 months (Chowdhury et al, 1991).
The portal vein has been used for liver targeting in
New Zealand White (NZW) rabbits. Expression of lacZ was obtained in virtually
all hepatocytes within 3 days (but was undetectable by 3 weeks) after transfer
of the lacZ reporter gene under the control of different promoters using
recombinant, replication-defective adenoviruses which were infused into the
portal circulation. An adenovirus human LDL-R cDNA was then infused into the
portal vein of rabbits deficient in LDL receptor and demonstrated human LDL
receptor protein in the majority of hepatocytes that exceeded the levels found
in human liver by at least 10-fold. Transgene expression diminished to
undetectable levels within 3 weeks (Kozarsky et al, 1994).
To demonstrate feasibility of the ex vivo FH therapy,
three baboons underwent a partial hepatectomy, their hepatocytes were isolated,
cultured, transduced with a retrovirus containing the human LDL-R gene, and
infused via a catheter that had been placed into the inferior mesenteric vein
at the time of liver resection (Grossman et al, 1992). Gene replacement therapy
of human LDL receptor gene into the murine model of FH transiently corrected
the dyslipidaemia; long-term expression of the therapeutic gene was
extinguished by humoral and cellular immune responses to LDL receptor which
developed and possibly contributed to the associated hepatitis (Kozarsky et al,
1996).
As an alternative strategy, expression in the liver
of the very low density lipoprotein
(VLDL) receptor, which is homologous to the LDL receptor but has a
different pattern of expression, using recombinant adenoviruses corrected the
dyslipidaemia in the FH mouse; transfer of the VLDL receptor gene circumvented
immune responses to the transgene leading to a higher duration of metabolic
correction (Kozarsky et al, 1996).
Replication-defective adenovirus-mediated gene transfer
of the very low density lipoprotein receptor (VLDL-R) driven by a
cytomegalovirus promoter in LDL-R knockout mice by a single intravenous
injection resulted in reduction in total cholesterol by approximately 50% at
days 4 and 9 and returned toward control values on day 21. Lowering in total
cholesterol was mediated by a marked reduction in the intermediate density
lipoprotein/low density lipoprotein (IDL/LDL) fraction. In treated animals,
there was also an approximately 30% reduction in plasma apolipoprotein (apo) E
accompanied by a 90% fall in apoB-100 on day 4 of treatment. Thus,
adenovirus-mediated transfer of the VLDLR gene induced high-level hepatic
expression of the VLDL-R, resulted in a reversal of the hypercho-lesterolemia,
and enhanced the ability of these animals to clear IDL (Kobayashi et al, 1996).
The human apolipoprotein E (apoE) gene driven by the cytochrome P450 1A1 promoter produced
transgenic mice where robust expression of apoE depended upon injection of the
inducer b-naphthoflavone; a transgenic line exhibiting basal
expression of apoE in the absence of the inducer upon breeding with
hypercholesterolemic apoE-deficient mice produced animals which were as
hypercholesterolemic as their nontransgenic apoE-deficient littermates in the basal
state. When injected with the inducer, plasma cholesterol levels of the
transgenic mice decreased dramatically. The inducer could pass transplacentally
and via breast milk from an injected mother to her suckling neonatal pups,
giving rise to the induction of human apoE in neonate plasma (Smith et al,
1995).
Other potential approaches for the treatment of FH
include transfer of the apolipoprotein
(apo) B mRNA editing protein which
is an essential catalytic component of the apoB mRNA editing enzyme complex.
This enzyme deaminates a cytidine residue at nucleotide position 6666 in apoB
mRNA, converting it to uridine leading to the production of apoB-48 in place of
apoB-100. The editing protein exists as a homodimer and can be used as a
therapeutic agent to reduce apoB-100; somatic gene transfer of the editing
protein cDNA was highly effective in lowering plasma low density lipoproteins
(Chan et al, 1996).
D. Clinical trials on FH
The first clinical trial for gene therapy in the
liver, based on ex vivo gene delivery, has shown both the feasibility and the
limits of the current technology. According to this protocol, cultured
hepatocytes from patients homozygous for mutations in the LDL receptor gene
were proposed to be transduced ex vivo with the LDL receptor gene and
transplanted by infusion into the portal vein of the patient (Wilson et al,
1992). A 29 year old woman, with homozygous FH, was transplanted with
autologous hepatocytes that were genetically corrected with recombinant
retroviruses carrying the LDL receptor gene. She tolerated the procedures well
and in situ hybridization of liver tissue four months after therapy revealed
evidence for engraftment of transgene-expressing cells. The patient's LDL/HDL
ratio declined from 10-13 before gene therapy to 5-8 following gene therapy, an
improvement which remained stable for the 18-month duration of the treatment
(Grossman et al, 1994).
Five patients, ranging in age from 7 to 41 years,
with homozygous FH, underwent hepatic resection and placement of a portal
venous catheter; primary hepatocyte cultures from the resected liver were
transduced with the human LDL-R gene with a retrovirus and the cells were then
transplanted into the liver through the portal venous catheter. The
liver-directed ex vivo gene therapy was accomplished safely and, in a child
patient, normalization of cholesterol levels took place; LDL-R expression was
detected in a limited number of hepatocytes of liver tissue four months after
hepatocyte implantation from all five patients whereas significant and
prolonged reductions in LDL cholesterol were demonstrated in three of five
patients. The major obstacle in this first trial was the level and duration of
LDL-R expression which Òprecluded a broader application of liver-directed gene
therapy without modifications supporting substantially greater gene transferÓ
(Grossman et al, 1995; Raper et al, 1996).
XXXI. Angiogenesis and human disease
A. Formation of new blood vessels (angiogenesis)
Blood vessels, named in anatomy on the basis of their
luminar diameter, branching, position and organ supplied, are formed with their
proper diameter in the embryo before the heart starts beating. During a complex
developmental program leading to formation of the cardiovascular system
angioblasts are derived from mesoderm; this process requires the action of
basic fibroblast growth factor (bFGF) and vascular endothelial growth factor
(VEGF). Angioblasts then differentiate into endothelial cells which undergo
proliferation, migration, and morphologic organization in the context of their
surrounding tissues to form the blood vessels (reviewed by Folkman and DÕAmore,
1996).
Angiogenesis virtually never occurs physiologically
in adult tissues except in the ovary, the endometrium and the placenta. During
this process, which is also essential in pathological situations such as wound
healing and inflammation, formation of new microvessels from parent
microvessels takes place. The process involves remodeling of the basement
membrane and interstitial extracellular matrix (ECM) using degrading proteases
produced by the endothelial cells and other adjacent cells, and the synthesis
of ECM. The endothelial cells are able to synthesize and secrete cytokines. The
angiogenesis is strictly controlled by a redundancy of pro- and anti-angiogenic
paracrine peptide molecules. The tumor suppressor p53 protein has been shown to
control the expression and synthesis of two anti-angiogenic factors (reviewed
by Norrby, 1997).
Blood vessels in embryogenesis are formed in two
stages: (i) during vasculogenesis
newly differentiated endothelial cells coassemble into tubules that further
fuse forming the primary vasculature of the embryo; (ii) angiogenesis, involves sprouting of new capillary vessels
from preexisitng vasculature, also occurring into initially avascular organs
such as the brain and kidney, and remodeling of the primary vascular network
into large and small vessels (Davis et al, 1996). During tumor angiogenesis
endothelium gives rise to new vessels which requires (i) dissolution of the basement membrane, (ii) migration and (iii)
proliferation of endothelial cells, (iv)
formation of the vascular loop, and (v)
formation of a new basement membrane; VEGF and PDGF act directly on endothelial
cells and may also activate inflammatory cells to synthesize angiogenic factors
such as SPARC (Secreted Protein Acidic and Rich in Cysteine) (reviewed by
Jendraschak and Sage, 1996).
Additional angiogenic factors include bFGF,
angiopoietin-1, and thymidine phosphorylase whereas naturally occurring
inhibitors of angiogenesis, other than angiostatin and vasculostatin include
thrombospondin (see below, reviewed by Bicknell and Harris, 1996). Tissue
factor (TF), which is the principal cellular initiator of coagulation and its
deregulated expression has been implicated in cancer and inflammation has a
documented role in tumor-associated angiogenesis (reviewed by Carmeliet et al,
1997).
In the adult, angiogenesis accompanies the
pathological processes of neovascularization during tumor growth, wound
healing, and diabetic retinopathy and the normal processes of ovulation and
placental development. There is a difference between vasculogenesis and
angiogenesis: vasculogenesis occurs only during early embryogenesis resulting
in the formation of the primordia of the heart and large vessels; on the other
hand, angiogenesis is required for both the embryonic and postnatal tissues
(for references see Davis et al, 1996). These processes involve two families of
receptor tyrosine kinases, the Flt-1, Flk-1 receptors which interact with VEGF
and the TIE (or Tek) receptor tyrosine kinases which are stimulated by
angiopoietin-1 (see below).
B. Vascular endothelial growth factor (VEGF)
VEGF (also known as vascular permeability factor,
VPF) is a secreted protein related to PDGF which has been cloned (Keck et al,
1989; Leung et al, 1989; Abraham et al, 1991). VEGF is a mitogen for
endothelium required for the differentiation of mesoderm-derived angioblasts
into endothelial cells which form de novo
vessels during embryogenesis, and in pathological states such as cancer and
wound healing. VEGF is required for both vasculogenesis and angiogenesis.
Targeted disruption of the VEGF gene
in mice resulted in delayed differentiation of endothelial cells, impairment of
vasculogenesis and angiogenesis and death at 8.5 to 9 days of gestation
(Carmeliet et al, 1996; Ferrara et al, 1996).
VEGF is a tumor secreted protein but also is
synthesized in specialized endothelial and epithelial cells (primarily in
alveolar walls of the lung, kidney glomeruli, heart, and adrenal gland, and
secondarily in liver, spleen, and in autonomic nerves supplying the smooth
muscle layers of the gastrointestinal tract) and in embryonic tissues; placenta
expresses a related protein, placenta growth factor (PGF). The expression of
VEGF in corpus luteum in primate ovaries is under hormonal control (reviewed by
Senger et al, 1993). The positive staining for VEGF in normal corpus luteum is
coincidental with the angiogenesis incurring concurrently with development and
differentiation in this tissue; on the other hand, the expression of VEGF in
lung, kidney, heart, GI tract, and adrenals, where angiogenesis is not normally
occurring, might serve to maintain a certain density of endothelial cells in
these tissues as well as for inducing and maintaining the base-line vascular
permeability for plasma proteins, including antibodies and lipoproteins
(reviewed by Senger et al, 1993).
VEGF is produced in four isoforms by alternative
splicing giving polypeptides of 210, 189, 165, and 121 amino acid residues
(Leung et al, 1989; Keck et al, 1989; Abraham et al, 1991); VEGF is
overexpressed in about 70% of hepatocellular carcinomas and other tumors
(Suzuki et al, 1996).
At least three pathophysiological roles for VEGF have
been unraveled: (i) Primarily, VEGF
induces angiogenesis (Plate et al, 1992; Shweiki et al, 1992), i.e. sprouting
of capillaries from preexisting blood vessels, a process occurring during
embryonic development but also under pathological conditions such as wound
healing, eye disease, and tumor growth; VEGF expression is an early event
during carcinogenesis and is also involved in metastasis (Liotta et al, 1991). (ii) VEGF is a mitogenic factor
primarily for vascular endothelial cells stimulating phospholipase C after high
affinity binding to the receptor. (iii) VEGF
also stimulates migration of monocytes across the endothelial cell monolayer.
Other endothelial growth factors with angiogenic activity are the
platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF)
(reviewed by Folkman and Klagsbrun, 1987).
C. VEGF receptors
The potential targets of secreted VEGF are proximal
cells expressing VEGF receptors. Three VEGF receptors have been identified:
(i) A fms-like tyrosine kinase, the Flt-1
protein, (also called VEGF-R1), which is a transmembrane receptor with seven
immunoglobulin-like domains in the extracellular region, a single
transmembrane-spanning region, and a tyrosine kinase sequence (de Vries et al,
1992); Flt-1 is expressed in endothelial cells but is not found in
non-endothelial cells (Shweiki et al, 1992). Disruption of the flt-1 gene permits differentiation of
endothelial cells but interferes with a later stage of vasculogenesis causing
thin-walled blood vessels with larger diameter and the death of mouse embryos
at day 9 (Fong et al, 1995).
(ii) The
Flk-1, (also called VEGF-R2), also a tyrosine kinase receptor. Flk-1 is
endothelial cell-specific, already expressed in the angioblasts of the blood
islands in early mouse embryos, progenitors of vascular endothelial cells. The
Flk-1, (fetal liver kinase-1) was cloned independently and had been suggested
to be involved in hematopoietic stem cell renewal. Flk-1 exhibits a high
affinity for VEGF (Kd=10-10 M) and is a
major regulator of angiogenesis and vasculogenesis (Millauer et al, 1993).
Hybridization of a parasagittal section of mouse embryos, at 14.5 days of
development, with a single-stranded antisense DNA probe comprising the Flk-1
extracellular domain showed high levels of hybridization in the endothelial
lining of the atrium in heart, endothelial cells in the peribronchial
capillaries (but not bronchial epithelium) in the lung, the menings, and at the
inner surface of the atrium and the aorta; this expression seemed to be
restricted to endothelial cells in blood vessels and capillaries. Flk-1 was
also expressed in capillaries in brain at postnatal day 4 (Millauer et al,
1993).
(iii) The
Flt-4 (or VEGF-R3) (for references see Suri et al, 1996).
Transgenic mouse embryos with targeted disruption of
the VEGF-R1 and R2 genes have unraveled the different roles these receptors
undertake during development: Flt-1 regulates normal endothelial cell-cell or
cell-matrix interactions during vascular development (Fong et al, 1995) and
Flk-1 is required for the formation of blood islands and vascularization of the
embryo; disruption of the flk-1 gene
interfered with differentiation of endothelial cells leading to death of
embryos at day 8.5 to 9.5 (Shalaby et al, 1995 ).
The temporal and spatial expression of VEGF exactly
correlated with the expression pattern of Flk-1 in all tissues and
developmental stages in mice examined suggesting a pivotal role of the growth
factor/receptor duet in development and differentiation of the vascular system;
their expression was high during development and declined in adulthood
(Millauer et al, 1993).
Although VEGF expression showed a moderate increase
during tumor development in pancreatic islets of Langerhans, the expression of
the flt-1 and flk-1 receptor genes remained unchanged during pancreatic
carcinogenesis in an animal model (transgenic mice having a targeting
expression of the SV40 T antigen gene under control of the insulin gene
regulatory regions in b-cells of the pancreatic islets) (Christofori et al,
1995).
D. Angiopoietin and its receptors
Although the TIE1 and TIE2 receptor tyrosine kinases
were found to be involved in vasculogenesis already in 1992, angiopoietin-1,
the natural ligand of TIE2 was only recognized in 1996 by secretion-trap
expression cloning; according to this method entire cDNA libraries were
transfected into large numbers of cells and the cell that contained the desired
cDNA was uniquely marked on its surface by expression of the desired ligand;
this rare cell was isolated within a background of millions of cells and was
expanded leading to the isolation of the ligand-encoding cDNA (Davis et al,
1996). This finding represents a significant milestone in the effort to
understand the molecular mechanisms that govern formation of blood vessels with
important implications for cancer targeting by inhibition of angiogenesis.
Targeted disruption of the angiopoietin-1 gene in
mice (Suri et al, 1996) gave defects in the blood vessels reminiscent of those
caused by disruption in its receptor TIE2 (Dumont et al, 1994); these defects
were mainly in the endocardium and myocardium but also generalized defects in
vascular complexity leading to the death of mice by day 12.5 of gestation.
These studies have established the important role of angiopoietin in mediating
reciprocal interactions between the endothelium and surrounding matrix and
mesenchyme (Suri et al, 1996). However, angiopoietin-1 does not display the
mitogenic activities of VEGF on endothelial cells. The efficacy of disrupting
the binding of angiopoietin to its ligand in tumor cell growth remains to be
established.
A missense mutation in the receptor tyrosine kinase
TIE2, resulting in a Arg to Trp substitution at position 849 of the kinase
domain, was found in patients from two unrelated families suffering with venous
malformations; this disorder is characterized by the presence of veins with
large lumens lined by a monolayer of endothelial cells but with thin walls
because of a reduction in smooth muscle layers. Expression of the wild-type and
mutant TIE2 in insect cells has shown that the mutation caused a 6 to 10-fold
increase in autophosphorylation activity of TIE2; thus, this mutation causes a
defect in vascular remodeling and the overproliferation of endothelial cells
without a complementary increase in smooth muscle layers (Vikkula et al, 1996).
This finding demonstrates the significance of the TIE2 signaling pathway for
endothelial cell-smooth muscle cell communication in venous morphogenesis.
E. Involvement of VEGF in tumor angiogenesis
Important for tumor growth are alterations in
extracellular matrix. Solid tumors are composed of the malignant cells and the
supportive vascular and connective tissue stroma whose synthesis is induced by
the malignant cells. Fibrin is an essential component of the connective tissue
stroma upon which tumor cells depend for their oxygen/nutrient supply and waste
disposal. Fibrin gel provides solid tumors with a matrix which favors the
ingrowth of macrophages, fibroblasts, and endothelial cells; these compose,
along with neoangiogenesis vessels and elements found in normal connective
tissue, the mature tumor stroma. Fibrinogen and other plasma proteins are found
in increased amounts in tumor stroma and in healing wounds compared with normal
stroma of most tissues; deposition of fibrin at the extravascular site requires
a previous increase of permeability of the microvasculature thought to be
mediated by VEGF (Senger et al, 1993).
VEGF is the factor largely responsible for leakiness
and hyperpermeability of tumor blood vessels; leakage of plasminogen (which is
converted to plasmin) and of fibrinogen and clotting factors II, V, VII, X, and
XIII (responsible for the formation of the extravascular fibrin gel) through
postcapillary venules in tumor cells is responsible for generating the
supporting matrix for fibroblast migration, angiogenesis, and fibroplasia
(reviewed by Senger et al, 1993). Migration of macrophages and fibroblasts in
the fibrin gel in tumors is determined by fibrinogen concentration and Factor
XIII crosslinking of a and g chains. Tumor cells as
well as inflammatory cells in healing wounds produce a higher concentration of
degradative proteases for extracellular matrix but also protease inhibitors
which explains the resistance toward degradation of the fibrin gel in solid
tumors (reviewed by Senger et al, 1993).
The mechanism of overexpression of VEGF in solid tumors might involve its
induction by hypoxia (Shweiki et al, 1992); the rapid proliferation of the
cells in the center of the tumor induces an increase in the interstitial
pressure and may lead to closure of capillaries by compression; inefficient
vascular supply, including the compensatory development of collateral blood
vessels in ischaemic tissues, leads to neovascularization via production of
VEGF. A clustering of capillaries alongside VEGF-producing cells in a subset of
glioblastoma cells immediately proximal to necrotic foci have been observed in
intracranial brain neoplasms obtained from surgical specimens; this was thought
to be the result of a local angiogenic response elicited by VEGF (Shweiki et
al, 1992). VEGF expression by hypoxia was also induced in skeletal muscle
myoblasts, in the fibroblast mouse L cell line, and in cells from rat heart
muscle (Shweiki et al, 1992).
Targeting of VEGF
gene leading to its transcriptional inactivation (e.g. via triplex-forming
oligonucleotides or antisense vectors) is expected to limit growth in solid
tumors via inhibition in neo-vascularization; the prolonged sustenance of
hypoxia in the center of the tumor is also expected to induce p53. An important
concept to understand is that tumor angiogenesis results from a balance between
angiogenic and anti-angiogenic factors. Expression of VEGF165 in rat C6 glioma cells and
subcutaneous injection of the transduced cells in athymic mice has shown that
tumors from cells expressing VEGF
grew slower than tumors developed from nontransduced C6 cells, were highly
vascularized, and contained varying degrees of necrosis and eosinophilic
infiltrate (Saleh, 1996).
VEGF plays an important role not only in
carcinogenesis but also restenosis (see below). VEGF promotes endothelial cell
proliferation to accelerate re-endothelialization of the artery reducing
intimal thickening; up-regulation of VEGF is the desired effect for treatment
of restenosis (Asahara et al, 1996; Isner et al, 1996a). The transfer of the
VEGF gene demonstrates a special mission of gene therapy: how to treat one
human disease by upregulating the expression of a specific gene while treating
a different disease by downregulating the expression of the same gene.
Targeting is important. Also, exploring the molecular mechanisms affected by
the transfer and overexpression of the cDNA of a gene, in all aspects and at
their entire spectrum, is essential for a successful gene therapy application.
F. Transfer of the VEGF gene in ischemia
VEGF gene transfer can improve blood supply to the
ischaemic limb and is a promising approach for the treatment of acute limb
ischemia. In a gene therapy approach for tissue ischemia, the VEGF165 cDNA under the
transcriptional control of the HSV immediate-early 4/5 promoter was used to
transduce BLK-CL4 fibroblasts resulting in the secretion of high levels of
biologically active VEGF; when the transduced cells were resuspended in
basement membrane extract (matrigel) and were injected subcutaneously into
syngeneic C57BL/6 mice they showed a strong angiogenic response (Mesri et al,
1995). Regional angiogenesis was induced in nonischemic retroperitoneal adipose
tissue by adenoviral VEGF gene transfer supporting a 123% increase in vessel
number compared to control (Magovern et al, 1997).
Treatment of a 71 year-old patient with an ischaemic
leg with 2 mg phVEGF165 plasmid applied to the hydrogel polymer
coating of an angioplasty balloon and reaching the distal popliteal artery
resulted in an increase in collateral vessels at the knee, mid-tibial, and
ankle levels, which persisted for 12-weeks (Isner et al, 1996a).
Ischemia, induced in the hindlimb of rats by excision of the femoral artery,
was experimentally treated by transfer of the VEGF gene; therapeutic
angiogenesis produced morphologically similar, but significantly more
extensive, networks of collateral microvessels (Takeshita et al, 1997). Direct
i.m. injection of naked VEGF165 plasmid DNA into the ischemic thigh
muscles in rabbits resulted in more angiographically recognizable collateral
vessels at 30 days posttransfection (Tsurumi et al, 1996, 1997).
G. Cancer treatment with angiogenesis inhibitors
On November 20, 1997 the first exciting data on clinical
trials using the TNP-470, a drug extracted from fungi which inhibits
angiogenesis, were reported in a speech before the National Institutes of
Health by Judah Folkman (Harvard University). A woman in Texas with cervical
cancer and metastasis to lungs had been tumor-free for months after treated
with TNP-470; and a young girl with a slow-growing bone tumor in her jaw was
cancer-free after treatment with IFN-a. Both TNP-470 and IFN-a are relatively weak inhibitors of blood vessel
formation compared with angiostatin (O'Reilly et al, 1994, 1996), endostatin
(O'Reilly et al, 1997), and vasculostatin which eliminated tumors in small
animals. A combination therapy with angiostatin and endostatin was even more
effective in tumor eradication; furthermore, these drugs have no apparent side
effects and there is virtually no resistance of tumors to these drugs (see
below). However, the number of human patients treated with angiogenesis
inhibitors is too small and a larger number of cases need to be examined.
H. Angiostatin and endostatin
Angiostatin is a potent naturally occurring inhibitor
of angiogenesis and growth of tumor metastases, which is generated by
cancer-mediated proteolysis of plasminogen
to a 38 kDa plasminogen fragment; angiostatin selectively instructs endothelium
to become refractory to angiogenic stimuli (O'Reilly et al, 1994, 1996). A
number of enzymes including metalloelastase, pancreas elastase, plasmin
reductase, and plasmin collaborate in the conversion of plasminogen to
angiostatin. Systemic administration of angiostatin, but not intact
plasminogen, inhibited neovascularization in vitro and in vivo and suppressed
the growth of Lewis lung carcinoma metastases (O'Reilly et al, 1994; Gately et
al, 1997); human angiostatin inhibited almost completely the growth of three
human and three murine primary carcinomas in mice without detectable toxicity
or resistance (O'Reilly et al, 1996); these studies have developed the
Òdormancy therapyÓ for cancer based on that malignant tumors are regressed by
prolonged blockade of angiogenesis to microscopic dormant foci in which tumor
cell proliferation is balanced by apoptosis (O'Reilly et al, 1996).
Human angiostatin, administered to mice with s.c.
hemangioendothelioma and associated disseminated intravascular coagulopathy
(Kasabach-Merritt syndrome), significantly reduced tumor volume and increased
survival (Lannutti et al, 1997).
PC-3 human prostate carcinoma cells release uPA and
free sulfhydryl donors that converted plasminogen to angiostatin; these two
components were sufficient for angiostatin generation (Gately et al, 1997);
reduction of one or more disulfide bonds in the serine proteinase, plasmin, by
a reductase secreted by Chinese hamster ovary cells triggered proteolysis of
plasmin, generating fragments with the domain structure of angiostatin; two
reductases (protein disulfide isomerase and thioredoxin) although able to
produce biologically active angiostatin from plasmin and to inhibit
proliferation of human dermal microvascular endothelial cells, were not the
reductases secreted by cultured cells; instead the plasmin reductase factor
secreted was a different one requiring reduced glutathione for activity
(Stathakis et al, 1997). Two members of the human matrix metalloproteinase
(MMP) family, matrilysin (MMP-7) and gelatinase B/type IV collagenase (MMP-9),
hydrolyzed human plasminogen to generate angiostatin fragments; 58-, 42- and
38-kDa angiostatin fragments were generated; these studies implicated MMP-7 and
MMP-9 in regulation of new blood vessel formation by cleaving plasminogen and
generating angiostatin molecules (Patterson and Sang, 1997).
Recent studies exploring the mechanism responsible
for the in vivo production of angiostatin that inhibits growth and metastasis
in Lewis lung carcinoma have shown that angiostatin is produced by
tumor-infiltrating macrophages whose metalloelastase expression is stimulated
by tumor cell-derived GM-CSF (Dong et al, 1997).
Endostatin is a 20 kDa C-terminal fragment of collagen XVIII
produced by hemangioendotheliomas which specifically inhibits endothelial cell
proliferation, angiogenesis and tumor growth (O'Reilly et al, 1997).
Reports on the transfer of the angiostatin cDNA for
the treatment of malignancies are about to appear (Toshihide Tanaka, personal
communication).
XXXII. Gene therapy of restenosis
A. Pathophysiology of restenosis
The pathological situation, described as recurrent
narrowing of a blood vessel after a successful revascularization procedure, has
been termed restenosis (from the Hellenic stenos=narrow); the most frequent
revascularization procedure has been the percutaneous transluminal angioplasty
(PTA) used to treat atherosclerotic obstructions in the coronary and peripheral
vascular circulations; PTA is achieved using a tiny balloon mounted on a catheter
which is advanced under x-ray guidance to the site of a blocked artery. The
most frequent artery suffering restenosis is the superficial femoral artery
(SFA)/popliteal artery of the leg and the iliac arteries.
One of the factors contributing to restenosis is the
intimal hyperplasia of the arterial wall; among others, the mechanism for
intimal hyperplasia involves increasing the tissue levels of TGF-b following injury; injection of antibodies directed
against TGF-b has blocked restenosis in a rat model (reviewed by
Border and Noble, 1995). Transfer of the TGF-b
gene into porcine arteries caused restenosis (Nabel et al, 1993a,b). Arterial
injury has pleiotropic effects at the molecular level; for example, injury of
rat arteries led to an increase in FGF receptors in vascular smooth muscle
cells.
Atherosclerosis and restenosis following balloon
angioplasty are characterized by two steps: during the thrombotic phase in the
arterial wall following injury fibrin networks are synthesized with platelet
depositions; this phase is followed by smooth muscle cell proliferation. Both
the synthesis of fibrin from fibrinogen, as well as the proliferation of
platelet and smooth muscle cells are upregulated by the protease thrombin.
Inhibition of the action of thrombin in the arterial wall is a potential target
against arterial disease. The most potent and specific inhibitor of thrombin
known today is the polypeptide hirudin, an anticoagulant derived from the
medicinal leech, Hirudo medicinalis;
especially important is a local delivery of hirudin to prevent thrombosis
circumventing the systemic coagulopathy associated with systemic administration
of the purified protein (for references see Rade et al, 1996).
The pathogenesis of both atherosclerosis and
restenosis involves the migration of medial smooth-muscle cells across the
internal elastic lamina to form a neointima; inflammatory reactions involving T
cells and other leukocytes maintain smooth-muscle cell migration, proliferation
and matrix deposition. The stenotic response involves the expression of HA
(hyaluronan) receptors on both the infiltrating white cells and on
smooth-muscle cell populations; exposure of injured arteries to high
concentrations of HA in vivo resulted in significant inhibition of neointimal
formation (Savani and Turley, 1995). Intervening with the HA and receptor genes
could provide potential molecular targets for restenosis.
A number of drugs have been developed to inhibit
neointima formation such as the drug CVT-313, identified from a purine analog
library; CVT-313 is a specific and potent inhibitor of CDK2 reducing
hyperphosphorylation of RB (Brooks et al, 1997). The angiotensin-converting
enzyme inhibitor, cilazapril, also prevented myointimal proliferation after
vascular injury (Powell et al, 1989).
However, most of these drugs are toxic and need continuous administration to
the artery. Gene therapy could result in stable transfection of the arterial
wall cells with the gene of a therapeutic protein circumventing these problems.
Significant progress has been made in the area of
coronary restenosis, particularly in identifying target genes to reduce
neointima formation in vein grafts used in coronary bypass surgery. Targets of
gene therapy include the prevention of postangioplasty restenosis, postbypass
atherosclerosis, peripheral atherosclerotic vascular disease and thrombus
formation (reviewed by Malosky and Kolansky, 1996; YlŠ-Herttuala, 1996).
B. VEGF
gene transfer for restenosis
Thickening of the arterial intima, composed of smooth
muscle cells, is an important area for intervention by gene transfer to
alleviate the syptoms of restenosis following balloon treatment. Gene therapy
for restenosis may be achieved following transfer of the gene encoding VEGF;
this therapy has been applied to animal models and has now entered clinical
trials (Isner et al, 1996a). Previous studies using administration of
recombinant, 165 amino acid, VEGF protein to rabbits in vivo has shown a significant augmentation in collateral vessel
development by angiography after excision of the ipsilateral femoral artery in
the animal to induce severe hind limb ischemia (Takeshita et al, 1994a). The
rationale behind this approach is that VEGF promotes endothelial cell
proliferation (Leung et al, 1989) to accelerate re-endothelialization of the
artery reducing intimal thickening and thrombogenicity (Asahara et al, 1996);
the inner lining of the blood vessels is made up of endothelial cells which are
important in preventing the formation of blood clots or atherosclerotic plaques.
Animal studies have shown that endothelial cells require a relatively long time
for growth after injury. "Naked" plasmid encoding the 165 amino acid
VEGF isoform is being delivered using a hydrogel /polymer-coated balloon
angioplasty catheter without use of liposomes or recombinant viruses to humans
(Isner et al, 1996a).
YlŠ-Herttuala and coworkers (Laitinen et al, 1997a)
have examined and compared the efficiency of lacZ delivery to the rabbit
carotid artery (using a collar method) with (i) plasmid/liposome complexes (Lipofectin), (ii) replication-deficient Moloney murine leukemia virus
(MMLV)-derived retroviruses, (iii)
pseudotyped vesicular stomatitis virus protein G (VSV-G)-containing
retroviruses and (iv) adenoviruses.
Transfer of the gene to the adventitia took place with all gene transfer
systems tested except MMLV; the adenovirus gave the highest gene transfer
efficiency and up to 10% of the cells displayed b-galactosidase
activity compared with 0.05% of cells using VSV-G retrovirus, 0.05% with
Lipofectin, and less than 0.01% with MMLV retrovirus (Figure 31).
During the collar application procedure extravascular
gene transfer took place without intravascular manipulation; the model is
suited for gene transfer studies involving difussible or secreted gene products
(such as VEGF, see Figure 32) that
act primarily on the endothelium; effects on medial smooth muscle cell (SMC) proliferation and even endothelium
can be achieved from the adventitial side of the artery (Laitinen et al,
1997a).
Transfer of the VEGF gene was performed on rabbits
using a silicone collar inserted around the carotid arteries. The collar acted
as an agent that caused intimal SMC growth and as a reservoir for the VEGF
gene; the model preserved the integrity of endothelial cells and permitted
extravascular gene transfer without intravascular manipulation. A plasmid
carrying the mouse VEGF164 gene under control of the CMV promoter in
a mixture with Lipofectin was injected under anesthesia by gently opening the
collar (Laitinen et al, 1997b). As a control, arteries were injected with the
lacZ cDNA; animals after 3, 7, or 14 days from the operation were sacrificed
and the arteries were examined by electron microscopy using SMC-specific
immunostaining (Figure 32A,B). One
week after VEGF transfer with cationic liposomes there was a significant
reduction in intimal thickening (Figure
32B) compared to control arteries (A). When the nitric oxide synthase
inhibitor L-NAME was administered to the animals it abolished the therapeutic
efficacy of VEGF and there was no VEGF-induced reduction in intimal thickening
of the arteries (Laitinen et al, 1997b).
C. Transfer of other genes against restenosis and arterial injury
A number of vascular disorders can be treated by
arterial gene transfer (Nabel et al, 1990, 1993a-c; Ohno et al, 1994; Takeshita
et al, 1994b; Chang et al, 1995a,b). One of the drawbacks has been the low
percentage of the cells transfected which were in the order of 1% to less than
0.1% using naked plasmid delivery with a balloon catheter (e.g. Isner et al,
1996a), cationic liposomes (Nabel et al, 1990, 1993a-c), or retroviruses
(Flugelman et al, 1992). A variety of genes have been transferred into arterial
wall cells. Transfer of the human growth hormone gene, a secreted protein, into
rabbit arterial organ culture using lipofectin permitted determination of hGH
levels in the culture medium using a sensitive immunoassay method (Takeshita et
al, 1994b). The ADA gene has been
transferred efficiently to vascular smooth muscle cells in rats (Lynch et al,
1992). Transfer of the fibroblast growth factor-1 gene (Nabel et al, 1993b), of
the platelet-derived growth factor B gene (Nabel et al, 1993c), or of the
transforming growth factor-b1 gene (Nabel et al, 1993a,b) into animal arteries
promoted intimal hyperplasia and angiogenesis.
The therapeutic induction of angiogenesis in ischemic
tissues using recombinant cytokines is also promising for clinical application
(Norrby, 1997).
In vivo suppression of injury-induced vascular smooth
muscle cell (VSMC) accumulation is a widely used approach (Ohno et al, 1994).
Other than VEGF gene transfer (Isner
et al, 1996a, see above), additional approaches for the treatment of restenosis
after injury-induced VSMC accumulation is via delivery of the HSV-tk gene followed by ganciclovir treatment
in order to kill preferentially the smooth muscle cells (Guzman et al, 1994;
Ohno et al, 1994); by transfer of the cytosine deaminase (CD) gene the product
of which is capable of metabolizing 5-fluorocytosine (5-FC) to 5-fluorouracil
in a rabbit femoral artery model of balloon-induced injury (Harrell et al,
1997); by transfer of the RB (Chang
et al, 1995a; Smith et al, 1997),
or p21 genes (Chang et al, 1995b); by transfer of ras (Indolfi et al, 1995), TGFb gene (Grainger et al, 1995); and, by transfer of the
nitric oxide synthase gene (von der Leyen et al, 1995).
At the molecular level, arterial injury results in
exposure of vascular smooth muscle cells (VSMC) and fibroblasts to multiple
growth factors that activate second messengers and induce expression of
immediate-early genes within minutes to hours after stimulation resulting in
the exit of VSMC from the quiescent G0 state. A series of CDKs are activated
and tumor suppressor genes need to be down-regulated for VSMC proliferation
including p53, p21, p16, and RB (reviewed by Muller, 1997). Therapeutic
strategies to restrict neointima formation in the injured artery include (i) inhibition in the expression of
proto-oncogenes (c-myc); (ii)
transfer of suicide genes (HSV-tk, CD); (iii)
use of molecular decoys or drugs to block specific steps required for cell
cycle progression, (iv) transfer of
tumor suppressor genes (p21, RB); (v)
treatment with antisense oligonucleotides to down regulate genes required for
cell proliferation or DNA synthesis (antisense cyclin G1, PCNA); (vi) transfer of a number of unrelated
genes such as of gax, TGF-b, hirudin, PKCd, b-interferon (Table
7). It is worth considering that delivery of recombinant adenoviruses
themselves causes (i) a pronounced infiltration of T cells throughout the
artery wall; (ii) upregulation of intercellular adhesion molecule-1 and
vascular cell adhesion molecule-1 in arterial smooth muscle cells; (iii)
neointimal hyperplasia (Newman et al, 1995).
Figure 31. b-galactosidase
gene transfer into the collared rabbit carotid arteries using (i)
plasmid/liposome complexes, (ii) replication-deficient Moloney murine leukemia
virus (MMLV)-derived retroviruses, (iii) pseudotyped vesicular stomatitis virus
protein G (VSV-G)-containing retroviruses and (iv) adenoviruses. Gene transfer
was done on day 5 after the collar operation. Arteries were analyzed 5 days
after the gene transfer for general histology, cell types and b-galactosidase
activity using immunocytochemistry and X-gal staining. (A,B) Immunostainings of serial sections of an artery transfected
with plasmid/liposome complexes. A:
Endothelium remained anatomically intact during manipulations as shown with
endothelial-specific staining using the monoclonal antibody CD31. B: The majority of cells in intima and
media were smooth muscle cells (SMC) as shown with the SMC-specific antibody
HHF-35. C: Absence of staining with
X-gal in an untransfected control artery. (D-L):
Arteries transfected with various gene transfer constructs. D: Plasmid/liposome complexes (25 mg lacZ
plasmid, 25 mg Lipofectin reagent in 600 ml Ringer
solution. E: MMLV retroviruses (600 ml pLZRNL
retrovirus, titer 5x105 cfu/ml). F: VSV-G pseudotyped retroviruses (600 ml pLZRNL+G
retrovirus, titer 1x107 cfu/ml). G: E1-E3-deleted adenoviruses (600
ml nuclear targeted pCMVBA-LACZ Adenovirus 5, titer 1x109
pfu/ml). H: Higher magnification of
G. I: Higher magnification of G
showing intense staining of the nucleae (arrow) in the adventitia with the
nuclear targeted lacZ construct and X-gal staining of some endothelial cells
(arrow-head). (J,K): Inflammatory
cells were seen in adventitia after the gene transfer with VSV-G retroviruses
and adenoviruses: J: VSV-G
pseudotyped retrovirus-transfected artery (macrophage-specific staining with
the monoclonal antibody RAM-11). K:
Adenovirus-transfected artery (macrophage-specific staining with the monoclonal
antibody RAM-11). L: Nonimmune
control (first antibody omitted). Original magnification X10 (G); X25 (A-C,F,H);
X50 (D,J,L); X100 (E,I). From Laitinen M, Pakkanen T, Donetti E, Baetta R,
Luoma J, Lehtolainen P, Viita H, Agrawal R, Miyanohara A, Friedmann T, Risau W,
Martin JF, Soma M, YlŠ-Herttuala S (1997a)
Gene transfer into the carotid artery using an adventitial collar: comparison
of the effectiveness of the plasmid-liposome complexes, retroviruses,
pseudotyped retroviruses, and adenoviruses.
Hum Gene Ther 8, 1645-1650. Reproduced with the kind permission of the
authors and Mary Ann Liebert, Inc.
Figure 32. Representative micrographs
showing the characteristics of rabbit carotid arteries 7 days after VEGF or
lacZ gene transfer. A. Control
artery transfected with lacZ-plasmid/liposomes using smooth muscle cell
(SMC)-specific immunostaining (HHF-35) showing a typical intimal thickening. B. Artery transfected with VEGF
plasmid/liposomes showing a limited intimal thickening after SMC-specific
immunostaining (HHF-35). C. Serial
section to A, but stained for endothelium with CD31 monoclonal antibodies; it
shows the presence of endothelium in all vascular segments examined. D. Serial section to B, but stained for
endothelium with CD31 monoclonal antibodies, showing an intact endothelium. E. In situ hybridization with a VEGF
antisense riboprobe labeled with [35S]UTP in VEGF-transfected
artery; bright spots (arrows) indicate the expression of VEGF mRNA (dark-field
image). Control hybridizations with sense riboprobes were negative (not shown).
F. The absence of inflammation was
shown in VEGF-transfected arteries with macrophage-specific immunostaining
(RAM-11). G. Neovascularization
(arrow) in the adventitia of VEGF-transfected artery 14 days after gene
transfer using endothelium-specific immunostaining (CD31). No
neovascularization was detectable in lacZ-transfected arteries (not shown). H. Nonimmune control for the
immunostainings (first antibody omitted); sections were counterstained with
hematoxylin. Magnification, 25X in A-E, G and 50X in F,H. From Laitinen M,
Zachary I, Breier G, Pakkanen T, Hakkinen T, Luoma J, Abedi H, Risau W, Soma M,
Laakso M, Martin JF, YlŠ-Herttuala S (1997b)
VEGF gene transfer reduces intimal thickening via increased production of
nitric oxide in carotid arteries. Hum
Gene Ther 8, 1737-1744. Reproduced with the kind permission of the authors
and Mary Ann Liebert, Inc.
Transfer of the bone morphogenetic protein-2 (BMP-2)
gene inhibited serum-stimulated increase in DNA synthesis and cell number of
cultured rat arterial SMCs as well as injury-induced intimal hyperplasia; the
mode of BMP-2 action differed from that mediated by TGF-b; BMP-2 had the ability to inhibit SMC proliferation
without stimulating extracellular matrix synthesis (Nakaoka et al, 1997).
cDNA for hirudin has been delivered to smooth muscle
cells of injured rat carotid arteries using an adenoviral vector; the coding
region for the human growth hormone signal peptide (MATGSRTSLLLAFGLLCLPWLQEGSA)
was engineered upstream of the hirudin cDNA in order to achieve secretion of
the protein in effectively transduced cells. The therapeutically important
levels of hirudin which were secreted in vivo resulted in 35% reduction in
neointimal hyperplasia as shown on histologic sections of the carotid arteries
(Rade et al, 1996). Significant issues on toxicity and immunogenicity of the
vector remain to be resolved for application of the method to humans (Rade et
al, 1996).
Table 7. Genes or antisense used to inhibit smooth muscle
cell proliferation and neointima formation for the treatment of arterial injury
and restenosis
|
Gene or
antisense |
Reference |
|
|
|
|
VEGF gene transfer |
Isner et
al, 1996a; Van Belle et al, 1997; Laitinen et al, 1997a,b |
|
HSV-tk
gene /GCV |
Guzman et
al, 1994; Ohno et al, 1994 |
|
Cytosine
deaminase (CD) gene /5-fluorocytosine |
Harrell
et al, 1997 |
|
RB gene |
Chang et
al, 1995a; Smith et al, 1997 |
|
p21 gene |
Chang et
al, 1995b |
|
Hirudin
gene |
Rade et
al, 1996 |
|
Dominant-negative
mutated form of c-H-ras gene |
Indolfi
et al, 1995; Ueno H et al, 1997b |
|
TGFb gene |
Grainger
et al, 1995 |
|
Nitric
oxide synthase gene |
von der
Leyen et al, 1995 |
|
gax gene |
Weir et
al, 1995; Maillard and Walsh, 1996; Smith et al, 1997 |
|
Protein
kinase Cd gene (by suppressing G1
cyclin expression) |
Fukumoto
et al, 1997 |
|
Bone
morphogenetic protein-2 (BMP-2) gene |
Nakaoka
et al, 1997 |
|
b-interferon gene |
Stephan
et al, 1997 |
|
Antisense
cdk2 oligonucleotides |
Morishita
et al, 1994 |
|
Antisense
oligodeoxynucleotides to c-myc |
Bennettet
al, 1994 |
|
Antisense
oligonucleotides to PCNA |
Simons et
al, 1994 |
|
Antisense
cyclin G1 |
Zhu et
al, 1997 |
Inhibition in proliferation of the smooth muscle
cells has also been achieved by an antibody against basic fibroblast growth
factor (Lindner and Reidy, 1991), by antisense oligodeoxynucleotides to c-myc
applied in a pluronic gel to the arterial adventitia (Bennettet al, 1994), and
by antisense phosphorothioate oligonucleotides to PCNA in a rat carotid artery
injury model (Simons et al, 1994). Transfer of the protein kinase Cd gene to a rat clonal VSMC inhibited the
proliferation of vascular smooth muscle cells by suppressing G1 cyclin
expression and arrested the cells in the G0/G1 phase of the cell cycle;
overexpression of PKCd caused
reduction in the expression of cyclins D1 and E and RB phosphorylation, and
increased the protein levels of p27 (Fukumoto et al, 1997).
RB is implicated in the control of the cell cycle via
its interaction with E2F (see above);
a phosphorylation competent, amino-terminal-truncated RB protein (Rb56)
was a more potent inhibitor of E2F-mediated transcription relative to the
full-length Rb construct (Rb110); adenoviral transfer of either Rb56 or Rb110
inhibited neointima formation after balloon injury in the rat carotid artery
(Smith et al, 1997).
On the other hand, overexpression of the fibroblast
growth factor-1 gene (Nabel et al, 1993b), platelet-derived growth factor B
gene (Nabel et al, 1993c), and transforming growth factor b1 gene (Nabel et al, 1993a,b) into the arteries
induced intimal hyperplasia in vivo.
p21 protein is a negative regulator of mammalian cell
cycle progression that functions both by inhibiting cyclin dependent kinases
(CDKs) required for the initiation of S phase and by binding to and inhibiting
PCNA. p21 gene transfer has been used to inhibit vascular smooth muscle cell
(VSMC) proliferation after arterial injury for the treatment of atherosclerosis
and restenosis. Over-expression of human p21 inhibited growth factor-stimulated
VSMC proliferation and neointima formation in the rat carotid artery (a model
of balloon angioplasty) by arresting VSMCs in the G1 phase of the cell cycle.
p21-associated cell cycle arrest was associated both with a significant
inhibition of the phosphorylation of RB (see above) and with the formation of
complexes between p21 and PCNA in VSMCs (Chang et al, 1995b). Transfer of p21
was also used by others to suppress neointimal formation in the balloon-injured
porcine or rat carotid arteries in vivo; vascular endothelial and smooth muscle
cell growth was arrested through the ability of p21 to inhibit progression
through the G1 phase of the cell cycle (Yang et al, 1996; Ueno et al, 1997a).
Gax is a growth arrest gene which regulates
proliferation of VSMC; gax is an homeobox gene whose expression in the adult is
largely confined to cardiovascular tissues. In contrast to a number of genes
which are up-regulated following balloon injury and/or angioplasty, such as the
early response genes c-myc and c-fos, gax is down-regulated within hours of
balloon injury; gax may be required to maintain the gene expression of proteins
in VSMC that are associated with the nonproliferative or contractile phenotype.
Gax is also rapidly down-regulated in cultured VSMC upon stimulation by serum
or platelet-derived growth factor (PDGF); like the genes in the gas and gadd
families, gax is expressed at its highest levels in quiescent cells and is
down-regulated following mitogen activation (Weir et al, 1995). Percutaneous
gax adenovirus-mediated gene transfer into normal and atherosclerotic rabbit
iliac arteries suggested prevention of neointimal formation (Maillard and
Walsh, 1996). The gax-induced growth inhibition correlated with a
p53-independent up-regulation of the cyclin-dependent kinase inhibitor p21; gax
overexpression also led to an association of p21 with cdk2 complexes and a
decrease in cdk2 activity and, thus, gax overexpression inhibited cell
proliferation in a p21-dependent manner.
Ras proteins are key transducers of mitogenic signals
from the membrane to the nucleus. DNA vectors expressing ras transdominant
negative mutants, which interfere with ras function, reduced neointimal
formation after injury in rats in which the common carotid artery was subjected
to balloon injury (Indolfi et al, 1995). An adenoviral vector, expressing a
potent dominant-negative mutated form of c-H-ras, in which tyrosine replaced
aspartic acid at residue 57, completely inhibited serum-stimulated activation
of mitogen-activated protein kinase, and abolished the DNA synthesis in
response to serum mitogens in infected smooth muscle cells in culture.
Application of the adenoviral vector into balloon-injured rat carotid arteries
from inside the lumen resulted in a significant reduction in neointima
formation (Ueno H et al, 1997b).
Nitric oxide-generating vasodilators inhibit vascular
smooth muscle cell proliferation. S-nitroso-N-acetylpenicillamine (SNAP), a
nitric oxide-releasing agent, inhibited the activity of cyclin-dependent kinase
2 (Cdk2) and the phosphorylation of RB but it did not inhibit the activities of
cyclin D-associated kinases Cdk4 and Cdk6 (Ishida et al, 1997). Suppression of
injury-induced vascular smooth muscle cell accumulation was also achieved by
transfer of the endothelial cell nitric
oxide synthase gene (von der Leyden et al, 1995). Based on the fact that
administration of the nitric oxide (NO) synthase inhibitor L-NAME to rabbit
carotids eliminated the difference in intimal thickening between VEGF and
mock-transfected (lacZ) arteries it was proposed that VEGF may reduce smooth
muscle cell proliferation via VEGF-induced NO production from the endothelium
(Laitinen et al, 1997).
D. Atherosclerosis
The atherotic plaque is formed by a complex mechanism
initiated by the accumulation of lipid, macrophages and T cells at artery
lesions leading to smooth muscle cell proliferation (Ross, 1993). TGF-b is involved in atherosclerosis via its activation by
plasmin and via its inhibition by atherogenic lipoprotein deposited on the
arterial wall. Inhibition of TGF-b would lead to smooth
muscle cell proliferation; patients with advanced coronary disease have
decreased serum TGF-b levels; furthermore, transgenic mice overexpressing
lipoprotein (a) exhibit decreased levels of TGF-b
at sites of lipoprotein (a) accumulation such as in the aortic wall (Grainger
et al, 1995). As prolonged overproduction of TGF-b
may lead to tissue fibrosis by overproduction of extracellular cell matrix
(Border and Noble, 1995) a balanced overexpression of TGF-b might be of great therapeutic value for heart
disease.
The plasminogen system, via its triggers, t-PA and
u-PA and its inhibitor, plasminogen activator inhibitor-1 (PAI-1), has been
implicated in thrombosis, arterial neointima formation, and atherosclerosis
(reviewed by Carmeliet et al, 1997).
A number of animal models have been used to induce
atherosclerotic lesions such as the iliac arteries of New Zealand white rabbits
fed with cholesterol. Substantial progress in vector development and the
demonstration of efficacy in relevant animal models will be required before
gene therapy for atherosclerosis becomes a clinical reality (Rader, 1997).
E. Acidic and basic fibroblast growth factors (aFGF,
bFGF)
Acidic and basic fibroblast growth factors and their receptors are involved in
many fundamental biological processes but also in pathological processes
(Webster and Donoghue, 1998, this volume).
Whereas VEGF is a regulator of vascular permeability
and an endothelial cell growth factor the acidic and basic fibroblast growth
factor (aFGF, bFGF) and placenta growth factor (PGF) polypeptides are endowed
with endothelial cell growth-promoting activity; however, FGFs have not been reported
to be expressed in blood vessels in vivo. aFGF and bFGF seem to act as mitogens
for a large number of different cell types; in situ hybridization analysis has
shown that there is no expression of FGF receptors 1 and 2 (Flg and Bek) in
capillary endothelial cells during embryonic development; it is only VEGF and
PGF which are known to be specific for endothelial cells (for references see
Millauer et al, 1993).
Many of the studies that have demonstrated
therapeutic efficacy using fibroblast (aFGF, bFGF, FGF-5), endothelial (VEGF)
and other types of factors using the purified peptides can potentially be
transferred to the gene level. This will not require repeated administration of
the drug, especially whenever the somatic cell targets are transfected
efficiently and the expression of the transgene lasts.
Liposome-mediated gene transfer of antisense-oriented
bFGF or fibroblast growth factor receptor-1 (FGFR-1) cDNAs in episomal vectors
into human melanomas, grown as subcutaneous tumors in nude mice caused complete
arrest or regression of the tumors as a result of blocked intratumoral
angiogenesis and subsequent necrosis (Wang and Becker, 1997). Inhibition of
bFGF synthesis in vivo using an antisense RNA strategy significantly inhibited
intimal thickening after arterial balloon injury (Hanna et al, 1997).
Infection of human umbilical vein endothelial cell
cultures with a bFGF-expressing recombinant adenovirus enhanced the
proliferation rate and tubular formation of these cells on reconstituted
basement membrane (Takahashi et al, 1997). Low level expression of bFGF
upregulated Bcl-2 and delayed apoptosis in NIH3T3 cells; on the other hand
cells expressing from 8-15 times background levels of bFGF became
phenotypically transformed (gave dense foci at confluence, had decreased
adherence to tissue culture plates and grew colonies in soft agar) (Wieder et
al, 1997). Blood vessels of spontaneously hypertensive rats were shown to be
associated with subphysiological amounts of bFGF; transfer of the bFGF gene corrected hypertension,
restored the physiological levels of bFGF in the vascular wall, and ameliorated
endothelial-dependent responses to vasoconstrictors (Cuevas et al, 1996).
F. Wound healing and plasminogen
A number of diseases including cancer, cancer
metastasis, atherosclerosis, arthritis, hepatitis, dermatitis, inflammatory
bowel disease, sickle cell anemia, and autoimmune disease result in severe
tissue damage. Plasminogen has a profound importance in wound healing and might
play a central role in many of these diseases (R¿mer et al, 1996). Plasminogen
is an inactive precursor-protease synthesized and secreted by the liver and
converted into plasmin (trypsin-like serine protease) by the action of two
different proteases: (i) tissue-type
plasminogen activator (tPA) and (ii) urokinase-type
plasminogen activator (uPA); in addition to uPA- and tPA-regulation, the
activity of plasminogen is also controlled by plasminogen-specific cell surface
receptors, by inhibitors of plasminogen activation (PAI-1 and PAI-2), and by
the receptor of uPA (uPAR). Angiostatin is a 38 kDa plasminogen fragment
generated by cancer-mediated proteolysis of plasminogen (O'Reilly et al, 1994,
1996, see angiostatin). Endostatin
is a 20 kDa C-terminal fragment of collagen XVIII (O'Reilly et al, 1997); both
angiostatin and endostatin inhibit angiogenesis and tumor growth.
Plasmin passes to extravascular fluids and stimulates
proteolytic activity in the extracellular matrix (such as degradation of
fibrin) but also contributes to the activation of growth factors and other
proteases (see R¿mer et al, 1996). Fibrin is an important component of the
wound healing and reepithelization process and is formed from fibrinogen by the
action of the protease thrombin (see Rade et al, 1996). These processes take
place during wound healing but also during the process of atherosclerosis,
restenosis, response to vascular injury, and in tumorigenesis during formation
of the tumor stroma.
Plasminogen-deficient mice (transgenic animals
produced by targeted disruption in the plasminogen gene) completed embryonic
development and survived to adulthood but were predisposed to spontaneous
thrombotic lesions in many tissues and displayed fibrin deposition in the liver
(Bugge et al, 1995). These animals showed severe impairment in the healing of
skin wounds; thus, plasminogen plays a central role in extracellular matrix
degradation during wound healing in rodents in vivo and most likely also in
humans (R¿mer et al, 1996). Fibrin dissolution allows keratinocyte migration
from incisional wound edges; detriment in fibrin degradation slows down wound
repair by the limited ability of epidermis cells to dissect their way through
the extracellular matrix beneath the wound crust (R¿mer et al, 1996). Fibrin is
a major component of the extracellular matrix in wounds and solid tumors but
not in normal embryonic or adult tissue.
G. TGF-b in injury and wound healing
Transforming growth factor-b (TGF-b) is a cytokine
implicated in the pathogenesis of impaired wound healing but also in autoimmune
disease, malignancy, and atherosclerosis (Grainger et al, 1995). TGF-b has gained interest for the treatment of autoimmune
disease, multiple sclerosis (autoimmune encephalomyelitis), and arthritis;
however, prolonged overproduction of TGF-b may lead to tissue
fibrosis by overproduction of extracellular cell matrix affecting kidney,
liver, lung and other organs. TGF-b1 is involved in the
pathogenesis of fibrosis by its matrix-inducing effects on stromal cells such
as in activation of the pulmonary fibrotic process (Sime et al, 1997).
Overexpression of TGF-b1 in the heart is thought to contribute to the
development of cardiac hypertrophy and fibrosis (Villarreal et al, 1996). TGF-b can activate and then suppress T cells, macrophages,
and leukocytes; transgenic mice with targeted disruption of the TGF-b gene die with autoimmune symptoms (reviewed by
Border and Noble, 1995).
The preservation and architectural design of the
extracellular matrix depends on the action of cytokine polypeptides. TGF-b controls the mitogenic action of platelet-derived
growth factor (PDGF); in response to injury or disease, the production of TGF-b and PDGF are increased stimulating extracellular
matrix production; this is accomplished by inhibition of proteases and
stimulation of synthesis of extracellular matrix proteins by TGF-b. Failure of cells to produce enough TGF-b has been proposed to result in impaired wound
healing in the elderly, glucocorticoid-treated individuals, and in diabetics; a
single injection of TGF-b has been shown to accelerate wound healing (reviewed
by Border and Noble, 1995).
TGF-b inhibits epithelial and
smooth cell proliferation; it is believed that one of the factors contributing
to the unrestricted growth of cancer cells is their nonresponsiveness to TGF-b because of loss of functional TGF-b receptors; microsatellite instability in colon
cancer cells inactivates the type II TGF-b receptors (Markowitz et
al, 1995). Tamoxifen, an anticancer drug, stimulates TGF-b thus inhibiting cancer cell proliferation.
Restoration of the TGF-b receptor genes might constitute a strategy for
treating human cancers (Border and Noble, 1995).
Transfer of the cDNA of porcine TGF-b1 to rat lung induced prolonged and severe
interstitial and pleural fibrosis characterized by extensive deposition of the
extracellular matrix (ECM) proteins collagen, fibronectin, and elastin (Sime et
al, 1997). Particle-mediated delivery of mutant porcine constitutively active
TGF-b1 cDNA to rat skin at the site of skin incisions
increased tensile strength up to 80% for 14-21 days (Benn et al, 1996).
Neurodegeneration associated with Alzheimer's disease is believed to involve
toxicity to b-amyloid and related peptides; this neurotoxicity was
significantly attenuated by single treatments with TGF-b1 and was prevented by repetitive treatments, a
process associated with a preservation of mitochondrial potential and function
(Prehn et al, 1996); this implies a potential avenue of TGF-b1 gene transfer for Alzheimer's disease.
Transfer of TGF-b1 cDNA in vivo
suppresses local T cell immunity and prolonged cardiac allograft survival in
mice; TGF-b1 gene transfer may become a new type of
immunosuppressant avoiding the systemic toxicity of conventional
immunosuppression (Qin et al, 1996).
GM-CSF overexpression induced TGF-b1 gene expression and secretion from macrophages
purified from bronchoalveolar lavage fluid 7 days after GM-CSF gene transfer;
these findings implicate GM-CSF in pulmonary fibrogenesis (Xing et al, 1997).
XXXIII. Cystic fibrosis (CF)
A. Molecular mechanism of CF pathogenesis
CF is a lethal recessive hereditary disorder
characterized by abnormalities of the airway epithelium; it affects 1 in 2,000
Caucasians. Inflicted individuals show secretion of thick mucus and chronic
colonization of the lung epithelium with pathogens such as Pseudomonas aeruginosa. The defect arises from mutations in the
250-kb gene encoding a 12-transmembrane domain glycoprotein (1480 amino acids),
called cystic fibrosis transmembrane conductance regulator (CFTR), that
modulates the permeability of Cl- in
response to elevation of intracellular cAMP. The defect is caused by deletion
of three base pairs eliminating a single phenylalanine residue at the center of
the first nucleotide-binding domain of the CFTR protein (Riordan et al, 1989).
Much of the mortality seen in CF is related to
chronic infection of the respiratory tract with Pseudomonas aeruginosa; Pseudomonas colonization has been
attributed to increased numbers of specific cell-surface receptors and to the
presence of mucus. Adherence of P.
aeruginosa directly to the cell surface of CF airway epithelium (from
noncultured nasal epithelial cells isolated from CF patients) was significantly
increased over that in cells from healthy donors. Liposome-mediated CFTR gene
transfer resulted in a significant reduction in the numbers of bacteria bound
to ciliated CF epithelial cells (Davies et al, 1997).
The architecture of the lung and the terminal
differentiation of the defective cells imposes a serious hurdle for ex vivo gene
therapy for CF: the epithelial cells on the airway surface cover the
successively branching structures of the lung making impossible their removal
and reimplantation (Yoshimura et al, 1992).
Successful introduction of the entire 250 kb human
CFTR gene locus and adjacent sequences into Chinese hamster ovary-K1 (CHO)
cells which lack endogenous CFTR was achieved using yeast artificial
chromosomes (YACs); integration of the human CFTR-containing YACs into the CHO
genome took place on the order of one copy per genome; functional human CFTR
was expressed from subclones and human CFTR expression in CHO cells was
unexpectedly high (Mogayzel et al, 1997). This type of studies are very useful
as a number of DNA control elements for CFTR may be ÒhiddenÓ throughout the
gene locus, including enhancers, ORIs, silencers, MARs, that participate in the
tissue- and developmental stage-specific CFTR gene expression.
The airway epithelium is in the process of injury and
regeneration in CF; regenerating poorly differentiated cells of human airway
epithelium in culture were efficiently transfected with CFTR cDNA using
adenoviral vectors; CFTR expression and cAMP-regulated stimulation of the cell
membrane chloride ion secretion took place on these cells as determined by light
fluorescence microscopy and scanning laser confocal microscopy (Dupuit et al,
1997).
B. CFTR gene transfer in animal models
Direct transfer of the human CFTR gene was achieved using a replication-defective adenovirus
vector by intratracheal instillation into cotton rat lungs; the presence of
human CFTR mRNA transcripts was detected by in situ hybridization with a cRNA
(antisense) probe as well as by immunohistochemical evaluation using antibodies
directed against the CFTR protein (Rosenfeld et al, 1992).
First generation adenovirus-mediated gene transfer of
CFTR to the mouse lung resulted in the expression of viral proteins leading to
the elimination of the therapeutic cells expressing CFTR by cellular immune
responses; second generation E1-deleted viruses displayed substantially longer
recombinant gene expression and induced a lower inflammatory response (Yang et
al, 1994).
Adenoviral vector constructs with an E1-E3+E4ORF6+
backbone encoding CFTR (or b-galactosidase) produced declining levels of
expression while a similar vector with an E1-E3+E4+ backbone gave rise to
sustained, long-term reporter gene expression in the lung in nude mice; CTLs
directed against either adenoviral proteins or b-galactosidase
reduced expression in nude mice stably expressing b-galactosidase from the E4+ vector (Kaplan et al,
1997).
Aerosol delivery of an adenoviral vector encoding
CFTR to non-human primates showed human CFTR mRNA in lung tissue from all
treated animals on days 3, 7, and 21 post-exposure; other than some rather mild
complications on individual animals ranging from an increase in lavage
lymphocyte numbers to bronchointerstitial pneumonia, the treatment was rather
safe (McDonald et al, 1997).
Adenoviruses elicit am immune response. Effective
gene therapy for CF would ideally be accomplished with a vector capable of
long-term expression of the CFTR in the absence of a host inflammatory
response; in this respect AAV might be better suited. Administration of single
doses of AAV-CFTR vector to 10 rhesus macaques by fiberoptic bronchoscopy to
the right lower lobe of lungs showed that transfer of the CFTR gene occurred in
bronchial epithelial cells of each animal by in situ DNA PCR; vector mRNA was
detectable for 180 days after administration as detected by RT-PCR and there
was no evidence of inflammation (Conrad et al, 1996).
Transfer of CFTR gene was also achieved using
retroviral vectors; sodium butyrate treatment of murine retrovirus packaging
cells producing the vector increased the production of the retrovirus vector
between 40- and 1,000-fold (Olsen and Sechelski, 1995).
Yoshimura and coworkers (1992) have transduced airway
epithelial cells in mice by intratracheal instillation of a plasmid carrying
the CFTR gene under control of the
Rous sarcoma virus promoter with cationic liposomes. Use of liposomes have
successfully transferred the CFTR
gene to epithelia and to alveoli deep in the lung leading to correction of the
ion conductance defects found in the trachea of transgenic mice (Hyde et al,
1993).
Complexes of cationic polymers and cationic lipids
with adenovirus enhanced gene transfer to the nasal epithelium of cystic
fibrosis mice in vivo (Fasbender et al, 1997). The novel cationic lipid EDMPC
(1,2-dimyristoylsn-glycero-3-ethylphosphocholine, chloride salt) mediated
efficient intralobar DNA delivery of CFTR to rodents; there was no correlation
between DNA-EDMPC formulations that delivered DNA most efficiently in vitro and
those that worked best in vivo (Gorman et al, 1997). The structures of several
novel cationic lipids that were effective for CFTR gene delivery to the lungs
of mice were investigated; an amphiphile (lipid #67) consisting of a
cholesterol anchor linked to a spermine head-group in a "T-shape"
configuration was shown to sustain a 1,000-fold increase in expression above
that obtained in animals instilled with naked pDNA alone and was greater than
100-fold more active than other cationic lipids and comparable to that of
adenoviral vectors (Lee et al, 1996).
C. Clinical trials on cystic fibrosis patients
A significant number of clinical trials on CF have
received RAC approval (Appendix 1
and Table 4 in Martin and Boulikas,
following article). The clinical protocols approved use adenoviral delivery of
CFTR (#118-123, 125, 128, 129) or cationic lipids (#193, 203, 212, and 214).
The only two protocols using AAV in clinical trials are for CF (#165, 166)
whereas no retroviral protocol has been approved for CF as of December 1997.
Results of clinical trials have been reported and
more will become available in the near future. A single dose of 400 mg pCMV-CFTR in complex with 2.4 mg DOTAP,
administered to the nasal epithelium of eight CF patients resulted in partial,
sustained correction of CFTR-related functional changes toward normal values in
two treated patients; transgene DNA was detected in seven of eight treated
patients for up to 28 days after treatment; vector derived CFTR mRNA was
detected in two of the seven patients at 3 and 7 days from treatment using PCR
(Porteous et al, 1997). Complexes of plasmids with DOTAP liposomes rendered
their DNA resistant to DNaseI something relevant to clinical trials for gene
therapy of CF, in which patients are normally removed from treatment with DNase
before receiving administration of DNA (Crook et al, 1997).
A formulation of plasmid encoding CFTR (pCF1-CFTR)
was at least as effective as complexes of DNA with lipid in partially
correcting the Cl- transport defect in CF patients by administering complexes
of DNA-lipid to one nostril and DNA alone to the other nostril in a randomized,
double-blind study (Zabner et al, 1997).
The safety of the nebulised cationic lipid
formulation (GL-67/DOPE/DMPE-PEG5000) to be used for the transfer of CFTR to CF
patients was first tested on 15 healthy volunteers in the absence of plasmid DNA;
no adverse clinical events were seen (Chadwick et al, 1997).
XXXIV. Rheumatoid arthritis (RA)
A. Molecular mechanisms for development of RA
RA is a systemic autoimmune disease caused by genetic
and environmental factors; chronic inflammation and hyperactivation of synovial
cells in the joints is the salient feature of RA resulting in the thickening
(hyperplasia) of the synovial membrane lining the interior surface of the joint
capsule. The mechanism involves synovial cell proliferation, infiltration by leukocytes,
and excessive extracellular cell matrix deposition. The activated synovial
cells in the hypertrophied synovium produce inflammatory cytokines and
degradative enzymes that invade and erode the articular cartilage leading to
partial or complete destruction of cartilage and bones. The inflamed synovium
in RA is infiltrated by lymphocytes and monocytes, a process mediated by the
enhanced binding of the very late antigen-4 (VLA-4) to vascular cell adhesion
molecule-1 (VCAM-1) (Chen et al, 1995).
Several well-characterized murine models of arthritis
closely resemble RA immunologically, genetically, and histopathologically and
have been developed to study RA. Collagen-induced arthritis in DBA/1 mice is
one model of RA; the animals exhibit marked synovitis and erosions. The disease
can be adoptively transferred to SCID mice using arthritogenic splenocytes from
DBA/1 mice injected with bovine collagen type II (Chernajovsky et al, 1997).
Bacterial cell wall-induced arthritis in rats is
another model (Makarov et al, 1996).
B. Approaches to gene therapy of RA
The current emphasis for RA gene therapy is on
transferring genes encoding secreted proteins which possess antiarthritic
properties. Genes may be delivered locally to individual diseased joints or
systemically to extra-articular sites where the secreted gene products may
enter the circulation. Gene transfer to the synovium would ensure local
production of anti-inflammatory gene products directly in the articular space
where they could exert a down-regulatory effect on the autoimmune process.
Although adenoviral delivery appeared best suited for gene delivery to
synovium, induction of an inflammatory response resulting in loss of gene
expression may take place (Evans and Robbins, 1996).
High efficiency lacZ gene transfer and expression was
achieved in both type A and type B synoviocytes throughout the articular and
periarticular synovium of the rabbit knee by Roessler et al (1993).
Intra-articular administration of an E1a-E3-deleted adenoviral (Ad5) vector expressing
the lacZ transgene into mouse joints showed lacZ expression in the articular
synovium for at least 14 days. However, a gradual loss of transgene expression
was caused by a predominantly neutrophilic, inflammatory response. Pretreatment
with the anti-T cell receptor monoclonal antibody (mAb) H57 resulted in a
significant reduction in lymphocytic infiltration and in persistence of
transgene expression. Thus, anti-T cell mAbs may be useful in inhibiting
adenovirus-induced immune responses that lead to the loss of therapeutically
transduced cells (Sawchuk et al, 1996).
Many new therapeutic approaches are currently being
developed, including the use of soluble receptors to IL-1 or TNF, monoclonal
antibodies to TNF-a, and a specific IL-1 receptor antagonist. A number
of studies have assessed the impact of gene transfer on inflammatory and
chondrodestructive effects during the acute phase of antigen-induced arthritis
in RA joints. A promising therapy for RA involves delivery of the TNF-a and IL-1 proteins to the joints to inhibit the
activity of proinflammatory cytokines (Bandara et al, 1993; Arend and Dayer,
1995).
Angiogenesis is not only essential for the growth and
metastatic spread of solid tumors but in diseases such as rheumatoid arthritis,
psoriasis, liver cirrhosis and diabetic retinopathy (Norrby, 1997). Future
approaches for the gene therapy of RA may thus include anti-angiogenesis
approaches to the inflamed joints.
C. Ex vivo gene therapy of RA using IL-1Ra-transduced
cells
Degradation of cartilage in RA in vitro is stimulated
by IL-1, a proinflammatory cytokine, which is released from RA synovial
fibroblasts (RA-SF). Synovial cells
were surgically removed from joints of animals with experimental arthritis,
cultured and transduced with the naturally occurring inhibitor of IL-1,
IL-1-receptor antagonist (IL-1Ra)
protein gene and reimplanted into the respective donors by intra-articular
injection (Bandara et al, 1993). Retroviral transfer of the IL-1Ra gene to RA-SF which were then coimplanted with normal human
cartilage in SCID mice protected the cartilage from chondrocyte-mediated
degradation; the IL-1Ra-transduced RA-SF continued to secrete IL-1Ra over a
60-day period (Muller-Ladner et al, 1997a,b). Transfer the human IL-1Ra gene to
rabbits' knees produced a marked chondroprotective effect although the
anti-inflammatory effect was milder (Otani et al, 1996).
Ex vivo retroviral delivery of the secreted human
IL-1Ra cDNA to primary synoviocytes followed by engraftment in ankle joints of
rats with recurrent bacterial cell wall-induced arthritis significantly
suppressed the severity of recurrence of arthritis as assessed by measuring
joint swelling and by the gross-observation score; this ex vivo approach
attenuated but did not abolish erosion of cartilage and bone; the level of
locally expressed IL-1Ra was about four orders of magnitude higher than that
attained from systemically administered recombinant IL-1Ra protein (Makarov et
al, 1996). These findings provide experimental evidence for the feasibility of
antiinflammatory gene therapy for arthritis.
Retroviral transduction of hematopoietic stem cells
with human IL-1Ra cDNA was also used for the treatment of RA; HSCs were
subsequently injected into lethally irradiated mice; all of the mice survived
and over 98% of the white blood cells in these mice were arising from the
transduced HSCs (donor type) from 2-13 months after transplantation; the
animals had the human IL-1Ra protein in their sera for at least 15 months.
These results demonstrated that systemic production of biologically active
human IL-1Ra can be obtained by retrovirus-mediated gene transfer to
hematopoietic stem cells which could be useful in the treatment of chronic
diseases such as rheumatoid arthritis as well as bone degeneration caused by
aging (Boggs et al, 1995).
Characterization of the interleukin-1/interleukin-1
receptor antagonist pathways in RA resulted in the first gene therapy trial in
animals and humans for RA (Evans et al, 1996; reviewed by Evans and Robbins,
1996; Muller-Ladner et al, 1997a). Protocol #56 (page 162) involves removal of
autologous synovial cells from the patient, their retroviral transduction with
the IL-1Ra cDNA followed by injection of the transduced cells into the
metacarpal phalangeal joints of RA patients.
Infection of arthritogenic splenocytes from DBA/1
mice transferred to SCID mice with a recombinant retrovirus carrying the TGF-b1 gene was effective in lowering inflammation of
joints with already established arthritis and inhibiting the spreading of the
disease to other joints in mice (Chernajovsky et al, 1997).
D. Direct gene delivery for RA
A retroviral vector based on a murine leukemia virus
was used to deliver the human growth hormone and lacZ genes to the synovium of
the rabbit knee to test the efficacy of gene transfer and to develop an
approach for the gene therapy of RA (Ghivizzani et al, 1997).
An effective treatment of arthritis is via
eliminating most or all of the activated synovial cells. The death factor
Fas/Apo-1 and its ligand (FasL) play
pivotal roles in maintaining self-tolerance and immune privilege; Fas is
expressed constitutively in most tissues and is dramatically upregulated at the
site of inflammation. Unlike Fas, however, the levels of FasL expressed in the
arthritic joints are extremely low, and most activated synovial cells survive
despite high levels of Fas expression. Delivery of the FasL gene via a
replication-defective adenovirus by injection into inflamed joints conferred
high levels of FasL expression, induced apoptosis of synovial cells, and
ameliorated collagen-induced arthritis in DBA/1 mice (Zhang et al, 1997).
A strategy was developed for inhibiting T lymphocyte
retention and activation within the rheumatoid synovium (Chen et al, 1995). The
inflamed synovium in RA is infiltrated by lymphocytes and monocytes, a process
mediated by the enhanced binding of the very late antigen-4 (VLA-4) to vascular
cell adhesion molecule-1 (VCAM-1)
expressed on microvascular endothelial cells; VLA-4 binding appears to play a
role in T cell retention and activation within the inflamed synovial membrane.
Therefore, blocking of VLA-4 binding by utilizing a soluble congener of the
VCAM-1 molecule might be of therapeutic efficiency for RA. Adenoviral infection
of human synoviocytes carrying the cDNA for a secreted form of VCAM-1 (sVCAM-1)
showed secretion of transgenic sVCAM-1 by ELISA of tissue culture supernatants.
In vivo, transgenic sVCAM-1 expression was determined by immunohistochemical
analysis and in situ hybridization of synovial tissue, and secretion of
transgenic sVCAM-1 was demonstrated by ELISA of tidal knee lavage fluid. The
results showed that recombinant adenovirus can mediate the expression of a
biologically active sVCAM-1 by synoviocytes in vivo and suggested that this strategy
may be useful for inhibiting T lymphocyte retention and activation within
rheumatoid synovium. Ex vivo studies using this strategy have not been
reported.
XXXV. Adenosine deaminase (ADA) deficiency and severe
combined immunodeficiency (SCID)
Severe combined immunodeficiency is secondary to the
deficiency in adenosine deaminase; the enzyme is involved in purine catabolism.
The syndrome is characterized by defective B and T cell function caused by the
large amounts of deoxyadenosine which is preferentially converted into the
toxic compound deoxyadenosine triphosphate in T cells disabling the immune
system (see Blaese et al, 1995 and the references cited therein). Affected
individuals experience recurrent infections and the disease is usually fatal unless
affected children are kept in isolation. One therapeutic approach has been to
partially reconstitute the immune system by bone marrow transplantation from a
human leukocyte antigen (HLA)-identical sibling donor (Hirschorn et al, 1981).
An enzyme replacement therapy consisted of introducing bovine ADA enzyme
conjugated with polyethylene glycol (PEG-ADA) in order to increase the
circulation time of the ADA enzyme in the blood and other extracellular fluids
(Hershfield et al, 1987).
The first person to be treated ex vivo was a
4-year-old suffering with ADA deficiency in 1990. Protocol #2 treating ADA
deficiency with autologous lymphocytes transduced ex vivo with the ADA gene was
the second RAC-approved protocol. Because of this innovative work, the US
Patent Office has issued in 1995 a patent covering all ex vivo gene therapy to French Anderson, Steven Rosenberg, and
Michael Blaese.
From 1990-1992, a clinical trial was initiated using
retrovirus mediated transfer of the 1.5 kb ADA gene cDNA to T cells from two
children with severe combined immunodeficiency following multiple
transplantations of ex vivo modified
blood cells; the integrated ADA gene was expressed for long periods (Blaese et
al, 1995; Bordignon et al, 1995). The success of this ex vivo approach probably
arose from that the ADA gene-corrected T cells acquired a survival advantage
compared with uncorrected cells when transplanted into immunodeficient but ADA
normal BNX mice (Ferrari et al, 1991) and humans (Kohn et al, 1995).
Three neonates with ADA deficiency have been
successfully treated later with hematopoietic stem CD34+ cells,
isolated from their umbilical cord blood, transduced with the ADA gene under
control of the LTR of the MoMuLV using retroviral vectors, followed by
autologous transplantation (Kohn et al, 1995).
Ex vivo studies have shown correction of the severe combined
immunodeficiency in ADA-deficient mice by transfer of human peripheral blood
lymphocytes transduced with a retroviral vector in cell culture carrying the ADA gene; the injected human cells
survived for long times in mice and restored the immune functions (presence of
human immunoglobulin and antigen-specific T cells) (Ferrari et al, 1991). Ex vivo correction of the defect in T
cells from ADA-deficient patients with retroviral vectors gave to these cells
an advantage for cell division against a background of slowly dividing
uncorrected T cells after their transplantation (Karlsson, 1991).
XXXVI. Gaucher disease, lysosomal storage disease,
and mucopolysaccharidosis VII
Many mutations affecting the glucocerebrosidase gene
have been defined as causes of the glycolipid storage disorder, Gaucher disease; disease symptoms are a
result of macrophage engorgement secondary to this enzyme deficiency. The
recombinant from of glucocerebrosidase imiglucerase protein is effective in
treating the disease as a replacement therapy (reviewed by Beutler, 1997).
An amphotropic producer cell line that synthesized
viral particles carrying a fusion of the selectable MDR1 cDNA encoding
P-glycoprotein (P-gp) and the human glucocerebrosidase gene was constructed;
complete restoration of glucocerebrosidase deficiency in Gaucher fibroblasts
was achieved using this retrovirus; selection of the transduced Gaucher
fibroblasts in colchicine (MDR1 function) raised their glucocerebrosidase
activity from nearly undetectable to normal levels; combination of much lower
concentrations of colchicine and inhibitors of the P-gp pump (verapamil)
allowed to select for high-level expression of MDR1 and glucocerebrosidase;
this regimen, in clinical use for the treatment of multidrug-resistant
malignancies, may find application for high level selection of a nonselectable
gene such as glucocerebrosidase (Aran et al, 1996; see also Migita et al,
1995).
Allogenic bone marrow transplantation (Parkman, 1986)
or intravenous infusion of glucocerebrosidase (enzyme replacement therapy) in a
patient with Gaucher's disease (Barton et al, 1990), although has partially
corrected deficiencies in lysosomal enzymes, was not amenable to brain cells
because of the brain barrier and cannot alleviate symptoms in the central
nervous system. Protocols #38, 39, and 51 use glucocerebrosidase cDNA to
transduce CD34+ autologous peripheral blood cells followed by
intravenous injection of the transduced cells into patients with Gaucher's
disease. CD34+ cells obtained from G-CSF mobilized peripheral blood
stem cells or from bone marrow (#51) are being transduced ex vivo and reinfused
into the patient at the National Institutes of Health and ChildrenÕs Hospital
of Los Angeles (Dunbar and Kohn, 1996).
Type II
Glycogen Storage Disease, a
deficiency of acid a-glucosidase (GAA), results in the abnormal
accumulation of glycogen in skeletal and cardiac muscle lysosomes; this can
have devastating effects ultimately leading to death; the wild-type enzyme was
produced in deficient myoblasts after gene transfer with a retroviral vector
carrying the cDNA for GAA. The transduced cells secreted GAA that was
endocytosed via the mannose-6-phosphate receptor into lysosomes of deficient
cells and digested glycogen; thus, the transduced cells provided phenotypic
correction to distant cells in the culture by secretion. Figure 33 shows that the GAA-transduced myoblasts (red
fluorescence) were able to fuse with deficient myoblasts (green fluorescence)
and provide enzyme activity mediating phenotypic correction to neighboring
GAA-deficient cells (Zaretsky et al, 1997).
Aspartylglucosaminuria (AGU, appearance of aspartylglucosamine in the
urine) is the only known human disease caused by an amidase deficiency, in this
case by deficiency of the enzyme aspartylglucosaminidase (AGA) in virtually all
cell types of patients; AGA deficiency fails to perform the final breakdown of
asparagine-linked glycoproteins leading to the intraly-sosomal accumulation of
uncleaved glycoasparagines and to their abnormal urinary excretion. AGU
patients display progressive psychomotor retardation starting in early
childhood. The most common mutation in the Finnish population responsible for
AGA deficiency is a point mutation resulting in the amino acid substitution
Cys-163 to Ser in the AGA gene
(Ikonen et al, 1991).
Retrovirus-mediated gene transfer was successfully
used to correct the AGA gene in
cultured human primary fibroblasts and lymphoblasts from AGU patients as a
prelude to ex vivo human gene therapy; enzyme correction
Figure 33. Immunofluorescent detection of
in vitro fusion of a-glucosidase (GAA)-deficient
muscle cells with myoblasts transduced with the GAA gene using a retroviral
vector. The GAA-transduced myoblasts (red fluorescence) were able to fuse
(arrows) with deficient myoblasts (green fluorescence) and provide enzyme
activity. From Zaretsky JZ, Candotti F, Boerkoel C, Adams EM, Yewdell JW,
Blaese RM, Plotz PH (1997)
Retroviral transfer of acid a-glucosidase
cDNA to enzyme-deficient myoblasts results in phenotypic spread of the
genotypic correction by both secretion and fusion. Hum Gene Ther 8, 1555-1563. Reproduced with the kind permission of
the authors and Mary Ann Liebert, Inc.
further
took place by cell-to-cell interaction between transduced and nontransduced
cells in culture suggesting that only partial cell transduction might be
sufficient to correct AGA deficiency in vivo (Enomaa et al, 1995).
Mucopolysaccharidosis
type VII (Sly syndrome or MPS VII)
is a result of an inherited deficiency of b-glucuronidase in
humans, mice, and dogs (see Wolfe et al, 1992 for references). The symptoms are
progressive degeneration in several tissues resulting from storage in lysosomes
of undegraded glycosaminoglycans affecting the spleen, liver, brain, cornea,
kidney, and skeletal muscle. Affected individuals display a reduced life-span
which is 5 months in mice. Retroviral vectors have successfully treated
mucopolysaccharidosis VII by somatic cell gene transfer in mouse models (Wolfe
et al, 1992) or by implantation of ex vivo modified mouse skin fibroblasts
(Moullier et al, 1993).
Retrovirus-mediated transfer of the
iduronate-2-sulfatase cDNA into lymphocytes is being applied for the clinical
treatment of mild Hunter syndrome (mucopo-lysaccharidosis type II, protocol #65
on page 163).
XXXVII. Hereditary a1-antitrypsin (a1-AT)
deficiency
Destruction of components of the extracellular matrix
of the lung by neutrophil elastase (NE)
is believed to be a critical event in the development of obstructive lung
disease. a1-antitrypsin (also known as a1-proteinase inhibitor) is an antiprotease that
protects the lung from destruction by the powerful protease NE. The hereditary a1-antitrypsin deficiency is caused by mutations in
the coding region of the 12.2 kb-gene resulting in decreased serum and lung
levels of a1-antitrypsin; affected individuals develop emphysema
at age 30-40 (Crystal, 1990). Lung-derived epithelial cells have the capacity
to synthesize functional a1-antitrypsin but also to increase the rate of its
production when stimulated by specific inflammatory mediators, including
oncostatin M, IL-1, and dexamethasone (Cichy et al, 1997).
The respiratory epithelium has been a potential site
for somatic gene therapy because of the possibility of direct delivery of a
functional gene by tracheal instillation. A drawback for retrovirus-mediated
gene transfer arises from that the majority of alveolar and airway epithelial
cells are terminally differentiated and only a small fraction of these cells
are proliferating and amenable to recombinant retrovirus infection; however,
lung epithelial cells are prone to adenovirus infections because host cell
replication is not required for expression of adenoviral proteins (see
Rosenfeld et al, 1991).
The adenovirus major late promoter was linked to a
human a1-antitrypsin gene for its transfer to lung epithelia
of cotton rat respiratory pathway as a model for the treatment of a1-antitrypsin deficiency; the cotton rat is an animal
commonly used to evaluate the pathogenesis of adenoviral respiratory tract
infections. Both in vitro and in vivo infections have shown production
and secretion of a1-antitrypsin by the lung cells: cells, removed by
brushing the epithelial surface of the tracheobronchial tree from the lungs of
cotton rats demonstrated the possibility of their infection in culture and
secretion of the therapeutic protein; following direct infection of the animals
in vivo, demonstrated that the
protein was synthesized and secreted in the epithelial lining fluid of the lung
for over 1 week (Rosenfeld et al, 1991).
i.v. administration of a full-length cDNA encoding
human a1-antitrypsin (100 ng/mouse) encapsulated in small
liposomes resulted in expression in liver parenchymal cells as shown on
immunohistochemical liver sections; this effect remained for at least 2 weeks
and some enzyme could be detected in plasma (Ali–o et al, 1996). The human a1-antitrypsin gene was transferred to lungs of
rabbits; immunohistochemical staining showed a1-AT
protein in the pulmonary endothelium following intravenous administration, in
alveolar epithelial cells following aerosol administration, and in the airway
epithelium by either route (Canonico et al, 1994). A recombinant adenovirus
vector was also used for a1-AT cDNA transfer (Gilardi et al, 1990). a1-AT cDNA in an adenoviral vector was administered by
retrograde ductal instillation to the submandibular glands of male rats;
transient expression took place in salivary glands (Kagami et al, 1996).
Guo et al (1996) have evaluated the transcriptional
activities of 5 viral and cellular enhancer/promoter elements, showing either
high-level or hepatocyte-specific expression following transient transfection
into hepatoma cells using recombinant adenoviruses expressing human a1-antitrypsin; the human elongation factor 1a gene promoter produced 2 mg/ml serum level of human a1-antitrypsin, which is physiologic in humans and
will be therapeutic for patients with a1-antitrypsin
deficiency.
XXXVIII. Approaches to the gene therapy of
ParkinsonÕs disease (PD)
A. Etiology and mechanisms of destruction of neurons
in PD
First described by James Parkinson in 1817 this
neurodegenerative disorder is characterized by resting tremor, postural
instability and bradykinesia (slow movement); surviving neurons display
intracytoplasmic inclusions known as Lewy bodies. PD symptoms ensue when the
pars compacta region of the substantia nigra (black substance) at the base of
the brain loses neurons that normally issue motion-controlling signals
(dopamine) to the striatum (divided into caudate nucleus and putamen). The
death of neurons is believed to be caused by oxygen free radical damage; brain
contains unusually low levels of antioxidants. This damage might be caused by a
decline in the activity of the mitochondrial complex I.
PD can be induced in experimental animals by
selective destruction of the dopaminergic neurons of the substantia nigra by
the neurotoxic drug 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) through
inhibition of complex I of the mitochondrial respiratory chain (see
Polymeropoulos et al, 1996 and the references cited therein). MPTP was found as
an impurity in heroin and explained some earlier observations of addicts who
became almost completely immobile after making use of the drug, a symptom
characteristic of severe PD. MPTP crosses the brain-blood barrier and is
converted by mitochondrial monoamine oxidase B into a reactive molecule that
inhibits the complex I enzyme resulting in energy deficit and increase in free
radicals in the cell (reviewed by Youdim and Riederer, 1997).
There is substantial evidence which implicates immune
mechanisms in the destruction of neurons. The substantia nigra of ParkinsonÕs
patients contains active microglia which, after stimulation by cytokines, could
produce the free radical nitric oxide which can penetrate the cell membrane of
vicinal neurons, inhibit the complex I mitochondrial enzyme and activate signal
transduction pathways. Furthermore, NO with superoxide, emitted by hyperactive
microglia, can free iron ions from intracellular stores which can oxidize
dopamine into neuromelanin, a molecule that acts as an oxidant when complexed
with transition metals. These oxidative stress mechanisms could trigger apoptosis
in neurons. Excessive release of the neurotransmitter glutamate (known to occur
in stroke) into the striatum and substantia nigra could induce a similar
cascade of NO and free radical damage. These mechanisms suggest that excessive
stressful conditions in predisposed individuals might precipitate the onset of
PD symptoms.
B. Drug treatment of PD
The first medicament in the mid-1900s included
extracts of the deadly nightshade plant which inhibited the activity of
acetylcholine in the striatum; acetylcholine overexcites striatal neurons that
projected to higher motor regions of the brain, an effect normally counteracted
by dopamine. Later in 1960s L-DOPA, which is converted into dopamine, proved
valuable for treatment of PD patients; dopamine itself cannot cross the
blood-brain barrier (a network of specialized blood vessels that control which
substances are allowed to pass from the blood into the central nervous system).
Drugs that mimic the actions of dopamine (agonists) have also been used. Selegiline
(also called deprenyl), an inhibitor of monoamine oxidase B, the enzyme that
breaks down dopamine in the astrocytes and microglia, is of therapeutic
potential (reviewed by Youdim and Riederer, 1997).
Amantadine is used to block the effects of glutamate
in substantia nigra. Antioxidants able to cross the brain-blood barrier could
have a protective effect on the destruction of neurons. Unfortunately, the
first indications show that vitamin E in the low doses tested, which can cross
to some extent the brain-blood barrier, is ineffective; however, the effect of
higher doses of vitamin E need to be investigated. The efficacy of
glial-derived neurotrophic factor (GDNF)
injected into the brain of PD patients is in trials. Rasagiline, which could
activate neuronal growth factors in the brain is under investigation on humans.
Also in clinical trials are strategies of direct implantation of
dopamine-producing cells into the brain of patients (Youdim and Riederer,
1997).
Ex vivo and in vivo gene therapy strategies for PD
have a promising future (see below).
C. Candidate genes for PD
A susceptibility gene for PD has been mapped to
chromosome 4q21-q23 by genotyping genomic DNA from a large family in Contursi
in the Salemo province of Southern Italy where 60 individuals out of 592
members are affected by PD at an average age of 46. A total of 140 genetic
markers were typed in the pedigree and only those associated with this
chromosomal region were altered showing recombination events in PD patients in
this family; this type of recombination does not involve expansions of the CAG
trinucleotide repeat (Polymeropoulos et al, 1996).
The neurologic abnormalities associated with PD were
thought to result from a severe reduction in L-DOPA as a consequence of
degeneration of dopaminergic neurons of the nigrostriatal pathway. L-DOPA is
synthesized from tyrosine by the enzyme tyrosine hydroxylase (TH); L-DOPA is then converted into the
neurotransmitter dopamine by a decarboxylase. Besides TH, other genes whose
malfunction has been linked to PD include glutathione peroxidase, a
brain-derived neurotrophic factor, catalase, amyloid precursor protein, Cu/Zn
superoxide dismutase, and debrisoquine 4-hydroxylase; however, none of these
candidate genes are found in the 4q21-q23 region to be linked as etiologic
agents of PD; instead, candidate genes in the 4q21-q23 region include alcohol
dehydrogenase, formaldehyde dehydrogenase, synuclein, and
UDP-N-acetylglycosamine phosphotransferase (Polymero-poulos et al, 1996).
A mutation was identified in the a-synuclein gene, which codes for a presynaptic
protein thought to be involved in neuronal plasticity, in the Italian kindred
with autosomal dominant inheritance for the PD phenotype (Polymeropoulos et al,
1997). The missense mutation in the a-synuclein gene
suggested that at least some fraction of familial PD with diffuse Lewy bodies
is the result of an abnormal protein that interferes with normal protein
degradation leading to the development of inclusions and ultimately neuronal
cell death. Furthermore, a peptide fragment of a-synuclein
is known to be a constituent of Alzheimer's disease plaques; there may be
common pathogenetic mechanisms involved in a-synuclein
mutations in PD and b-amyloid and presenilin gene mutations in Alzheimer's
disease (Nussbaum and Polymeropoulos, 1997).
D. Gene and cell therapy for PD
1. Grafting
of dopamine neurons
Transplantation of human embryonic dopamine neurons
have been performed on patients with Parkinson's disease but the amelioration
of the symptoms is transient; death of therapeutic cells was thought to arise
from hypoxia, oxidative stress, and trauma during preparation and grafting of
the cells. Grafting of dopamine neurons into transgenic mice overexpressing the
Cu/Zn superoxide dismutase increased 4-fold the survival of the transplanted
cells providing a direct support to the free radical-mediated death of
dopaminergic neurons in brain tissue grafts (Nakao et al, 1995).
Cells transduced with tyrosine hydroxylase and GTP
cyclohydrolase I were grafted alone or in combination with cells transduced
with aromatic L-amino acid decarboxylase into the 6-hydroxydopamine-denervated
rat striatum; it was concluded that there is sufficient aromatic L-amino acid
decarboxylase near striatal grafts producing L-DOPA and that the close
proximity of L-amino acid decarboxylase to TH-producing cells is detrimental
for optimal dopamine production (Wachtel et al, 1997).
2. Tyrosine
hydroxylase (TH)
Since adult brain cells are nonproliferative, they
are refractory to retroviral infection that could deliver the TH gene to the brain to alleviate
degeneration at the nigrostriatal pathway. Gene therapy of PD has been
approached ex vivo using PD animal models with TH deficiency. Unilateral
destruction of dopaminergic nigrostriatal neurons in PD animal models with 6-hydroxydopamine
and administration of apomorphine causes PD rats to turn contralaterally (7-15
rotations/min).
Figure 34. Transfer of the tyrosine hydroxylase gene to
primary muscle cells followed by transplantation of these cells to brains of
TH-deficient rats has alleviated the number of collateral rotations of the
animals which are models for ParkinsonÕs disease. Adapted from Jiao et al,
1993. Reproduced from Boulikas T (1996b)
Gene therapy to human diseases: ex vivo and in vivo studies. Int J Oncol 9, 1239-1251. With the kind permission from the
International Journal of Oncology.
Implantation of immortalized rat fibroblasts
releasing L-dopa into the cell culture medium (Wolff et al, 1989), of primary
fibroblasts (Fisher et al, 1991) and myoblasts (Jiao et al, 1993), stably
transfected in culture with the TH
gene, reduced behavioral abnormalities in PD animal models and the number of
contralateral rotation dropped to 4 rotations/min (Figure 34).
Direct injection of lipofectin-plasmid DNA complexes
containing the TH gene under the
influence of the SV40 promoter/enhancer (pSVK3 plasmid of Pharmacia) has also
shown expression of TH into striatal
cells compensating for the loss of the intrinsic striatal dopaminergic input
reducing quickly and significantly the rotational abnormalities in rat models
(Cao et al, 1995).
A different approach has been aimed at converting
endogenous striatal cells into L-dopa-producing cells; this was obtained by
infection of 6-hydroxydopamine-lesioned rats, used as a model of PD, with a
defective herpes simplex virus type 1 vector expressing TH (During et al,
1994).
Recombinant adenovirus are attractive delivery
vehicles of genes to alleviate PD symptoms because they can transduce both
quiescent and actively dividing cells, thereby allowing both direct in vivo
gene transfer and ex vivo gene transfer to neural cells; because the brain is
partially protected from the immune system, the expression of adenoviral
vectors can persist for several months with little inflammation (reviewed by
Horellou and Mallet, 1997).
3. Glial
cell line-derived neurotrophic factor
The rat glial cell line-derived neurotrophic factor
(rGDNF), a putative central nervous system dopaminergic survival factor, was
evaluated for its ability to protect nigral dopaminergic neurons in the
progressive Sauer and Oertel 6-hydroxydopamine (6-OHDA) lesion model of
Parkinson's disease. Perinigral injections to rats of rGDNF protected a
significant number of cells when compared with cell counts of rats injected
with a recombinant AAV carrying the lacZ gene (94% vs. 51%, respectively); this
treatment gave 85% of tyrosine hydroxylase-positive cells (vs. only 49% in the
lacZ group) (Mandel et al, 1997; see also Bohn and Choi-Lundberg, 1998, this
volume).
XXXIX. Gene therapy of hemophilia A and B
A. Gene therapy of hemophilia A
Hemophilia A, characterized by hemorrhagic episodes
of which the spontaneous intracranial bleeding could result in crippling or
death, affects 1 in 10,000 males. It is caused by a deficiency in Factor VIII
(FVIII), crucial in blood coagulation, responsible for accelerating activation
of factor X by factor IXa in the presence of calcium and phospholipids. Human
FVIII is synthesized as a 2351-amino acid precursor protein with a 19- amino
acid signal peptide; the 256 kDa single-chain protein composed of the
homologous domains A1-A2-B-A3-C1-C2 is processed by proteolysis to a
heterodimer composed of a heavy chain (90-200 kDa) and a light chain (80 kDa)
which circulates in plasma.
Both the 186 kb gene encoding human FVIII and the 7.2
kb cDNA sequences are known; recombinant FVIII has been expressed from both
intact cDNA and a cDNA lacking the B domain; however, the expression of the
protein from cell culture was 100-1000 times lower than the expression of other
recombinant proteins. This is due to the large size of the protein, its
required proteolytic processing, instability of mRNA, abnormal secretion from
inefficient transport from the endoplasmic reticulum to the Golgi, and the
required N- and O-linked glycosylation for biological activity. Recombinant
FVIII is being administered to approximately 50% of the patients. Biologically
active FVIII has been produced recently in the milk of transgenic pigs by
targeting expression of human FVIII cDNA to the mammary gland of the animals;
the expression of the transgene was driven by regulatory sequences from the
mouse whey acidic protein gene (Paleyanda et al, 1997).
Infusion of purified factor VIII is the most widely
used therapy; however, protein replacement suffers from transfusion-associated
complications (AIDS and hepatitis B and C infections); over 50% of the patients
treated from 1977 to 1985 were infected with HIV. Improved manufacturing
procedures and production of recombinant factor VIII have reduced infectious
complications.
Hemophilia A is particularly amenable to gene therapy
because even a slight increase in blood plasma of factor VIII can convert a
severe form of the disease to a mild form. Application of retrovirus-mediated
transfer of factor VIII gene has been hampered by a 100- to 1000-fold reduction
in mRNA accumulation and protein production in cells, as well as in retrovirus
titer, because of the presence of a secondary structure (arising from inverted
repeats) within the DNA coding region of clotting factor VIII gene (Lynch et al, 1993; Chuah et al, 1995). Partial
solution to this problem has been provided by Chuag and coworkers (1995) who
determined that insertion of a 5' intron in the retrovirus vector increased
20-fold gene expression and 40-fold virus titer after transfection of the human
T cell line SupT1, human Raji Burkitt B lymphoblastoma and other cell lines.
An more exciting approach has been the use of a
B-domain-deleted form of factor VIII; at the protein level, this domain is not
required for pro-coagulant activity and retains the thrombin-cleavage sites.
Transferrin-mediated transfection of fibroblasts and myoblasts with
B-domain-deleted factor VIII gene followed by implantation into mice gave
therapeutic levels of factor VIII in the blood of the animals for 24 hours
(Zatloukal et al, 1994).
A similar ex
vivo transfection procedure used retroviral vectors for the introduction of
B-domain-deleted factor VIII gene into primary mouse
fibroblasts in culture; use of the MFG vector, which utilizes authentic viral
splicing signals and lacks a selectable marker gene was crucial in producing
high titer viral stocks (Dwarki et al, 1995). This procedure was followed by
surgical implantation into the peritoneal cavity in SCID mice of 15 million
cells in the form of neo-organs formed on expanded poly(tetra fluoroethylene)
(PTFE) fibers after they were coated with type I collagen from rat tail. Coated
fibers were arranged to the bottom of tissue culture dishes and genetically
modified cells were allowed to solidify on the PTFE fibers for 1-2 days; the
levels of factor VIII obtained were 50-1000 ng/ml which are 10-fold higher than
those required for correction of hemophilia A (Dwarki et al, 1995). Efficient
delivery of factor VIII was also observed after direct i.v. or i.p. injection
but not after i.m. or s.c. injection of genetically-modified cells; this
difference might arise from protease levels in the extracellular space of
muscle and skin (Dwarki et al, 1995).
The subject is being reviewed in depth by Connelly
and Kaleko (1998) and Hoeben (1998) in this volume.
B. Gene therapy of hemophilia B
Hemophilia B is caused by a defect in the blood
clotting factor IX (FIX) affecting about 1 in 30,000 males. The therapy
consists on administration of factor IX concentrates prepared from human
plasma, a fact that led to the infection of hemophiliacs with HIV and hepatitis
B virus in the 80s. Current research efforts are focused on the delivery of
factor IX gene using ex vivo transduction of primary myoblasts in mice with
factor IX gene followed by transplantation of the transduced cells (Dai et al,
1992; Yao et al, 1994). Mouse primary myoblasts were infected with retrovirus
expressing the canine factor IX under control of mouse muscle creatine kinase
and human CMV promoter; successfully infected myoblasts, selected in the
presence of G418, were injected into the hindlegs of recipient mice; secreted
canine factor IX was monitored in the plasma. Sustained expression of factor IX
for over six months without any apparent adverse effects on the recipient mice
was obtained; however, the levels of the factor IX protein secreted into the
plasma (10 ng/ml for 107 injected cells) were not sufficient to be of therapeutic
value but 100 times below the desired levels (Dai et al, 1992).
Dogs, lacking a functional factor IX gene, have been
used as animal models for hemophilia B. The liver of the animals is the organ
responsible for the production of factor IX; direct infusion of recombinant
retroviral vectors, carrying the canine factor IX gene, into the portal vein
cannulated into a splenic vein in animals previously subject to two-thirds
hepatectomy resulted in the expression of low levels of factor IX for up to
about 5 months; about 0.3-1% of hepatocytes were found to be transduced and
stained blue with X-Gal in liver sections when the b-galactosidase gene of E. coli was delivered with the same retroviral vector (Kay et al,
1993).
A sustained partial correction of the defect was
succeeded in hemophilia B dogs by directly delivering the factor IX gene in
adenovirus vectors by injection into the splenic veins of 1.6 to 2.2 pfu/Kg
adenovirus (Kay et al, 1994). The therapy, however, obtained was transient and
although these animals displayed 300% factor IX levels in their blood at day 2
from treatment, the levels dropped to 1% by three weeks and to 0.1% by 2 months
(Kay et al, 1994). Since T cell immunity was responsible for attacking and
eliminating virally-transduced cells from the body, clearing the corrected
cells from the liver of animals, daily administration of 19.5 mg/Kg cyclosporin
A led to prolongation of the therapeutic effect and to the persistence of
adenovirus-transduced cells (10% of factor IX levels by two months (Fang et al,
1995; Figure 35).
Cyclosporin A (CsA) is a cyclic peptide, fungal
metabolite, displaying low myelotoxicity but toxic to T cell lymphocytes; it is
widely used for immuno-suppression of individuals receiving renal and other
organ transplants but also for the therapy of autoimmune diseases. CsA inhibits
activation of IL-2 gene, an early event required for T cell activation and this
mechanism is thought to govern its immunosuppressive effects. However, CsA also
inhibits the activity of TBP required for transcription from the adenovirus
major late promoter. Recombinant adenovirus-transduced cells were able to elute
host immune surveillance in dogs by cyclosporin A treatment (Fang et al, 1995).
Similar conclusions were reached by Dai and coworkers (1995) using adenoviral
vectors for delivering the canine factor IX gene into the hind leg muscle of
mice: whereas in nude mice a high level of expression of FIX protein was
detectable for 300 days, expression of FIX protein lasted for 7-10 days in
normal mice. CD8+ lymphocytes were localized in the site of
injection; both cell-mediated and humoral immune responses were found to be
responsible for eliminating the adenovirus-infected cells from the organism.
Recently, successful transduction of the mouse liver
in vivo after a single hepatic gene transfer of F.IX cDNA in an AAV vector was
achieved; persistent and curative concentrations of functional human factor IX
were detected in the blood of the animals (Snyder et al, 1997). Intramuscular
injection of a recombinant AAV vector expressing human factor IX (hF.IX) into
hindlimb muscles of C57BL/6 mice and Rag 1 mice demonstrated the presence of
hF.IX protein by immunofluorescence staining of muscles harvested 3 months
after injection; however, no hF.IX was detected in the plasma of
immunocompetent C57BL/6 mice because these animals had developed circulating
antibodies to hF.IX. Rag 1 mice on the other hand, which carry a mutation in
the recombinase activating gene-1 and thus lack functional B and T cells, displayed
therapeutic levels (200-350 ng/ml) of F.IX in the plasma in addition to muscle
cells; F.IX levels gradually increased over a period of several weeks before
reaching a plateau that was stable 6 months after injection. Furthermore, these
studies have demonstrated colocalization of hF.IX and collagen IV in
interstitial spaces between muscle fibers; this was explained following
identification of collagen IV as a F.IX-binding protein (Herzog et al, 1997).
Figure 35. Transfer of the Factor IX gene
for the treatment of hemophilia B. The FIX gene under control of RSV LTR in a
recombinant adenovirus was infused into the portal vein of hemophiliac dogs
(see text for details). Reproduced from Boulikas T (1996b) Gene therapy to human diseases: ex vivo and in vivo studies.
Int J Oncol 9, 1239-1251. With the kind permission from the
International Journal of Oncology.
A mouse model for hemophilia B was generated by
homologous recombination-mediated disruption of the clotting factor IX gene;
the factor IX coagulant activities for wild-type (+/+), heterozygous (+/-), and
homozygous (-/-) mice were 92%, 53%, and <5%, respectively. Plasma factor IX
activity in the deficient mice (-/-) was restored by introducing wild-type
murine FIX gene via adenoviral vectors (Wang L et al, 1997).
Primary
skeletal myoblast-mediated gene transfer was tested for achieving a long-term
stable systemic production of human factor IX in SCID mice; a hFIX minigene
under the control of a b-actin promoter with the muscle creatine kinase
enhancers was used; myotubes derived from the myoblasts produced 1,750 ng
hFIX/106 cells/24 hours in culture; intramuscular injection of 5-20x
106 myoblasts to SCID mice stably produced hFIX into the systemic
circulation for at least up to 10 months (Wang JM et al, 1997).
XL. Gene therapy of hypertension
A. Molecular mechanisms of high blood pressure
Blood pressure can be altered by mutations in at
least 10 genes which alter blood pressure through a common pathway, affecting
salt and water reabsorption in the kidney. Probably the most promising lead has
involved the genes governing the structure of angiotensinogen, the substrate in
the renin reaction. Disorders associated with hypertension are the
glucocorticoid-remediable aldoste-ronism, the syndrome of apparent
mineralocorticoid excess, and Liddle's syndrome. Syndromes linked with
hypotension are the pseudohypoaldosteronism type 1, and Bartter's, and
Gitelman's syndromes (reviewed by Hollenberg, 1996; Karet and Lifton, 1997).
Identification of mutations in the gene encoding a
subunit of the renal sodium channel in the Liddle syndrome has unraveled the
mechanisms involved in this form of hereditary hypertension. Salt retention and
secondary high blood pressure are the result of constitutive activation of the
renal sodium channel by mutations in its gene.
The pathophysiological basis of Liddle's syndrome
(pseudoaldosteronism), a rare autosomal dominant form of arterial hypertension,
has been found to rest on missense mutations or truncations of the b- and g-subunits of the
epithelial sodium channel (ENaC) which controls sodium reabsorption in the
distal nephron; these mutations result in constitutive activation of the
amiloride-sensitive distal renal epithelial sodium channel (Shimkets et al, 1994);
its activity is under the control of aldosterone. The genes encoding ENaC have
been identified and revealed an heteromultimeric structure of the protein
composed of three homologous a b g subunits. Most of the mutations on ENaC reported are
either nonsense mutations or frame shift mutations which would truncate the
cytoplasmic carboxyl terminus of the b or g subunits of the channel.
The original report was that Liddle's syndrome is
caused by a premature stop codon that truncates the cytoplasmic carboxyl
terminus of the encoded b subunit (Shimkets et al, 1994). Sequencing of the
ENaC in a family with Liddle syndrome has also revealed a missense mutation in
the b subunit which predicted substitution of Tyr by His
at codon 618 (Tamura et al, 1996; reviewed by Schild, 1996); molecular variants
of these genes might also contribute to the common polygenic forms of
hypertension. Liddle's syndrome can also result from a mutation truncating the
carboxy terminus of the g subunit of this channel; this truncated subunit also
activates channel activity. These findings indicate independent roles of b and g subunits in the
negative regulation of channel activity (Hansson et al, 1995).
Expression of the mineralocorticoid receptor (MR) is
restricted to some sodium-transporting epithelia and a few nonepithelial target
tissues. The genomic structure of the human MR (hMR) revealed two different
untranslated exons (1a and 1b), which splice
alternatively into the common exon 2, giving rise to two hMR mRNA isoforms
(hMR-a
and hMR-b). Expression of the human MR transcripts in renal,
cardiac, skin, and colon tissue samples was examined by in situ hybridization.
Functional hypermineralocorticism was associated with reduced expression of hMR
b in sweat glands of two patients affected by Conn's
and Liddle's syndrom (Zennaro et al, 1997).
Blood vessels and other tissues of hypertensive
patients may have abnormal levels of several factors such as (i) the peptide kinin (produced from
kininogen) and its specific receptor,
(ii) kallikrein which processes kininogen into kinin, (iii) tissue kallikrein-binding protein (kallistatin), (iv) endothelial basic FGF, (v) the endothelium-derived nitric
oxide (NO) and endothelial NO synthase, and
(vi) the renin-angiotensin system (angiotensinogen, AT) and its receptor
(AT1 receptor).
B. Gene therapy for hypertension
The peptide kinin,
after binding to its specific receptor, triggers a broad spectrum of biological
effects such as vasodilatation, increase in vascular permeability, smooth
muscle contraction and relaxation, and electrolyte and glucose transport; it
plays an important role in homeostasis of blood pressure, sodium excretion in
the kidney, and inflammatory disorders. It is produced from a larger
oligopeptide precursor, kininogen,
after cleavage by a specific protease called kallikrein. Low levels of this protease in urine have been
associated with hypertension. Repeated oral administration of swine pancreatic
kallikrein can lower the blood pressure of hypertensive patients albeit in a
temporal manner.
Delivery of a 5.6 kb genomic clone or of a 834-bp
cDNA clone encoding the kallikrein gene under control of the albumin promoter,
CMV, RSV, or metallothionein promoters into the portal vein or tail vein of
spontaneously hypertensive rats resulted in significant reduction of their
blood pressure for about 5-6 weeks (Chao et al, 1996). Intravenous injection of
an adenoviral vector containing the human tissue kallikrein gene under the
control of a CMV promoter, into spontaneously hypertensive rats caused a
sustained delay in the increase in blood pressure from day 2 to day 41
post-injection. The therapeutic effect was a result of transfection of the
human gene into several rat tissues and human tissue kallikrein mRNA was
detected in the liver, kidney, spleen, adrenal gland, and aorta (Jin et al,
1997).
Treatment of hypertension with gene therapy has also
been attained by transfer of the human tissue kallikrein-binding protein (HKBP)
or kallistatin, a serine proteinase
inhibitor (serpin). Transgenic mice overexpressing rat kallikrein-binding
protein are hypotensive; kallistatin may function as a vasodilator in vivo.
Delivery of the human kallistatin cDNA under control of the RSV 3' LTR in an
adenoviral vector into spontaneously hypertensive rats by portal vein injection
resulted in a significant reduction of blood pressure for 4 weeks; human
kallistatin mRNA was detected in liver, spleen, kidney, aorta, and lung (Chen
et al, 1997).
Blood pressure is also controlled by other factors
such as by the endothelium-derived nitric oxide (NO) in peripheral vessels.
Transfer of the human endothelial NO
synthase (eNOS) gene to spontaneously hypertensive rats gave a continuous
supply of eNOS which caused a significant reduction of systemic blood pressure
for 5 to 6 weeks; the effect continued for up to 10 weeks after a second
injection (Lin et al, 1997).
Angiotensinogen, a substrate for angiotensin I generation, is mainly
produced in the liver, and is a unique component of the renin-angiotensin
system. Mutations in the angiotensinogen gene are associated with hypertension.
It is unclear whether circulating angiotensinogen is a rate-limiting step in
blood pressure regulation. Transfer of antisense oligonucleotides against rat
angiotensinogen into the rat liver via the portal vein diminished the
expression of hepatic angiotensinogen mRNA and resulted in a transient decrease
in plasma angiotensinogen levels in spontaneously hypertensive rats from day 1
to day 7 after the injection. Liposomes were used for the transfer of oligonucleotides
containing viral agglutinins to promote fusion with target cells. This
treatment resulted in a decrease in plasma angiotensin II concentration;
transfection of sense and scrambled oligonucleotides did not show any changes
in plasma angiotensinogen level, blood pressure, or angiotensinogen mRNA level
(Tomita et al, 1995).
The renin-angiotensin
system plays an important role in blood pressure regulation; Phillips and
coworkers (1997) have targeted the renin-angiotensin system at the level of synthesis
(angiotensinogen, AT) and the receptor (AT1 receptor). Antisense
oligonucleotides to AT1-receptor mRNA and to angiotensinogen mRNA reduced blood
pressure. The cDNA for the AT1 receptor was inserted in the antisense direction
under control of CMV promoter in AAV (which was the system of choice among
adeno, retrovirus, naked DNA and liposomes tested) and injected either directly
in the hypothalamus (1 mL) or in the lateral ventricles (5 mL). A prolonged decrease in blood pressure in
spontaneously hypertensive rats was achieved via delivery of antisense DNA for
AT1-R causing a significant reduction in AT1 receptors. After a single
injection there was a significant decrease of blood pressure (approximately 23
+/- 2 mm Hg) for up to 9 weeks (Phillips, 1997; Phillips et al, 1997).
Blood vessels of spontaneously hypertensive rats were
shown to be associated with sub-physiological amounts of endothelial basic FGF (bFGF); this decrease correlated both with
hypertension and with a decrease in the endothelial content of nitric oxide
synthase. As a consequence, transfer of the bFGF
gene corrected hypertension, restored the physiological levels of bFGF in
the vascular wall, significantly enhanced the number of endothelial cells with
positive immunostaining for nitric oxide synthase, and ameliorated
endothelial-dependent responses to vasoconstrictors (Cuevas et al, 1996).
Gene therapy of hypertension has been achieved via
transfer of the atrial natriuretic peptide (ANP) gene to
genetically hypertensive rats; chronic infusion of ANP has been shown to cause
natriuresis, diuresis, and hypotension in rats and humans. Intravenous delivery
of the human ANP gene fused to the
RSV 3'-LTR (shown to be expressed in heart, lung, and kidney) caused a
significant reduction of systemic blood pressure in young hypertensive rats (4
weeks old), and the effect continued for 7 weeks; a maximal blood pressure
reduction of 21 mm Hg in young hypertensive rats was observed 5 weeks after
injection along with significant increases in urinary volume and urinary
potassium output (Lin et al, 1995).
XLI. Gene therapy for obesity
A. Molecular mechanisms of obesity
Obesity results from an imbalance in the mechanisms
which control storage of energy as triglycerides in adipose cells versus energy
expenditure. The identification of the ob
gene, and its encoded protein leptin, as subfunctional in obesity (Zhang et al,
1994) has advanced our understanding on the mechanisms of receival and
integration of a feedback signaling reflecting the amount of adipose energy
stores (reviewed by Spiegelman and Flier, 1996). Further advancement was the
identification of the db gene (also
known as OB-R gene) on mouse
chromosome 4 encoding the receptor of leptin which is expressed primarily in
the hypothalamus and choroid plexus; OB-R is a single membrane-spanning
receptor most related to the gp130 signal-transducing component of the IL-6
receptor, the G-CSF receptor, and the LIF receptor (Tartaglia et al, 1995).
The leptin is a hormone which is secreted from the
white adipose tissue as a plasma protein, that acts in the hypothalamus to
regulate the size of the body fat depot; the leptin with its receptor
constitute a hormone-receptor pair that signals the status and magnitude of
energy (fat) stores to the brain serving as an adipostatic signal to reduce
food intake and body weight. Leptin might have evolved to inform the brain that
energy stores in adipose tissue are sufficient but also to trigger a
neuroendocrine response to fasting and limitation of food intake (Ahima et al,
1996). Leptin also acts acutely to increase glucose metabolism after
intravenous and intracerebroventricular administrations; both intravenous or
intracerebroventricular infusion of leptin into wild-type mice increased
glucose turnover and glucose uptake (the plasma levels of insulin and glucose
did not change), but decreased hepatic glycogen content; thus, the effects of
leptin on glucose metabolism are mediated by the central nervous system
(Kamohara et al, 1997).
Plasma leptin was found to be highly correlated with
body mass index (BMI) in rodents and in 87 lean and obese humans. In humans,
there was variability in plasma leptin at each BMI group suggesting that there
are differences in its secretion rate from fat. Weight loss due to food
restriction was associated with a decrease in plasma leptin in samples from
mice and obese humans (Maffei et al, 1995).
B. Animal models for obesity
A number of rodent models for obesity are being used
in the laboratories including db/db, fa/fa, yellow (Ay/a) VMH-lesioned, and
those induced by gold thioglucose, monosodium glutamate, and by transgenic
ablation of brown adipose tissue. The ob/ob mouse is genetically deficient in
leptin. The expression of leptin mRNA and the level of circulating leptin are
increased in these animal models, suggesting resistance to one or more of the
actions of leptin. High-fat diet was found to evoke a sustained increase in
circulating leptin in normal FVB mice and FVB mice with transgene-induced
ablation of brown adipose tissue; leptin levels were found to accurately
reflect the amount of body lipid across a broad range of body fat. However,
despite increased leptin levels, animals fed a high-fat diet became obese
without decreasing their caloric intake, suggesting that a high content of
dietary fat limits the action of leptin (Frederich et al, 1995). Peripheral and
central administration of microgram doses of OB (leptin) protein reduced food
intake and body weight of ob/ob and diet-induced obese mice but not in db/db
obese mice (Campfield et al, 1995).
Body weight and adiposity appear to play a critical
role in the timing of puberty in humans and rodents. Leptin is the signal that
informs the brain that energy stores are sufficient to support the high energy
demands of reproduction, and may be a major determinant of the timing of
puberty. Indeed, injections of recombinant leptin (once daily) in female mice
showed an earlier onset of three classic pubertal parameters (i.e., vaginal
opening, estrus, and cycling) compared with saline-injected controls. In
addition to its effects on body weight, chronic leptin treatment restored
puberty and fertility to ob/ob mice with total leptin deficiency, and acute
treatment with leptin substantially corrected hypogonadism in mice starved for
2 days without affecting body weight (Ahima et al, 1997). In a different study
leptin was found to play a significant role in sustaining the male mouse
reproductive pathways: all leptin-treated ob/ob males fertilized normal females
mice that carried out normal pregnancies and deliveries, demonstrating that the
reproductive capacity of sterile ob/ob males was corrected only with leptin
treatment (Mounzih et al, 1997).
C. Glucocorticoids and obesity
The crucial role of glucocorticoids in obesity and
insulin resistance and the actions of the OB protein leptin on the
hypothalamic-pituitary-adrenal axis suggest that there is an important
interaction of leptin with the glucocorticoid system. Leptin inhibits cortisol
production in adrenocortical cells and therefore appears to be a metabolic
signal that directly acts on the adrenal gland (Bornstein et al, 1997).
Glucocorticoids play a key inhibitory role in the action of leptin: the
permissive role of glucocorticoids in the establishment and maintenance of
obesity syndromes in rodents arises from that glucocorticoids restrain the
effect of leptin. Leptin injected intracerebroventricularly in normal rats
induced modest reductions in body weight and food intake. In marked contrast,
the same dose of leptin had very potent and long-lasting effects in decreasing
both body weight and food intake when administered to adrenalectomized rats
(Zakrzewska et al, 1997).
D. Therapy of obesity with leptin infusion
High leptin levels are observed in obese humans and
rodents, suggesting that, in some cases, obesity is the result of leptin
insensitivity. To test this hypothesis Halaas et al (1997) have used
subcutaneous infusion of leptin to lean mice; this resulted in a dose-dependent
loss of body weight at physiologic plasma levels. Chronic infusions of leptin
intracerebroventricularly (i.c.v.) at doses of 3 ng/hr or greater resulted in
complete depletion of visible adipose tissue, which was maintained throughout
30 days of continuous i.c.v. infusion. Direct measurement of energy balance
indicated that leptin treatment prevented the energy decrease that follows
reduced food intake but did not increase total energy expenditure (Halaas et
al, 1997). In New Zealand Obese (NZO) mice, which were unresponsive to
peripheral leptin but were responsive to i.c.v. leptin, obesity was the result
of leptin resistance most likely arising from a decreased transport of leptin
into the cerebrospinal fluid(Halaas et al, 1997).
Leptin administration reduced obesity in
leptin-deficient ob/ob mice. Van Heek et al (1997) examined whether
diet-induced obesity in mice produces resistance to peripheral and/or central
leptin treatment. In a diet-induced obesity model, mice exhibited resistance to
peripherally administered leptin, while retaining sensitivity to centrally administered
leptin (by a single intracerebroventricular infusion). Whereas C57BL/6 mice
initially responded to peripherally-administered leptin with a marked decrease
in food intake, leptin resistance developed after 16 days on high fat diet;
however, central administration of leptin to peripherally leptin-resistant mice
resulted in a robust response to leptin. Thus, the effects of additional leptin
administration in obese humans who have high circulating leptin levels,
especially after intravenous injection (peripheral) versus
intracerebroventricular infusion, remain to be determined. This study also
implies the importance of the tissue target for the delivery of the leptin gene
for treatment of obesity in humans.
E. The leptin and leptin receptor genes
Cloning of the gene encoding leptin (ob gene) and its receptor (db gene) has provided spectacular
insights in elucidating the mechanisms involved in the control of food intake
and body weight maintenance in obese and lean individuals. Transgenic mice
lacking both alleles of either ob or db genes showed early onset obesity from
excessive food intake and decreased energy expenditure, and in addition showed
severe insulin resistance, diabetes, and sterility; administration of
recombinant leptin had weight reducing effects (Campfield et al, 1995; Halaas
et al, 1995; Pellymounter et al, 1995).
However, the vast majority of obese humans appear to
have excessively high levels of leptin and absence of mutations in the OB gene (Considine et al, 1995; Maffei
et al, 1996). The nonsense mutation in the ob mouse which results in the
conversion of arginine 105 to a stop codon of leptin gene was not present in
human obesity. The defect in humans is localized in the signaling pathway in
the brain which might involve: (i) the
leptin receptor; (ii) the Tub
protein, expressed in the hypothalamus, that mediates the signaling to the
interior of the hypothalamus cell; (iii)
the Agouti protein which is expressed in all tissues in obese mice but in
the skin in normal mice, supposed to antagonize melanocortin signal to the CNS;
and (iv) carboxypeptidase E (product
of the fat gene) expressed in
endocrine and neuroendocrine tissues (reviewed by Spiegelman and Flier, 1996).
Using a reverse transcription PCR product of the
coding region of the Obese (ob) gene from five lean and five obese subjects it
was determined that there was 72% more ob gene expression in eight obese
subjects compared to eight lean controls; thus, ob gene expression is increased
in human obesity (Considine et al, 1995). Limitation in food intake reduced the
reproductive competence, reduced the levels of thyroid hormone, and activated
the adrenal-pituitary stress axis; these starvation adaptations were reversed
with administration of recombinant leptin (Ahima et al, 1996).
Obesity can result from a promotion in adipocyte
differentiation. A number of mitogens (PDGF, EGF, FGF, tumor promoters),
cytokines (TNF-a, IL-1, IL-6, TGF-b,
IFN-g) and oncogenes inhibit adipocyte differentiation
and, therefore, inhibited adipogenesis and obesity. Insulin plays a positive
role in the differentiation of adipocyte precursors and stimulates lipogenesis
in adipose cells but exerts a negative lipogenic response in fibroblasts;
preadipocytes which express small amounts of insulin receptors require insulin
or insulin-like growth factor-1 for optimal differentiation.
The mechanism of inhibition of adipogenesis by
mitogens involves activation of the mitogen-induced MAP kinase which
phosphorylates at serine-112 the adipogenic transcription factor PPARg (peroxisome proliferator-activated receptor g). PPARg acts as a dimer with
RXRa to regulate adipocyte differentiation and
sensitivity of the adipose cells to insulin. PPARg
is the high affinity receptor for the thiazolidinedione class of
insulin-sensitizing drugs and the PPARg-drug binding results in
a powerful adipogenic response; thus, factors which stimulate the MAP kinase
phosphorylation of PPARg, could cause resistance to insulin (Hu et al, 1996).
F. Gene transfer of the leptin gene
This field is in its infancy; however, animal studies
showed that treatment of obese persons is one of the future prospects of gene
therapy. Adenovirus-mediated transfer of the mouse leptin cDNA in the ob/ob
mouse (which is genetically deficient in leptin and exhibits both an obese and
a mild non-insulin-dependent diabetic phenotype) resulted in dramatic
reductions in both food intake and body weight, as well as the normalization of
serum insulin levels and glucose tolerance (Muzzin et al, 1996). Thus, transfer
of the leptin gene can correct the obese and diabetic phenotypes in the adult
ob/ob mice; these studies also provided confirming evidence that the control in
body weight may be critical in the long-term management of
non-insulin-dependent diabetes mellitus in obese patients.
Infusion of a recombinant adenovirus containing the
rat leptin cDNA under control of the CMV promoter to Wistar rats (8 ng/ml for
28 days) made them hyperleptinemic; these animals exhibited a 30-50% reduction
in food intake and gained only 22 g over the experimental period versus 115-132
gained by control animals. Body fat was absent and plasma triglycerides and
insulin levels were significantly lower in hyperleptinemic compared to control
rats (Chen et al, 1996).
On the contrary, delivery of the rat neuropeptide Y
(NPY) cDNA with AAV and Sendai virosomes into the rat hypothalamic
para-ventricular nucleus increased body weight and food intake for 21 days (Wu
et al, 1996).
XLII. Profile of Biotech companies: the big race
Research and drug development in Biotech Industry
have played and continue to play an important role in advancing molecular
medicine. A number of Biotechnology Companies sponsor ongoing gene therapy
Clinical Trials led by Genetic Therapy Incorporated (part of Novartis, Gaithersburg,
MD) with the phase III trial in glioblastoma.
Biotech Companies have the expertise and resources in
large scale production, regulatory affairs, and clinical development to take
off the basic science of gene therapy into the skies of commercialization and
clinical trials. This is more evident in USA where strong bridges between the
academia and industry have been established and numerous biotechnology
companies dedicated to gene therapy have been founded. As of 1997 Europe lags
some 3 to 5 years behind USA in translating basic science into commercial
technology; however, European Pharmaceutical Companies have invested $1.4
billion in the American gene and cell therapy industry (compared with a modest
$140 million investment from USA biotech firms to European partners). It is
certain that both USA and Europe will ultimately benefit from the successful
gene therapy development (Martin, 1997).
Table 8 gives a glimpse of the role of Biotech
Industry in drug discovery related to gene therapy and the clinical trials
sponsored.
Table 8. Biotech companies and drug
development related to genes or cancer targeting
|
Company |
Drug/Gene type |
Goal/Disease |
Status of drug development (end of
1997) |
|
Calydon
(San Francisco, CA) |
Prostate
cancer gene therapy |
|
Preclinical
trials |
|
Canji/Schering-Plough
(San Diego, CA) |
p53 to
restore p53-mediated tumor suppression or apoptosis |
Colon
with hepatic metastases(#131); prostate (#148) |
Phase I |
|
Canji/Schering-Plough
(San Diego, CA) |
RB to
restore RB-mediated cell cycle arrest |
Bladder(#140),
non-small cell lung cancer (#156), lung, ovarian, and liver cancers |
Early
clinical trials |
|
Cell
Genesys, Inc |
CC49-Zeta
T cell receptor |
Colorectal
carcinomas expressing the tumor-associated antigen, TAG-72 (#110) |
Phase I
/II |
|
Cell
Genesys, Inc |
CD4-zeta
Chimeric Receptor |
HIV (#85,
116) |
Phase
I-II |
|
Chiron
Corporation (Emerville & San Diego CA) |
HIV-1IIIB
envelope protein (#108) |
HIV |
Phase I |
|
IDUN
Pharmaceutical (San Diego, CA) |
bcl-2 inhibition |
|
Preclinical
trials |
|
Incyte
Pharmaceuticals (Palo Alto, CA) |
Gene
sequence databases |
|
License
access to database for drug discovery to different companies |
|
Introgen
Therapeutics (Austin and Houston, TX) |
p53 gene therapies to restore
p53-mediated tumor suppression or apoptosis |
Lung,
head and neck cancers, prostate cancer (#154) |
Phase
I-II |
|
Gene
Medicine, Inc. (The Woodlands, Texas) |
a1-Antitrypsin cDNA/cationic lipids |
a1-antitrypsin deficiency (#194) |
Phase I |
|
Gene
Medicine, Inc. |
Human
insulin-like growth factor-1(hIGF-1) |
Cubital
Tunnel syndrome (#164) |
Phase I |
|
Genetic
Therapy, Inc. /Novartis (Gaithersburg, MD) |
HSV-tk |
brain
tumors (#17), recurrent pediatric brain tumors (#45), recurrent glioblastoma
(#32, 97, 99), astrocytoma (#42, 68), leptomeningeal carcinomatosis (#49),
multiple myeloma (#75) |
Phase I |
|
Genetic
Therapy, Inc. /Novartis |
CFTR/adenovirus
vector |
Cystic
fibrosis (#121) |
Phase I |
|
Genetic
Therapy, Inc. /Novartis |
Glucocerebrosidase
cDNA |
Gaucher
disease (#39) |
Phase I |
|
Genset |
|
Isolation
of regulatory regions |
|
|
Genta (La
Jolla, CA) |
bcl-2 inhibition with antisense |
cancer |
Early
clinical trials |
|
Genzyme
Corporation (Framingham, MA) |
CFTR/adenovirus
vector/cationic lipids |
Cystic
fibrosis (#120, 128, 129, 203) |
Phase I |
|
GenVec,
Inc. |
VEGF121
cDNA to the ischemic myocardium |
Coronary
artery disease (#157) |
Phase I |
|
Glaxo Wellcome
Inc. |
CFTR/Cationic
Liposome Complex |
Cystic
fibrosis |
Phase I |
|
LXR
(Richmond, CA) |
Antiapoptotics |
|
Advanced
clinical trials |
|
Mitotix
(Cambridge, MA) |
Cell
cycle inhibitors |
|
Preclinical
trials |
|
Myriad
Genetics (Salt Lake City, UT) |
Diagnostic
genetic testing |
BRAC
analysis kit for breast cancer |
In the
market |
|
Onyx
(Richmond, CA) |
p53 gene therapies killing cells
that lack p53 |
|
Early
clinical trials |
|
Ribozyme
Pharmaceuticals, Inc (Boulder, CO) |
Tat and
Rev Hammerhead Ribozyme |
HIV
replication inhibition (#117) |
Phase II |
|
Ribozyme
Pharmaceuticals, Inc (Boulder, CO) |
Growth
factor inhibition |
|
Preclinical
trials |
|
Rh™ne-Poulenc
Rorer Gencell (Vitry-sur-Seine, France & Santa Clara, California) |
p53 |
Head and
neck squamous cell carcinoma (#152) |
Phase II |
|
SEQUUS
Pharmaceuticals (Menlo Park, CA) |
Doxorubicin
encapsulated into ÒstealthÓ liposomes |
Kaposis
sarcoma |
In the
market (Doxil); clinical trials for other cancers |
|
SUGEN
(Redwood City, CA) |
Tyrosine
kinase inhibitor to inhibit PDGF receptor |
Gliomas |
Clinical
trials |
|
Targeted
Genetics Corporation |
HSV-tk |
HIV (#81) |
Phase
I/II |
|
Targeted
Genetics Corporation |
E1A/
DC-Chol-DOPE |
Metastatic
breast or ovarian cancer, metastatic solid tumors that overexpress HER-2 /neu |
Phase I |
|
Targeted
Genetics Corporation |
CFTR/AAV |
Cystic
fibrosis |
Phase I |
|
Vical,
Inc. |
Tumor
idiotype |
Non-HodgkinÕs
B-cell lymphoma (#161) |
Phase
I/II |
|
Vical,
Inc. (San Diego, California) |
b-2
Microglobulin cDNA/cationic lipids |
Immunotherapy
of advanced colorectal carcinoma, renal cancer (#195), melanoma (#196),
metastatic malignancies (#201) |
Phase
I/II |
|
Vical,
Inc. |
Interleukin-2
cDNA |
Lymphoma
(#198), solid tumor immunotherapy (#211) |
Phase I |
|
Vical,
Inc. |
HLA B7
cDNA |
Renal
cancer immunotherapy |
Phase I |
|
|
|
|
|
|
|
|
|
|
XLIII. Prospects
A. Gene discovery: novel horizons in gene therapy
By the year 2005 the human genome project will be
completed and by the end of 1998 the entire cDNA repertoire of the 125,000
human genes will be sequenced completely (Incyte Pharmaceuticals, Palo Alto,
CA). Every single open reading frame of the human genome will become known.
Genes implicated in human disease are being
identified by mapping the mutation to a chromosomal locus after examining the
DNA from a number of patients; candidate genes residing in this locus are then
examined in a large number of patients for inactivating mutations (e.g.
Polymeropoulos et al, 1996, 1997). A number of other classical techniques are
aimed at identifying novel tumor suppressor genes or genes involved in
metastasis, adding new weapons to the fight against cancer. The elucidation of
many of the pathways implicated in the regulation of the cell cycle, signaling
pathways with cytokines, and activation and action of transcription factors on
the regulatory regions of genes lead to the discovery of new drugs interfering
with those pathways. The elucidation of a number of players in apoptosis
provides also targets not only for cancer treatment but for a number of
neurodegenerative diseases. All these studies will ultimately provide new
targets and genes for gene therapy.
B. Mutations in DNA and human disease
A number of human disorders have been linked to
mutations in specific genes that result in loss of function of a specific
protein in all somatic cells of the body. In the majority of cases known today
the mutation is at the coding region of the gene resulting in one amino acid
substitution at an important domain of the encoded protein, in amino acid
deletions, or in protein truncation. For example, deletion of three nucleotides
resulting in deletion of a single phenylalanine at the protein level of the
CFTR molecule is responsible for cystic fibrosis (Riordan et al, 1989); an A to
T transversion leading to a premature stop at amino acid 337 in one allele and
a C to T transition triggering an erroneous splice event and to frameshift in
the other allele are associated with mutations in the ERCC6 helicase in
Cockayne's syndrome (Troelstra et al, 1992).
Mutations could result in failure of the protein to
interact with DNA (mutated p53), with other regulatory proteins, or in enzymatic
dysfunction of the molecule. Defects at the nuclear localization signal of a
nuclear protein resulting in its cytoplasmic retention have been identified in
cancer cells (Chen et al, 1995). Mutations in regulatory regions (promoters,
enhancers) of genes, poorly understood but expected to play an important role
in human disease, could result in down-regulation of the gene they dictate;
mutation in the DNA-binding or transactivation domains of transcription factors
are expected to down-regulate the expression of their target genes. Most
important, mutations in genes involved in DNA repair are expected to have a
domino effect on the appearance of mutations in other regions of the genome,
since it is these genes that are responsible for removal of premutagenic
lesions incurring by a number of xenobiotics by patrolling the human genome
(Boulikas, 1996c).
C. Regulatory regions and the MAR project
The identification of the regulatory regions from the
human genome should also become a first priority. Regulatory regions will
provide new DNA control elements for the tissue-specific expression, episomal
replication, insulation, and silencing of genes in gene therapy protocols but
also targets, using small oligonucleotides (e.g. triplex) to abort
transcription of specific genes. Regulatory regions include enhancers (ENHs, at
least two for each gene), promoters (about 125,000 total, a significant
fraction of which might be known because of their proximity to the 5' end),
origins of replication (ORIs, about 50,000 have been estimated), silencers,
locus control regions (LCRs, perhaps several thousand), and matrix-attached
regions (seem to coincide with enhancers and ORIs). 445,000 is a modest
estimate of the total number of regulatory regions in the human genome. Their
size ranges from 100-500 bp but much more for LCRs and some ORIs.
Identification of strong regulatory regions from the human genome is expected
to provide strong promoter and enhancer sequences for the universal and cell
type-specific expression of transgenes in gene therapy but also strong human
ORIs able to sustain extrachromosomal replication of plasmids loaded with
therapeutic genes in human and animal model tissues.
Transcription factor recognition sequence databases
can be used in conjuction with other software methods (DNA curvature, inverted
repeats, triplex DNA, Z-DNA, phased nucleosomes) to predict regulatory regions
from the large DNA sequence information arising from the human genome project
(Boulikas, 1995b; Bode et al, 1998, this volume).
A technology developed in our laboratory based on
isolation and cloning of matrix-attached regions, shown to harbor a large
fraction of regulatory regions from the human and other genomes, is being
applied for identifying human regulatory regions (MAR project). MAR libraries
include tissue-specific and tumor-specific regulatory regions. One particular
MAR clone that has been extensively characterized (Boulikas et al, in
preparation) represents the ORI, enhancer, and MAR of the human choline
acetyltransferase gene, of crucial importance in neurological disorders
including Alzheimer's disease. When a subfragment of only 513 bp of this
MAR/ORI/ENH was placed at the flanks of the luciferase gene it was able to
sustain episomal replication in human culture cells (K562 erythroleukemia) for
more than 4 months. The actual 3.6 kb ChAT ORI region comprises a 1.2 kb
silencer whose presence inhibits the ORI function; thus, mammalian origins of
replication are much more sophisticated than viral ORIs and contain a number of
control elements, including silencers, for the cell type and developmental
stage-specific regulation. Identification and elimination of silencers from
human ORIs is of importance in the exploitation of ORI fragments in the
episomal replication of therapeutic genes.
MAR sequences sorted out into MAR/ORI, MAR/enhancer
and MAR/insulators can be used to promote extrachromosomal replication, to
enhance the transcription of genes or to insulate genes from position effects
from chromatin surroundings after integration. A number of studies show that
MARs act as insulators of genes shielding them from position effect variegation
from neighboring chromatin domains in transgenic studies; this shielding
results in a 2 to 1000-fold increase in the expression level of transgenes when
MARs are included on both sides of the foreign gene (see Boulikas 1995b).
Identification of tumor-specific MARs, such as
identification of the MARs of the carcinoembryonic antigen (CEA) gene, the
breast cancer/ovarian cancer BRCA1 gene, and others can lead to the development
of plasmid vectors able to drive the expression of therapeutic genes in
specific tumor cell types. In the postgenomic era, identification of a
reasonable fraction of regulatory regions will revolutionarize our approaches
to human disease.
D. What is next on gene therapy?
Theoretically, most human disorders could constitute
targets for gene therapy, aimed at correcting the defect either by transferring
the wild-type gene in all somatic cells of the body or to those specific cell
types responsible mainly for the synthesis of the particular protein (e.g.
factor IX gene in liver cells of hemophilia B patients).
Nuclear localization signal (NLS) peptides hooked to
triplex-oligonucleotides or to plasmids, or complexation of plasmids with
nuclear proteins possessing multiple NLSs are expected to increase nuclear
localization and enhanced expression of foreign genes.
A significant number of discoveries in molecular
biology of human diseases have opened doors to the development of strategies
for gene therapy. New genes whose mutations are responsible for human disease,
from mild to life threatening, are being discovered and the molecular
mechanisms are being unraveled. Many pieces of the puzzle aimed at elucidating
mechanisms leading to human disease and the genes implicated have been solved
and lie as scattered pieces of knowledge in various publications, lab
notebooks, or patent applications. Preexisting Biotech Companies redefine their
missions and new Biotech Companies are being founded to explore new discoveries
and develop new drugs; to win the race in the fight against human disease,
especially cancer and AIDS, we need to gather the right components into a
successful assemble.
Retroviruses, adenoviruses, AAV, HSV, naked plasmid
delivery, and liposomes all have a good share as delivery vehicles for genes
and it seems that they will be developed independently, each with its own
strengths and limitations for particular gene therapy protocols. For example,
liposomes have a distinct advantage over other systems for the delivery of
oligonucleotides, stealth liposomes could prove their strength in the systemic
delivery of genes by intravenous injection, retroviruses and adenoviruses for
their high transfection efficiency, AAV for not stimulating inflammation, HSV
as a vehicle for gene therapy to the nervous system, HIV and HSV vectors for their high payload
capacity. Furthermore, adenoviruses, AAV, HSV-1, HIV-1 vectors can transduce
nondividing cells (Table 1 on page
29).
A lot has been learned about the involvement of the
tumor suppressor p53 protein in cancer etiology. The current view is that an
initiated tumor cell in the body, having mutations in one or more oncogenes
needs to acquire loss in function in both alleles of p53 or other tumor
suppressor gene in order to expand into the tumor cell mass. Expression of the
wild-type (non-mutated form) of p53 arrests the proliferation in tumor cells
and induces apoptosis (suicidal programmed death) by boosting the expression of
the genes of p21, bax, and Gadd45 and by repressing the bcl-2 gene. Transfer of
the p53 gene with adenovirus or retrovirus after intratumoral injection has
successfully led to eradication of tumors in animal models and in human
patients at advanced stages of non small cell lung cancer. Intratumoral
injection, however, is not expected to be applicable to metastases very
frequently associated with advanced stages of cancer. Stealth liposomes might
offer a solution to this problem.
Anti-angiogenesis therapy, both drug-mediated and
gene therapy, would bring important ammunition in the fight against cancer.
Improvements in oligonucleotide delivery in vivo, a
very promising field that is in its infancy at the delivery level, will advance
the field of pharmacogenomics by providing triplex-forming oligonucleotide
drugs to inhibit the transcription of specific genes or ribozyme drugs to lower
the mRNA level of a specific target protein.
We expect the final victory of the human race on
cancer to be accomplished over the next 10 years. Gene therapy would, no doubt,
have an important role to play. It is likely that a combination of gene therapy
(p53, HSV-tk, angiostatin) along with the already existing antineoplastic drugs
(doxorubicin, cisplatin) but at subtoxic doses and at much lower concentrations
than those used today, as well as less severe doses of radiation, would become
routine regimens in hospitals for the eradication of all cancer types. In this
respect, the emerging priority in gene therapy is to improve the efficiency of
tissue targeting and gene delivery.
Acknowledgements
I am grateful to all authors who have kindly provided
their permission and original photos to use in this article. Special thanks to
Franois Meyer, Max Birnstiel, Brian Johnston, Marc Vasseur, Claude HŽlne,
Frank Martin, Joe Vallner, Douglas Jolly, Jeff Seilhamer, Demetrios Spandidos,
Kaz Taira, Ernst Wagner, Peter Dehlinger, Ko Kurachi, Dan Maneval, Jerzy
Jurkat, Ed Trifonov, and Emile Zuckerkandl for stimulating discussions. I am
also grateful to past and present members of my group for their contributions
to the ongoing projects related to the subjects discussed here in particular
Linda Hsie, CF Kong, Dawn Brooks, John Costouros, and Jie Hu, as well as to my
collaborators Maria Zannis-Hadjopoulos, JŸrgen Bode, and Wolfgang Deppert.
References
Abdallah (1996) A powerful nonviral vector for in
vivo gene transfer into the adult mammalian brain: polyethylenimine. Hum Gene Ther 7, 1947-1954.
Abdel-Mageed
A, Agrawal KC (1997) Antisense
down-regulation of metallothionein induces growth arrest and apoptosis in human
breast carcinoma cells. Cancer Gene Ther
4, 199-207.
Aebersold
P, Kasid A, Rosenberg S (1990)
Selection of gene-marked tumor infiltrating lymphocytes from post-treatment
biopsies: A case study. Hum Gene Ther
1, 373-384.
Agoff SN, Hou J, Linzer DIH, Wu B (1993) Regulation of the human hsp70 promoter by p53. Science 259, 84-87.
Ahima RS,
Dushay J, Flier SN, Prabakaran D, Flier JS (1997) Leptin accelerates the onset of puberty in normal female
mice. J Clin Invest 99, 391-395.
Ahima RS,
Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, Flier JS (1996) Role of leptin in the
neuroendocrine response to fasting. Nature
382, 250-252.
Akkina RK,
Walton RM, Chen ML, Li QX, Planelles V, Chen IS (1996) High-efficiency gene transfer into CD34+ cells
with a human immunodeficiency virus type 1-based retroviral vector pseudotyped
with vesicular stomatitis virus envelope glycoprotein G. J Virol 70, 2581-2585.
Ali RR,
Reichel MB, Thrasher AJ, Levinsky RJ, Kinnon C, Kanuga N, Hunt DM, Bhattacharya
SS (1996) Gene transfer into the mouse retina mediated by an adeno-associated
viral vector. Hum Mol Genet 5,
591-594.
Ali–o SF,
Bobadilla M, Crespo J, and Lejarreta M (1996)
Human a1-antitrypsin gene transfer to in vivo mouse hepatocytes. Hum Gene Ther 7, 531-536.
Allay J,
Dumenco L, Koc ON, LiumL, and Gerson SL (1995) Williams DA, Hsieh K, Desilva A,
and Mulligan RC (1987) Protection of
bone marrow transplant recipients from lethal doses of methotrexate by the
generation of methotrexate resistant bone marrow. J Exp Med 166, 210-218.
Allen, GC.,
Hall, GE Jr, Childs LC, Weissinger AK, Spiker S, and Thompson WF (1993) Scaffold attachment regions
increase reporter gene expression in stably transformed plant cells. Plant Cell 5, 603-613.
Alon T,
Hemo I, Itin A, Pe'er J, Stone J, Keshet E (1995) Vascular endothelial growth factor acts as a survival factor
for newly formed retinal vessels and has implications for retinopathy of
prematurity. Nature Med 1,
1024-1028.
Alton EWFW,
Middleton PG, Caplen NJ, Smith SN, Steel DM, Munkonge FM, Jeffery PK, Geddes
DM, Hart SL, Williamson R, Fasold KI, Miller AD, Dickinson P, Stevenson BJ,
McLachlan G, Dorin JR, Porteous DJ (1993)
Non-invasive liposome-mediated gene delivery can correct the ion transport
defect in cystic fibrosis mutant mice. Nature
Genet 5, 135-142.
Anderson WF
(1992) Human gene therapy. Science 256: 808-813.
Antony AC (1992) The biological chemistry of
folate receptors. Blood 79,
2807-2820.
Antony AC,
Briddell RA, Brandt JE, Straneva JE, Verma RS, Miller ME, Kalasinski LA and
Hoffman R (1991) Megaloblastic
hematopoiesis in vitro. Interaction of anti-folate receptor antibodies with
hematopoietic progenitor cells leads to a proliferative response independent of
megaloblastic changes. J Clin Invest
87, 313-325.
Aoki K,
Yoshida T, Matsumoto N, Ide H, Hosokawa K, Sugimura T, Terada M (1997)
Gene therapy for peritoneal dissemination of pancreatic cancer by
liposome-mediated transfer of herpes simplex virus thymidine kinase gene. Hum Gene Ther 8, 1105-1113.
Aoki K,
Yoshida T, Sugimura T, Terada M(1995)
Liposome-mediated in vivo gene transfer of antisense K-ras construct inhibits
pancreatic tumor dissemination in the murine peritoneal cavity. Cancer Res 55, 3810-3816.
Aran JM,
Licht T, Gottesman MM, Pastan I (1996)
Complete restoration of glucocerebrosidase deficiency in Gaucher fibroblasts
using a bicistronic MDR retrovirus and a new selection strategy. Hum Gene Ther 7, 2165-2175.
Arcasoy SM,
Latoche JD, Gondor M, Pitt BR, Pilewski JM (1997) Polycations increase the efficiency of adenovirus-mediated
gene transfer to epithelial and endothelial cells in vitro. Gene Ther 4, 32-38.
Arend WP,
Dayer JM (1995) Inhibition of the
production and effects of interleukin-1 and tumor necrosis factor a in
rheumatoid arthritis. Arthritis Rheum
38, 151-160.
Arenzana-Seisdedos
F, Virelizier JL, Rousset D, Clark-Lewis I, Loetscher P, Moser B, Baggiolini M
(1996) HIV blocked by chemokine
antagonist. Nature 383, 400-400.
Armentano
D, Zabner J, Sacks C, Sookdeo CC, Smith MP, St George JA, Wadsworth SC, Smith
AE, Gregory RJ (1997) Effect of the
E4 region on the persistence of transgene expression from adenovirus vectors. J Virol 71, 2408-2416.
Arteaga CL
and Holt JT (1996) Tissue-targeted
antisense c-fos retroviral vector inhibits established breast cancer xenografts
in nude mice. Cancer Res 56,
1098-1103.
Arthur JF,
Butterfield LH, Roth MD, Bui LA, Kiertscher SM, Lau R, Dubinett S, Glaspy J,
McBride WH, Economou JS (1997) A
comparison of gene transfer methods in human dendritic cells. Cancer Gene Ther 4, 17-25.
Aruga E,
Aruga A, Arca MJ, Lee WM, Yang NS, Smith JW 2nd, Chang AE (1997) Immune responsiveness to a murine mammary carcinoma modified
to express B7-1, interleukin-12, or GM-CSF.
Cancer Gene Ther 4, 157-166.
Asahara T,
Chen D, Tsurumi Y, Kearney M, Rossow S, Passeri J, Symes JF, Isner JM (1996) Accelerated restitution of
endothelial integrity and endothelium-dependent function after phVEGF165 gene
transfer. Circulation 94, 3291-3302.
Austin EA
and Huber BH (1993) A first step in
the development of gene therapy for colorectal carcinoma: Cloning, sequencing,
and expression of Escherichia coli
cytosine deaminase. Mol Pharmacol
43, 380-387.
Baasner S,
von Melchner H, Klenner T, Hilgard P, Beckers T (1996) Reversible tumorigenesis in mice by conditional expression of
the HER2/c-erbB2 receptor tyrosine kinase.
Oncogene 13, 901-911.
Bacchetti S
and Graham FL (1993) Inhibition of
cell proliferation by an adenovirus vector expressing the human wild-type p53
protein. Int J Oncol 3,
781-788.Baltimore D (1988) Gene
therapy. Intracellular immunization. Nature
335, 395-396.
Bagchi, S.,
Raychaudhuri, P. and Nevins, J.R. (1990)
Adenovirus E1A proteins can dissociate heteromeric complexes involving the E2F
transcription factor: a novel mechanism for E1A trans-activation. Cell
62, 659-669.
Bagchi, S.,
Weinmann, R. and Raychaudhuri, P. (1991)
The retinoblastoma protein copurifies with E2F-I, and E1A-regulated
inhibitor of the transcription factor E2F.
Cell 65, 1063-1072.
Baker SJ,
Markowitz S, Fearon ER, Willson JKV, Vogelstein B (1990) Suppression of human colorectal carcinoma cell growth by
wild-type p53. Science 249, 912-915.
Baldwin HS,
Mickanin C, and Buck C (1997)
Adenovirus-mediated gene transfer during initial organogenesis in the mammalian
embryo is promoter-dependent and tissue-specific. Gene Ther 4, 1142-1149.
Balicki D
and Beutler E (1997) Histone H2A
significantly enhances in vitro DNA transfection. Mol Med 3, 782-787.
Ballay A,
Levrero M, Buendia MA, Tiollais P, Perricaudet M (1985) In vitro and in vivo synthesis of the hepatitis B virus
surface antigen and of the receptor for polymerized human serum albumin from
recombinant human adenoviruses. EMBO J
4, 3861-3865.
Bandara G,
Mueller GM, Galea-Lauri J, Tindal MH, Georgescu HI, Suchanek MK, Hung GL,
Glorioso JC, Robbins PD, Evans CH (1993)
Intraarticular expression of biologically active interleukin
1-receptor-antagonist protein by ex vivo gene transfer. Proc Natl Acad Sci USA 90, 10764-10768.
Banerjee S,
Livanos E, Vos JM (1995) Therapeutic
gene delivery in human B-lymphoblastoid cells by engineered non-transforming
infectious Epstein-Barr virus. Nat Med
1, 1303-1308.
Barak Y, Juven T, Haffner R, Oren M (1993) mdm2 expression is
induced by wild typep53 activity. EMBO J
12: 461-468.
Bargonetti
J, Friedman PN, Kern SE, Vogelstein B, Prives C (1991) Wild-type but not mutant p53 immunopurified proteins bind to
sequences adjacent to the SV40 origin of replication. Cell 65, 1083-1091.
Barr E,
Leiden JM (1991) Systemic delivery
of recombinant proteins by genetically modified myoblasts. Science 254, 1507-1509.
Barry MA,
Dower WJ, Johnston SA (1996) Toward
cell-targeting gene therapy vectors: Selection of cell-binding peptides from
random peptide-presenting phage libraries. Nature
Med 2, 299-305.
Barton NW,
Furbish FS, Murray GJ, Garfield M, Brady RO (1990) Therapeutic response to intravenous infusions of
glucocerebrosidase in a patient with Gaucher disease. Proc Natl Acad Sci USA 87, 1913-1916.
Baudard M,
Flotte TR, Aran JM, Thierry AR, Pastan I, Pang MG, Kearns WG, Gottesman MM (1996) Expression of the human multidrug
resistance and glucocerebrosidase cDNAs from adeno-associated vectors:
efficient promoter activity of AAV sequences and in vivo delivery via
liposomes. Hum Gene Ther 7,
1309-1322.
Bauer G,
Valdez P, Kearns K, Bahner I, Wen SF, Zaia JA, Kohn DB (1997) Inhibition of human immunodeficiency virus-1 (HIV-1)
replication after transduction of granulocyte colony-stimulating
factor-mobilized CD34+ cells from HIV-1-infected donors using
retroviral vectors containing anti-HIV-1 genes. Blood 89, 2259-2267.
Beal PA and
Dervan PB (1991) Second structural
motif for recognition of DNA by oligonucleotide-directed triple-helix
formation. Science 251, 1360-1363.
Beg AA, Sha
WC, Bronson RT, Ghosh S, and Baltimore D (1995)
Embryonic lethality and liver degeneration in mice lacking the RelA component
of NF-kB. Nature 376, 167-170.
Behr J-P (1994) Gene transfer with synthetic
cationic amphiphiles; prospects for gene therapy. Bioconjugate Chem 5, 382-389.
Behr J-P,
Demeneix B, Loeffler J-P, and Perez-Mutul J (1989) Efficient gene transfer into mammalian primary endocrine
cells with lipopolyamine-coated DNA. Proc
Natl Acad Sci USA 86, 6982-6986.
Benn SI,
Whitsitt JS, Broadley KN, Nanney LB, Perkins D, He L, Patel M, Morgan JR, Swain
WF, Davidson JM (1996)
Particle-mediated gene transfer with transforming growth factor-b1 cDNAs
enhances wound repair in rat skin. J
Clin Invest 98, 2894-2902.
Bennett MR,
Anglin S, McEwan JR, Jagoe R, Newby AC, Evan GI (1994) Inhibition of vascular smooth muscle cell proliferation in
vitro and in vivo by c-myc antisense oligodeoxynucleotides. J Clin Invest 93, 820-828.
Bergemann
J, Kuhlcke K, Fehse B, Ratz I, Ostertag W, Lother H (1995) Excision of specific DNA-sequences from integrated retroviral
vectors via site-specific recombination.
Nucleic Acids Res 23, 4451-4456.
Berns KI,
Linden RM (1995) The cryptic life style of adeno-associated virus. Bioessays 17, 237-245.
Beutler E (1997) Gaucher disease. Curr Opin Hematol 4, 19-23.
Bi W, Kim
YG, Feliciano ES, Pavelic L, Wilson KM, Pavelic ZP, Stambrook PJ (1997) An HSVtk-mediated local and
distant antitumor bystander effect in tumors of head and neck origin in athymic
mice. Cancer Gene Ther 4, 246-252.
Bianchi,
M.E., Beltrame, M. and Paonessa, G. (1989)
Specific recognition of cruciform DNA by nuclear protein HMG1. Science 243, 1056-1059.
Bicknell R
and Harris AL (1996) Mechanisms and
therapeutic implications of angiogenesis.
Curr Opin Oncol 8, 60-65.
Blaese RM,
Culver KW, Miller AD, Carter CS, Fleisher T, Clerici M, Shearer G, Chang L,
Chiang Y, Tolstoshev P, Greenblatt JJ, Rosenberg SA, Klein H, Berger M, Mullen
CA, Ramsey WJ, Muul L, Morgan RA, and Anderson WF (1995) T lymphocyte-directed gene therapy for ADA-SCID: Initial
trial results after 4 years. Science
270, 475-480.
Block A,
Chen SH, Kosai K, Finegold M, Woo SL (1997)
Adenoviral-mediated herpes simplex virus thymidine kinase gene transfer:
regression of hepatic metastasis of pancreatic tumors. Pancreas 15, 25-34.
Bloom BR (1996) A perspective on AIDS vaccines. Science 272, 1888-1890.
Blumenthal
R, Seth P, Willingham MC, Pastan I (1986)
pH-dependent lysis of liposomes by adenovirus. Biochemistry 25, 2231-2237.
Bode
J, Bartsch J, Boulikas T, Iber M, Mielke C, SchŸbeler D, Seibler J, and Benham
C (1998) Transcription-promoting genomic sites in mammalia: their
elucidation and architectural principles. Gene Ther Mol Biol 1, 551-580.
Bodnar,
J.W., Hanson, P.I., Polvino-Bodnar, M., Zempsky, W., and Ward, D.C. (1989) The terminal regions of
adenovirus and minute virus of mice DNAs are preferentially associated with the
nuclear matrix in infected cells. J
Virol. 63, 4344-4353.
Bohenzky
RA, LeFebvre RB, Berns KI (1988)
Sequence and symmetry requirements within the internal palindromic sequences of
the adeno-associated virus terminal repeat. Virology 166, 316-327.
Bohn MC and
Choi-Lundberg DL (1998) Neurotrophic factor gene therapy for neurodegenerative
diseases. Gene Ther Mol Biol 1, 265-277.
Boletta A,
Benigni A, Lutz J, Remuzzi G, Soria MR, Monaco L (1997) Nonviral gene delivery to the rat kidney with
polyethylenimine. Hum Gene Ther 8,
1243-1251.
Bongartz
J-P, Aubertin A-M, Milhaud PG, and Lebleu B (1994) Improved biological activity of antisense oligonucleotides
conjugated to a fusogenic peptide. Nucleic
Acids Res 22, 4681-4688.
Bookstein
R, Shew J-Y, Chen P-L, Scully P, and Lee W-H (1990) Suppression of tumorigenicity of human prostate carcinoma
cells by replacing a mutated RB gene.
Science 247, 712-715.
Border WA,
Noble NA (1995) Targeting TGF-b for
treatment of disease. Nature Med 1,
1000-1001.
Bordignon
C, Notarangelo LD, Nobili N, Ferrari G, Casorati G, Panina P, Mazzolari E,
Maggioni D, Rossi C, Servida P, Ugazio AG, and Mavilio F (1995) Gene therapy in peripheral blood lymphocytes and bone marrow
for ADA- immunodeficient patients. Science 270, 470-475.
Boris-Lawrie
KA and Temin HM (1993) Recent
advances in retrovirus vector technology. Curr
Opin Genet Dev 3, 102-109.
Bornstein
SR, Uhlmann K, Haidan A, Ehrhart-Bornstein M, Scherbaum WA (1997) Evidence for a novel peripheral
action of leptin as a metabolic signal to the adrenal gland: leptin inhibits
cortisol release directly. Diabetes
46, 1235-1238.
Borrelli E,
Heyman R, Hsi M, and Evans RM (1988)
Targeting of an inducible toxic phenotype in animal cells. Proc Natl Acad Sci USA 85, 7572-7576.
Boulikas T (1994)
A compilation and classification of DNA binding sites for protein transcription
factors from vertebrates. Crit. Rev.
Euk. Gene Expression 4, 117-321.
Boulikas T
(1995a) Phosphorylation of transcription factors and the control of the
cell cycle. Crit Rev Eukar. Gene
Expression 5, 1-77.
Boulikas T
(1995b) Chromatin domains and
prediction of MAR sequences. Int Rev
Cytol. 162A, 279-388.
Boulikas T
(1996a) Cancer gene therapy and
immunotherapy. Int J Oncol 9,
941-954.
Boulikas T
(1996b) Gene therapy to human
diseases: ex vivo and in vivo studies. Int
J Oncol 9, 1239-1251.
Boulikas T
(1996c) DNA lesion-recognizing
proteins and the p53 connection. Anticancer
Res 16, 225-242.
Boulikas T
(1996d) Liposome DNA delivery and
uptake by cells. Oncol Rep. 3,
989-995.
Boulikas T
(1996e) Common structural features
of replication origins in all life forms
J. Cell. Biochem. 60, 297-316.
Boulikas T
(1997) Gene therapy of prostate
cancer: p53, suicidal genes, and other targets. Anticancer Res 17, 1471-1506.
Boulikas T
(1998) Nucleocytoplasmic
trafficking: implications for the nuclear import of plasmid DNA during gene
therapy. Gene Ther Mol Biol 1,
713-740.
Boussif (1995) A versatile vector for gene and
oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci USA 92, 7297-7301.
Boussif O,
Zanta MA, Behr JP (1996) Optimized
galenics improve in vitro gene transfer with cationic molecules up to
1000-fold. Gene Ther 3, 1074-1080.
Bowles NE,
Eisensmith RC, Mohuiddin R, Pyron M, Woo SL (1996) A simple and efficient method for the concentration and
purification of recombinant retrovirus for increased hepatocyte transduction in
vivo. Hum Gene Ther 7, 1735-1742.
Brady HJM,
Miles CG, Pennington DJ, Dzierzak EA (1994)
Specific ablation of human immunodeficiency virus Tat-expressing cells by
conditionally toxic retroviruses. Proc
Natl Acad Sci USA 91, 365-369.
Braithwaite AW, Sturzbecher H-W, Addison C, Palmer C, Rudge
K, Jenkins JR (1987) Mouse p53
inhibits SV40 origin-dependent DNA replication. Nature 329, 458-460.
Bramson JL,
Hitt M, Addison CL, Muller WJ, Gauldie J, Graham FL (1996) Direct intratumoral injection of an adenovirus expressing
interleukin-12 induces regression and long-lasting immunity that is associated
with highly localized expression of interleukin-12. Hum Gene Ther 7, 1995-2002.
Brancolini
C, Benedetti M, Schneider C (1995) Microfilament reorganization during apoptosis: the role of Gas2, a
possible substrate for ICE-like proteases.
EMBO J 14, 5179-5190.
Brewster
SF, Simons JW (1994) Gene therapy in
urological oncology: Principles, strategies and potential. Eur Urol 25, 177-182.
Breyne P,
Van Montagu M, Depicker A, and Gheysen G. (1992)
Characterization of a plant scaffold attachment region in a DNA fragment that
normalizes transgene expression in tobacco. Plant Cell 4, 463-471.
Bridgen A
and Elliott RM (1996) Rescue of a
segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc Natl Acad Sci USA 93, 15400-15404.
Brooks EE,
Gray NS, Joly A, Kerwar SS, Lum R, Mackman RL, Norman TC, Rosete J, Rowe M,
Schow SR, Schultz PG, Wang X, Wick MM, Shiffman D (1997) CVT-313, a specific and potent inhibitor of CDK2 that
prevents neointimal proliferation. J
Biol Chem 272, 29207-29211.
Brooks, A.R., Nagy, B.P., Taylor, S., Simonet, W.S.,
Taylor, J.M., and Levy-Wilson, B. (1994) Sequences containing the second-intron enhancer are essential for
transcription of the human apolipoprotein B gene in the livers of transgenic
mice. Mol Cell Biol 14, 2243-2256.
Buchkovich,
K., Duffy, L.A. and Harlow, E. (1989) The retinoblastoma protein is
phosphorylated during specific phases of the cell cycle. Cell 58, 1097-1105.
Budker V,
Zhang G, Knechtle S, Wolff JA (1996)
Naked DNA delivered intraportally expresses efficiently in hepatocytes. Gene Ther 3, 593-598.
Bugge TH,
Flick MJ, Daugherty CC, Degen JL (1995)
Plasminogen deficiency causes severe thrombosis but is compatible with
development and reproduction. Genes Dev
9, 794-807.
Bullough
PA, Hughson FM, Skehel JJ, Wiley DC (1994)
Structure of influenza haemagglutinin at the pH of membrane fusion. Nature 371, 37-43.
Burfeind P,
Chernicky CL, Rininsland F, Ilan J, Ilan J (1996) Antisense RNA to the type I insulin-like growth factor
receptor suppresses tumor growth and prevents invasion by rat prostate cancer
cells In vivo. Proc Natl Acad Sci USA 93, 7263-7268.
Burns JC,
Friedmann T, Driever W, Burrascano M, Yee JK (1993) Vesicular stomatitis virus G glycoprotein pseudotyped
retroviral vectors: concentration to very high titer and efficient gene
transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci USA 90, 8033-8037.
Bushman FD
and Miller MD (1997) Tethering human
immunodeficiency virus type 1 preintegration complexes to target DNA promotes
integration at nearby sites. J Virol
71, 458-464.
Campfield
LA, Smith FJ, Guisez Y, Devos R, Burn P (1995)
Recombinant mouse OB protein: evidence for a peripheral signal linking
adiposity and central neural networks. Science
269, 546-549.
Canman CE,
Gilmer TM, Coutts SB, and Kastan MB (1995)
Growth factor modulation of p53-mediated growth arrest versus apoptosis. Genes Dev 9, 600-611.
Cannon PM,
Kim N, Kingsman SM, Kingsman AJ (1996)
Murine leukemia virus-based Tat-inducible long terminal repeat replacement
vectors: a new system for anti-human immunodeficiency virus gene therapy. J Virol 70, 8234-8240.
Canonico
AE, Conary JT, Meyrick BO, Brigham KL (1994)
Aerosol and intravenous transfection of human a1-antitrypsin
gene to lungs of rabbits. Am J Respir
Cell Mol Biol 10, 24-29.
Cao L,
Zheng Z-C, Zhao Y-C, Jiang Z-H, Liu Z-G, Chen S-D, Zhou C-F, and Liu X-Y (1995) Gene therapy of Parkinson disease
model rat by direct injection of plasmid DNA-lipofectin complex. Hum Gene Ther 6, 1497-1501.
Capaccioli
S, Di Pasquale G, Mini E, Mazzei T, Quattrone A (1993) Cationic lipids improve antisense oligonucleotide uptake and
prevent degradation in cultured cells and in human serum. Biochem Biophys Res Commun
197, 818-825.
Caputo A,
Rossi C, Bozzini R, Betti M, Grossi MP, Barbanti-Brodano G, Balboni PG (1997) Studies on the effect of the
combined expression of anti-tat and anti-rev genes on HIV-1 replication. Gene Ther 4, 288-295.
Carmeliet
P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, Fahrig M,
Vandenhoeck A, Harpal K, Eberhardt C, Declercq C, Pawling J, Moons L, Collen D,
Risau W, Nagy A (1996) Abnormal
blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435-439.
Carmeliet
P, Moons L, Dewerchin M, Mackman N, Luther T, Breier G, Ploplis V, Muller M,
Nagy A, Plow E, Gerard R, Edgington T, Risau W, Collen D (1997) Insights in vessel development and vascular disorders using
targeted inactivation and transfer of vascular endothelial growth factor, the
tissue factor receptor, and the plasminogen system. Ann N Y Acad Sci 811, 191-206.
Carreau M,
Quilliet X, Eveno E, Salvetti A, Danos O, Heard J-M, Mezzina M, and Sarasin A (1995) Functional retroviral vector for
gene therapy of xeroderma pigmentosum group D patients. Hum Gene Ther 6, 1307-1315.
Caruso M,
Pham-Nguyen K, Kwong YL, Xu B, Kosai KI, Finegold M, Woo SL, Chen SH (1996) Adenovirus-mediated
interleukin-12 gene therapy for metastatic colon carcinoma. Proc Natl Acad Sci USA 93, 11302-11306.
Casalini P,
Menard S, Malandrin SM, Rigo CM, Colnaghi MI, Cultraro CM, Segal S (1997) Inhibition of tumorigenicity in
lung adenocarcinoma cells by c-erbB-2 antisense expression. Int J Cancer 72, 631-636.
Casciola-Rosen
LA, Anhalt GJ, Rosen A (1995) DNA-dependent protein kinase is one of
a subset of autoantigens specifically cleaved early during apoptosis. J Exp Med 182, 1625-1634.
Cassileth
PA, Podack E, Sridhar K, Savaraj N, and Hanlon J (1995) Phase I study of transfected cancer cells expressind the
interleukin-2 gene product in limited stage small cell lung cancer. Hum Gene Ther 6, 369-383.
Cavanaugh AH, Hempel WM, Taylor LJ, Rogalsky V, Todorov G,
Rothblum LI (1995) Activity of RNA
polymerase I transcription factor UBF blocked by Rb gene product. Nature 374, 177-180.
Cesano A,
Visonneau S Jeglum KA, Owen J, Wilkinson K, Carner K, Reese L, Santoli D (1996) Phase I clinical trial with a
major histocompatibility complex nonrestricted cytotoxic T-cell line (TALL-104)
in dogs with advanced tumors. Cancer Res
56, 3021-3029.
Chadwick
SL, Kingston HD, Stern M, Cook RM, O'Connor BJ, Lukasson M, Balfour RP,
Rosenberg M, Cheng SH, Smith AE, Meeker DP, Geddes DM, Alton EW (1997) Safety of a single aerosol
administration of escalating doses of the cationic lipid
GL-67/DOPE/DMPE-PEG5000 formulation to the lungs of normal volunteers. Gene Ther 4, 937-942.
Chambers R,
Gillespie GY, Soroceanu L, Andreansky S, Chatterjee S, Chou J, Roizman B,
Whitley RJ (1995) Comparison of
genetically engineered herpes simplex viruses for the treatment of brain tumors
in a scid mouse model of human
malignant glioma. Proc Natl Acad Sci USA
92, 1411-1415.
Chan L,
Teng BB, Lau P (1996) Apolipoprotein
B mRNA editing protein: a tool for dissecting lipoprotein metabolism and a
potential therapeutic gene for hypercholesterolemia. Z Gastroenterol 34 Suppl
3, 31-32.
Chan YJ,
Chiou CJ, Huang Q, Hayward GS (1996)
Synergistic interactions between overlapping binding sites for the serum
response factor and ELK-1 proteins mediate both basal enhancement and phorbol
ester responsiveness of primate cytomegalovirus major immediate-early promoters
in monocyte and T-lymphocyte cell types.
J Virol 70, 8590-8605.
Chang AE,
Sondak VK, Bishop DK, Nickoloff BJ, Mulligan RC, and Mule JJ (1996). Clinical protocol. Adoptive
immunotherapy of cancer with activated lymph node cells primed in vivo with
autologous tumor cells transduced with the GM-CSF gene. Hum Gene Ther 7, 773-792.
Chang EH, Jang YJ, Hao Z, Murphy G, Rait A, Fee WE Jr,
Sussman HH, Ryan P, Chiang Y, Pirollo KF (1997)
Restoration of the G1 checkpoint and the apoptotic pathway mediated by
wild-type p53 sensitizes squamous cell carcinoma of the head and neck to
radiotherapy. Head Neck Surg 123,
507-512.
Chang JY,
Xia W, Shao R, Hung MC (1996)
Inhibition of intratracheal lung cancer development by systemic delivery of
E1A. Oncogene 13, 1405-1412.
Chang MW,
Barr E, Lu MM, Barton K, Leiden JM (1995b)
Adenovirus-mediated over-expression of the cyclin/cyclin-dependent kinase
inhibitor, p21 inhibits vascular smooth muscle cell proliferation and neointima
formation in the rat carotid artery model of balloon angioplasty. J Clin Invest 96, 2260-2268.
Chang MW,
Barr E, Seltzer J, Jiang Y-Q, Nabel GJ, Nabel EG, Parmacek MS, and Leiden JM (1995a) Cytostatic gene therapy for
vascular proliferative disorders with a constitutively active form of the
retinoblastoma gene product. Science
267, 518-522.
Chang MW,
Barr E, Seltzer J, Jiang Y-Q, Nabel GJ, Nabel EG, Parmacek MS, and Leiden JM (1995) Cytostatic gene therapy for
vascular proliferative disorders with a constitutively active form of the
retinoblastoma gene product. Science
267, 518-522.
Chang YN,
Jeang KT, Chiou CJ, Chan YJ, Pizzorno M, Hayward GS (1993) Identification of a large bent DNA domain and binding sites
for serum response factor adjacent to the NFI repeat cluster and enhancer
region in the major IE94 promoter from simian cytomegalovirus. J Virol 67, 516-529.
Chao J, Jin
L, Chen L-M, Chen VC, and Chao L (1996)
Systemic and portal vein delivery of human kallikrein gene reduces blood
pressure in hypersensitive rats. Hum
Gene Ther 7, 901-911.
Chatterjee PK and Flint SJ (1986) Partition of E1A proteins between soluble and structural
fractions of adenovirus-infected and -transformed cells. J. Virol. 60, 1018-1026.
Chatterjee
S Johnson PR, and Wong KK (1992)
Dual tasrget inhibition of HIV-1 in vitro by means of an adeno-associated virus
antisense vector. Science 258,
1485-1488.
Chellappan
S, Hiebert S, Mudryj M, Horowitz J, Nevins J (1991) The E2F transcription factor is a cellular target for the RB
protein. Cell 65, 1053-1061.
Chen BP,
Fraser C, Reading C, Murray L, Uchida N, Galy A, Sasaki D, Tricot G, Jagannath
S, Barlogie B, et al (1995)
Cytokine-mobilized peripheral blood CD34+Thy-1+Lin-
human hematopoietic stem cells as target cells for transplantation-based gene
therapy. Leukemia 9 Suppl 1:S17-S25.
Chen C,
Parangi S, Tolentino MJ, Folkman J (1995)
A strategy to discover circulating angiogenesis inhibitors generated by human
tumors. Cancer Res 55, 4230-4233.
Chen C-Y, Oliner JD, Zhan Q, Fornace Jr AJ, Vogelstein B,
Kastan MB (1994) Interactons between
p53 and MDM2 in a mammalian cell cycle checkpoint pathway. Proc Natl Acad Sci USA 91, 2684-3688.
Chen DS,
Zhu NL, Hung G, Skotzko MJ, Hinton DR, Tolo V, Hall FL, Anderson WF, Gordon EM
(1997) Retroviral vector-mediated
transfer of an antisense cyclin G1 construct inhibits osteosarcoma tumor growth
in nude mice. Hum Gene Ther 8,
1667-1674.
Chen G,
Koyama K, Yuan X, Lee Y, Zhou YT, O'Doherty R, Newgard CB, Unger RH (1996) Disappearance of body fat in
normal rats induced by adenovirus-mediated leptin gene therapy. Proc Natl Acad Sci USA 93, 14795-14799.
Chen J,
Stickles RJ, Daichendt KA (1994)
Galactosylated histone-mediated gene transfer and expression. Hum Gene Ther 5, 429-435.
Chen LM,
Chao L, Chao J (1997)
Adenovirus-mediated delivery of human kallistatin gene reduces blood pressure
of spontaneously hypertensive rats. Hum
Gene Ther 8, 341-347.
Chen PL,
Chen Y, Shan B, Bookstein R, Lee WH (1992)
Stability of retinoblastoma gene expression determines the tumorigenicity of
reconstituted retinoblastoma cells. Cell
Growth Differ 3, 119-125
Chen SH,
Kosai K, Xu B, Pham-Nguyen K, Contant C, Finegold MJ, Woo SL (1996) Combination suicide and cytokine gene therapy for hepatic
metastases of colon carcinoma: sustained antitumor immunity prolongs animal
survival. Cancer Res 56, 3758-3762.
Chen SJ,
Wilson JM, Vallance DK, Hartman JW, Davidson BL, Roessler BJ (1995) A recombinant adenoviral vector
expressing a soluble form of VCAM-1 inhibits VCAM-1/VLA-4 adhesion in
transduced synoviocytes. Gene Ther
2, 469-480.
Chen ST,
Iida A, Guo L, Friedmann T, Yee JK (1996)
Generation of packaging cell lines for pseudotyped retroviral vectors of the G
protein of vesicular stomatitis virus by using a modified tetracycline
inducible system. Proc Natl Acad Sci USA
93, 10057-10062.
Chen X, Farmer G, Zhu H, Prywes R, Prives C (1993) Cooperative DNA binding of p53
with TFIID (TBP): A possible mechanism for transcriptional activation. Genes Dev 7, 1837-1849.
Chen Y,
Chen C-F, Riley DJ, Allred DC, Chen P-L, Von Hoff D, Osborne CK, and Lee W-H (1995) Aberrant subcellular localization
of BRCA1 in breast cancer. Science
270, 789-791.
Chen YM,
Chen PL, Arnaiz N, Goodrich D, Lee WH (1991)
Expression of wild-type p53 in human A673 cells suppresses tumorigenicity but
not growth rate. Oncogene 6,
1799-1805.
Chen P-L ,
Scully, P., Shew, J.-Y., Wang, J.Y.J. and Lee, W.-H. (1989) Phosphorylation
of the retinoblastoma gene product is modulated during the cell cycle and
cellular differentiation. Cell
58, 1193-1198.
Chernajovsky
Y, Adams G, Triantaphyllopoulos K, Ledda MF, Podhajcer OL (1997) Pathogenic lymphoid cells engineered to express TGF b 1
ameliorate disease in a collagen-induced arthritis model. Gene Ther 4, 553-559
Chi SG, de
Vere White RW, Meyers FJ,. Siders DB, Lee F, and Gumerlock PH (1994) p53 in prostate cancer: frequent
expressed transition mutations. J Natl
Cancer Inst 86, 926-933.
Chin K-V, Ueda K, Pastan I, Gottesman MM (1992) Modulation of activity of the
promoter of the human MDR1 gene by
Ras and p53. Science 255, 459-462.
Chintala SK, Fueyo J, Gomez-Manzano C, Venkaiah B, Bjerkvig
R, Yung WK, Sawaya R, Kyritsis AP, Rao JS (1997)
Adenovirus-mediated p16/CDKN2 gene transfer suppresses glioma invasion in
vitro. Oncogene 15, 2049-2057.
Chiou S, Rao L, and White E (1994) Bcl-2 blocks p53-dependent apoptosis. Mol Cell Biol 14, 1556-1563.
Choate KA
and Khavari PA (1997) Direct
cutaneous gene delivery in a human genetic skin disease. Hum Gene Ther 8, 1659-1665.
Chowdhury
JR, Grossman M, Gupta SJ, Chowdhury NR, Baker Jr JR, Wilson JM (1991) Long term improvement of
hypercholesterolemia after ex vivo gene therapy in LDLR-deficient rabbits. Science 254, 1802-1805.
Christofori
G, Naik P, and Hanahan D (1995)
Vascular endothelial growth factor and its receptors, flt-1 and flk-1, are
expressed in normal pancreatic islets and throughout islet cell tumorigenesis. Mol Endocrinol 9, 1760-1770.
Chuah MKL,
Vandendriessche T, and Morgan RA (1995)
Development and analysis of retroviral vectors expressing human factor VIII as
a potential gene therapy for hemophilia A. Hum
Gene Ther 6, 1363-1377.
Cichy J,
Potempa J, Travis J (1997)
Biosynthesis of a1-proteinase inhibitor by
human lung-derived epithelial cells. J
Biol Chem 272, 8250-8255.
Clark KR,
Voulgaropoulou F, Fraley DM, and Johnson PR (1995) Cell lines for the production of recombinant adeno-associated
virus. Hum Gene Ther 6, 1329-1341.
Clark KR,
Voulgaropoulou F, Johnson PR (1996)
A stable cell line carrying adenovirus-inducible rep and cap genes allows for
infectivity titration of adeno-associated virus vectors. Gene Ther 3, 1124-1132.
Clark SJ,
Harrison J, Molloy PL (1997) Sp1
binding is inhibited by mCpmCpG methylation. Gene 195, 67-71.
Clarke MF,
Apel IJ, Benedict MA, Eipers PG, Sumantran V, Gonzalez-Garcia M, Doedens M,
Fukunaga N, Davidson B, Dick JE, et al (1995)
A recombinant bcl-xs adenovirus selectively induces apoptosis in cancer cells
but not in normal bone marrow cells.
Proc Natl Acad Sci USA 92, 11024-11028.
Clary BM,
Coveney EC, Philip R, Blazer DG 3rd, Morse M, Gilboa E, Lyerly HK (1997) Inhibition of established
pancreatic cancers following specific active immunotherapy with interleukin-2
gene-transduced tumor cells. Cancer Gene
Ther 4, 97-104.
Cleat PH
and Hay RT (1989) Co-operative
interactions between NFI and the adenovirus DNA binding protein at the
adenovirus origin of replication. EMBO J.
8, 1841-1848.
Coenjaerts
FEJ, De Vries E, Pruijn GJM, van Driel W. Bloemers SM, van der Lugt MT, and van
der Vliet PC (1991) Enhancement of
DNA replication by transcription factors NFI and NFIII/Oct-1 depends critically
on the positions of their binding sites in the adenovirus origin of
replication. Biochim. Biophys. Acta
1090, 61-69.
Colak A,
Goodman JC, Chen S-H, Woo SLC, Grossman RG, Shine HD (1995) Adenovirus-mediated gene therapy in an experimental model of
breast cancer metastatic to the brain. Hum
Gene Ther 6, 1317-1322.
Coll JL,
Wagner E, Combaret V, Metchler K, Amstutz H, Iacono-Di-Cacito I, Simon N,
Favrot MC (1997) In vitro targeting
and specific transfection of human neuroblastoma cells by chCE7
antibody-mediated gene transfer. Gene
Ther 4, 156-161.
Conary JT,
Parker RE, Christman BW, Raulks RD, King GA, Meyrick BO, Brigham KL (1994) Protection of rabbit lungs from
endotoxin injury by in vivo hyperexpression of the prostaglandin G/H synthase
gene. J Clin Invest 93, 1834-1840.
Connelly S
and Kaleko M (1998) Hemophilia A:
current treatment and future gene therapy. Gene
Ther Mol Biol 1, 279-292.
Conrad CK,
Allen SS, Afione SA, Reynolds TC, Beck SE, Fee-Maki M, Barrazza-Ortiz X, Adams
R, Askin FB, Carter BJ, Guggino WB, Flotte TR (1996) Safety of single-dose administration of an adeno-associated
virus (AAV)-CFTR vector in the primate lung. Gene Ther 3, 658-668.
Considine
RV, Considine EL, Williams CJ, Nyce MR, Magosin SA, Bauer TL, Rosato EL,
Colberg J, Caro JF (1995) Evidence
against either a premature stop codon or the absence of obese gene mRNA in
human obesity. J Clin Invest 95,
2986-2988.
Cooney M,
Czernuszewicz G, Postel EH, Flint SJ, Hogan ME (1988) Site-specific oligonucleotide binding represses transcription
of the human c-myc gene in vitro. Science
241, 456-459.
Corbeau P,
Kraus G, and Wong-Staal F (1996)
Efficient gene transfer by a human immunodeficiency virus type 1
(HIV-1)-derived vector utilizing a stable HIV packaging cell line. Proc Natl Acad Sci USA 93, 14070-14075.
Corey CA,
Desilva AD, Holland CA, and Williams DA (1990)
Serial transplantation of MTX resistant bone marrow; protection of murine recipients
from drug toxicity by progeny of transduced stem cells. Blood 76, 337-343.
Cornetta K
and Anderson WF (1989) Protamine
sulfate as an effective alternative to polybrene in retroviral-mediated
gene-transfer: implications for human gene therapy. J Virol Methods 23, 187-194.
Cotten M,
Wagner E, Zatloukal K, Phillips S, Curiel DT, and Birnstiel ML (1992) High efficiency receptor-mediated
delivery of small and large (48 kilobase) gene constructs using the endosome
disruption activity of defective or chemically inactivated adenovirus
particles. Proc Natl Acad Sci USA
89, 6094-6098.
Cox LS, Hupp T, Midgley CA, Lane DP (1995) A direct effect of activated human p53 on nuclear DNA
replication. EMBO J 14, 2099-2105.
Crook K,
McLachlan G, Stevenson BJ, Porteous DJ (1997)
Plasmid DNA molecules complexed with cationic liposomes are protected from
degradation by nucleases and shearing by aerosolisation. Gene Ther 3, 834-839.
Cross GAM (1987) Eukaryotic protein modification
and membrane attachment via phosphatidylinositol. Cell 48, 179-181.
Crystal RG
(1990) a1-antitrypsin
deficiency, emphysema, and liver disease. J
Clin Invest 85, 1343-1352.
Cuevas P,
Garcia-Calvo M, Carceller F, Reimers D, Zazo M, Cuevas B, Munoz-Willery I,
Martinez-Coso V, Lamas S, Gimenez-Gallego G (1996) Correction of hypertension by normalization of endothelial
levels of fibroblast growth factor and nitric oxide synthase in spontaneously
hypertensive rats. Proc Natl Acad Sci
USA 93, 11996-12001.
Culver KW (1996) in ÒGene Therapy: a primer for physiciansÓ. Second Edition. Mary Ann
Liebert, Inc. Publications NY. pp. 1-198.
Culver KW,
Ram Z, Wallbridge S, Ishii H, Oldfield EH, and Blaese RM (1992) In vivo gene transfer with retroviral vector-producer cells
for treatment of experimental brain tumors. Science 256, 1550-1552.
Curiel DT (1994) High-efficiency gene transfer
employing adenovirus-polylysine-DNA complexes. Nat Immun 13, 141-164.
Curiel DT,
Agarwal S, Wagner E, and Cotten M (1991)
Adenovirus enhancement of transferrrin-polylysine-mediated gene delivery. Proc Natl Acad Sci USA 88, 8850-8854.
Cwirla SE,
Peters EA, Barrett RW, and Dower WJ (1990)
Peptides on phage: a vast library of peptides for identifying ligands. Proc Natl Acad Sci USA 87, 6378-6382.
Czubayko F,
Downing SG, Hsieh SS, Goldstein DJ, Lu PY, Trapnell BC, and Wellstein A (1997) Adenovirus-mediated transduction
of ribozymes abrogates HER-2/neu and
pleiotrophin expression and inhibits tumor cell proliferaation. Gene Ther 4, 934-949.
DÕSouza MP
and Harden VA (1996) Chemokines and
HIV-1 second receptors. Confluence of two fields generates optimism in aids
research. Nat Med 2, 1293-1300.
da Costa LT, Jen J, He T-C, Chan TA, Kinzler KW, and
Vogelstein B (1996) Converting
cancer genes into killer genes. Proc
Natl Acad Sci USA 93, 4192-4196.
Dai Y,
Roman M, Naviaux RK, and Verma IM (1992)
Gene therapy via primary myoblasts: Long term expression of factor IX protein
following transplantation in vivo. Proc
Natl Acad Sci USA 89, 10892-10895.
Dai Y,
Schwarz EM, Gu D, Zhang W-W, Sarvetnick N, and Verma IM (1995) Cellular and humoral immune responses to adenoviral vectors
containing factor IX gene: Tolerization of factor IX and vector antigens allows
for long-term expression. Proc Natl Acad
Sci USA 92, 1401-1405.
Dameron KM, Volpert OV, Tainsky MA, Bouck N (1994) Control of angiogenesis in
fibroblasts by p53 regulation of thrombospondin-1. Science 265, 1582-1584.
Das Gupta
TK, Cohen EP, Richards JM (1997)
Phase I evaluation of interleukin-2-transfected irradiated allogeneic melanoma
for the treatment of metastatic melanoma: appendix 1: protocol. Hum Gene Ther 8, 1701-1714.
Davies JC,
Stern M, Dewar A, Caplen NJ, Munkonge FM, Pitt T, Sorgi F, Huang L, Bush A,
Geddes DM, Alton EW (1997) CFTR gene
transfer reduces the binding of Pseudomonas aeruginosa to cystic fibrosis
respiratory epithelium. Am J Respir Cell
Mol Biol 16, 657-663.
Davis S,
Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, Ryan TE, Bruno J,
RadziejewskiC, Maisonpierre PC, and Yancopoulos GD (1996) Isolation of angiopoietin-1, a ligand for the TIE2 receptor,
by secretion-trap expression cloning. Cell
87, 1161-1169.
Day ML, Wu
S, Basler JW (1993) Prostatic nerve
growth factor inducible A gene binds a novel element in the retinoblastoma gene
promoter. Cancer Res 53, 5597-5599.
de los
Santos C, Rosen M, Patel D (1989)
NMR studies of DNA (R+)n.(Y-)n.(Y+)n
triple helices in solution: imino and amino proton markers of T.A.T and C.G.C+
base-triple formation. Biochemistry
28, 7282-7289.
de Vries C,
Escobedo JA, Ueno H, Houck K, Ferrara N, and Williams LT (1992) The fms-like
tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255, 989-991.
Deb S, Jackson CT, Subler MA, and Martin DW (1992) Modulation of cellular and viral
promoters by mutant human p53 proteins found in tumor cells. J Virol 66, 6164-6170.
Deb SP, Mu–oz RM, Brown DR, Subler MA, and Deb S (1994) Wild-type human p53 activates the
human epidermal growth factor receptor promoter. Oncogene 9, 1341-1349.
Debbas, M.
and White, E. (1993) Wild-type p53 mediates apoptosis by E1A, which is
inhibited by E1B. Genes Dev. 7,
546-554.
DeCaprio,
J.A. , Ludlow, J.W., Lynch, D., Furukawa, Y., Griffin, J., Piwnica-Worms, H.,
Huang, C.-M. and Livingston, D.M. (1989) The product of the retinoblastoma
susceptibility gene has properties of a cell cycle regulatory element. Cell 58,
1085-1095.
Deglon N,
Heyd B, Tan SA, Joseph JM, Zurn AD, Aebischer P (1996) Central nervous system delivery of recombinant ciliary
neurotrophic factor by polymer encapsulated differentiated C2C12 myoblasts. Hum Gene Ther 7, 2135-2146.
Delort JP
and Capecchi MR (1996) TAXI/UAS: a
molecular switch to control expression of genes in vivo. Human Gene Ther 7, 809-820.
DeLuca NA,
and Schaffer PA (1987) Activities of
herpes simplex virus type 1 (HSV-1) ICP4 genes specifying nonsense peptides. Nucleic Acids Res 15, 4491-4511.
Dematteo
RP, McClane SJ, Fisher K, Yeh H, Chu G, Burke C, Raper SE (1997) Engineering tissue-specific expression of a recombinant
adenovirus: selective transgene transcription in the pancreas using the amylase
promoter. J Surg Res 72, 155-161.
Deppert W (1994) The yin and yang of p53 in
cellular proliferation. Sem Cancer Biol 5,
187-202.
Devlin JJ,
Panganiban LC, Devlin PE (1990)
Random peptide libraries: A source of specific binding protein molecules. Science 249, 404-406.
Dhawan J,
Pan LC, Pavlath GK, Travis MA, Lanctot AM, Blau HM (1991) Systemic delivery of human growth hormone by injection of
genetically engineered myoblasts.
Science 254, 1509-1512.
Diller L, Kassel J, Nelson CE, Gryka MA, Litwak G, Gebhardt
M, Bressac B, Ozturk M, Baker SJ, Vogelstein B, Friend SH (1990) p53 functions as a cell cycle control protein in
osteosarcomas. Mol Cell Biol 10,
5772-5781.
Diller L,
Kassel J, Nelson CE, Gryka MA, Litwak G, Gebhardt M, Bressac B, Ozturk M, Baker
SJ, Vogelstein B, Friend SH (1990)
p53 functions as a cell cycle control protein in osteosarcomas. Mol Cell Biol 10, 5772-5781.
Dimaio JM,
Clary BM, Via DF, Coveney E, Papas TN, and Lyerly HK (1994) Directed enzyme pro-drug gene therapy for pancreatic cancer
in vivo. Surgery 116, 205-213.
Dinjens WN,
van der Weiden MM, Schroeder FH, Bosman FT, and Trapman J (1994) Frequency and characterization of p53 mutations in primary
and metastatic human prostate cancer. Int
J Cancer 56, 630-633.
Dion LD,
Goldsmith KT, Strong TV, Bilbao G, Curiel DT, Garver RI Jr (1996) E1A RNA transcripts amplify
adenovirus-mediated tumor reduction. Gene
Ther 3, 1021-1025.
Dittmer D,
Pati S, Zambetti G, Chu S, Teresky AK, Moore M, Finlay C, Levine AJ: Gain of
function mutations in p53. Nature Genet 4: 42-45, 1993.
Doll RF,
Crandall JE, Dyer CA, Aucoin JM, Smith FI (1996) Comparison of promoter
strengths on gene delivery into mammalian brain cells using AAV vectors. Gene
Ther 3, 437-447.
Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery
CAJr, Butel JS, Bradley A (1992)
Mice deficient for p53 are developmentally normal but susceptible to
spontaneous tumours. Nature 356,
215-221.
Dong JY,
Fan PD, Frizzell RA (1996)
Quantitative analysis of the packaging capacity of recombinant adeno-associated
virus. Hum Gene Ther 7, 2101-2112.
Dong Z,
Kumar R, Yang X, Fidler IJ (1997)
Macrophage-derived metalloelastase is responsible for the generation of
angiostatin in Lewis lung carcinoma.
Cell 88, 801-810.
Doorbar J,
Winter G (1994) Isolation of a
peptide antagonist to the thrombin receptor using phage display. J Mol Biol 244, 361-369.
Dorai T,
Olsson CA, Katz AE, Buttyan R (1997)
Development of a hammerhead ribozyme against bcl-2. I. Preliminary evaluation
of a potential gene therapeutic agent for hormone-refractory human prostate
cancer. Prostate 32, 246-258.
Dougherty
JP, Wisniewski R, Yang SL, Rhode BW, Temin HM (1989) New retrovirus helper cells with almost no nucleotide
sequence homology to retrovirus vectors. J
Virol 63, 3209-3212.
Dranoff G,
Jaffee E, Lazenby A, Golumbek P, Levitsky H, Brose K, Jackson V, Hamada H,
Pardoll D, Mulligan R (1993)
Vaccination with irradiated tumor cells engineered to secrete murine
granulocyte-macrophage colony-stimulating factor stimulates potent, specific,
and long-lasting anti-tumor immunity. Proc
Natl Acad Sci USA 90, 3539-3543.
Drazan KE, Shen XD, Csete ME, Zhang WW, Roth JA, Busuttil
RW, Shaked A (1994) In vivo
adenoviral-mediated human p53 tumor suppressor gene transfer and expression in
rat liver after resection. Surgery
116, 197-203.
Duan L, Zhu
M, Bagasra O, Pomerantz RJ (1995)
Intracellular immunization against HIV-1 infection of human T lymphocytes:
Utility of anti-rev single-chain variable fragments. Hum Gene Ther 6, 1561-1573.
Duan L, Zhu
M, Ozaki I, Zhang H, Wei DL, Pomerantz RJ (1997)
Intracellular inhibition of HIV-1 replication using a dual protein- and
RNA-based strategy. Gene Ther 4,
533-543.
Duke RC,
Ojcius DM, and Young JD-E (1996)
Cell suicide in health and disease. Scientifc
Amer 275, 80-87.
Dumont DJ,
Gradwohl G, Fong GH, Puri MC, Gertsenstein M, Auerbach A, Breitman ML (1994) Dominant-negative and targeted
null mutations in the endothelial receptor tyrosine kinase, tek, reveal a
critical role in vasculogenesis of the embryo. Genes Dev 8, 1897-1909.
Dunbar C
and Kohn D (1996) Retroviral
mediated transfer of the cDNA for human glucocerebrosidase into hematopoietic
stem cells of patients with Gaucher disease. A phase I study. Hum Gene Ther 7, 231-253.
Dunlap DD,
Maggi A, Soria MR, Monaco L (1997)
Nanoscopic structure of DNA condensed for gene delivery. Nucleic Acids Res 25, 3095-3101.
Dupuit F,
Chinet T, Zahm JM, Pierrot D, Hinnrasky J, Kaplan H, Bonnet N, Puchelle E (1997) Induction of a cAMP-stimulated
chloride secretion in regenerating poorly differentiated airway epithelial
cells by adenovirus-mediated CFTR gene transfer. Hum Gene Ther 8, 1439-1450.
During MJ,
Naegele JR, O'Malley KL, Geller AI (1994)
Long-term behavioral recovery in Parkinsonian rats by an HSV Vector expressing
tyrosine hydroxylase. Science 266,
1399-1403.
Dutta A,
Ruppert JM, Aster JC and Winchester E (1993)
Inhibition of DNA replication factor RPA by p53. Nature 365: 79-82.
Dwarki VJ,
Belloni P, Nijjar T, Smith J, Couto L, Rabier M, Clift S, Berns A, and Cohen LK
(1995) Gene therapy for hemophilia
A: Production of therapeutic levels of human factor VIII in vivo in mice. Proc Natl
Acad Sci USA 92, 1023-1027.
Dyson, N., Howley, P.M., MŸnger, K. and Harlow, E. (1989) The human papilloma virus-16 E7 oncoprotein is able to bind to the
retinoblastoma gene product. Science
243, 934-937.
Ealovega
MW, McGinnis PK, Sumantran VN, Clarke MF, Wicha MS (1996) bcl-xs gene therapy induces apoptosis of human mammary tumors
in nude mice. Cancer Res 56,
1965-1969.
Eastham JA,
Chen S-H, Sehgal I, Yang G, Timme TL, Hall SJ, Woo SLC, and Thompson TC (1996) Prostate cancer gene therapy:
herpes simplex virus thymidine kinase gene transduction followed by ganciclovir
in mouse and human prostate cancer models. Hum
Gene Ther 7, 515-523.
Eastham JA, Hall SJ, Sehgal I, Wang J, Timme TL, Yang G,
Connell-Crowley L, Elledge SJ, Zhang W-W, Harper JW, and Thompson TC (1995) In vivo gene therapy with p53 or
p21 adenovirus for prostate cancer. Cancer Res 55, 5151-5155.
Ebbinghaus
SW, Vigneswaran N, Miller CR, Chee-Awai RA, Mayfield CA, Curiel DT, Miller DM (1996) Efficient delivery of triplex
forming oligonucleotides to tumor cells by adenovirus-polylysine complexes. Gene Ther 3, 287-297.
Eckert HG,
Stockschlader M, Just U, Hegewisch-Becker S, Grez M, Uhde A, Zander A, Ostertag
W, Baum C (1996) High-dose multidrug
resistance in primary human hematopoietic progenitor cells transduced with
optimized retroviral vectors. Blood
88, 3407-3415.
Einerhand
MP, Antoniou M, Zolotukhin S, Muzyczka N, Berns KI, Grosveld F, Valerio D (1995) Regulated high-level human b-globin
gene expression in erythroid cells following recombinant adeno-associated
virus-mediated gene transfer. Gene Ther
2, 336-343.
El Ouahabi
A, Thiry M, Pector V, Fuks R, Ruysschaert JM, Vandenbranden M (1997) The role
of endosome destabilizing activity in the gene transfer process mediated by
cationic lipids. FEBS Lett 414,
187-192.
El-Deiry
WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B (1992) Definition of a consensus binding site for p53. Nature Genet 1, 45-49.
El-Deiry
WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE,
Kinzler KW, Vogelstein B (1993) WAF1, a potential mediator of p53 tumor
suppression. Cell 75, 817-825.
Eliyahu D,
Michalovitz D, Eliyahu S, Pinhasi-Kimhi O, Oren M (1989) Wild-type p53 can inhibit oncogene-mediated focus formation. Proc Natl Acad Sci USA 86, 8763-8767.
Elshami AA,
Cook JW, Amin KM, Choi H, Park JY, Coonrod L, Sun J, Molnar-Kimber K, Wilson
JM, Kaiser LR, Albelda SM (1997) The
effect of promoter strength in adenoviral vectors containing herpes simplex
virus thymidine kinase on cancer gene therapy in vitro and in vivo. Cancer Gene Ther 4, 213-221.
Emoto Y,
Manome Y, Meinhardt G, Kisaki H, Kharbanda S, Robertson M, Ghayur T, Wong WW,
Kamen R, Weichselbaum R, et al (1995)
Proteolytic activation of protein kinase C d by an
ICE-like protease in apoptotic cells.
EMBO J 14, 6148-6156.
Endicott JA
and Ling V (1989) The biochemistry
of P-glycoprotein-mediated multidrug resistance. Annu Rev Biochem 58, 137-171.
Enomaa N,
Danos O, Peltonen L, and Jalanko A (1995)
Correction of deficient enzyme activity in a lysosomal storage disease,
aspartylglucosaminuria, by enzyme replacement and retroviral gene transfer. Hum Gene Ther 6, 723-731.
Evans CH
and Robbins PD (1996) Pathways to
gene therapy in rheumatoid arthritis. Curr
Opin Rheumatol 8, 230-234.
Evans CH,
Robbins PD, Ghivizzani SC, Herndon JH, Kang R, Bahnson AB, Barranger JA, Elders
EM, Gay S, Tomaino MM, Wasko MC, Watkins SC, Whiteside TL, Glorioso JC, Lotze
MT, Wright TM (1996) Clinical trial
to assess the safety, feasibility, and efficacy of transferring a potentially
anti-arthritic cytokine gene to human joints with rheumatoid arthritis. Hum Gene Ther 7, 1261-1280.
Fang B,
Eisensmith RC, Wang H, Kay MA, Cross RE, Landen CN, Gordon G, Bellinger DA,
Read MS, Hu PC, Brinkhous KM, and Woo SLC (1995)
Gene therapy for hemophilia B: Host immunosuppression prolongs the therapeutic
effect of adenovirus-mediated factor IX expression. Hum Gene Ther 6, 1039-1044.
Fardel O,
Escande F, Drenou B, Le Bescot J, Rault B, and Fauchet R (1995) Expression of P-glycoprotein in multidrug-resistant human
leukemia K562 cells during erythroid differentiation. Int J Oncol 7, 377-381.
Farmer G, Bargonetti J, Zhu H, Friedman P, Prywes R, Prives
C (1992) Wild-type p53 activates
transcription in vitro. Nature 358, 83-86.
Fasbender
A, Zabner J, Chillon M, Moninger TO, Puga AP, Davidson BL, Welsh MJ (1997) Complexes of adenovirus with
polycationic polymers and cationic lipids increase the efficiency of gene
transfer in vitro and in vivo. J Biol
Chem 272, 6479-6489.
Fassati A,
Wells DJ, Walsh FS, Dickson G (1995)
Efficiency of in vivo gene transfer using murine retroviral vectors is
strain-dependent in mice. Hum Gene Ther
6, 1177-1183.
Fearon ER,
Pardoll DM, Itaya T, Golumbek P, Levitsky HI, Simons JW, Karasuyama H,
Vogelstein B, Frost P (1990)
Interleukin-2 production by tumor cells bypasses T helper function in the
generation of an antitumor response. Cell
60, 397-403.
Federspiel
MJ, Swing DA, Eagleson B, Reid SW, Hughes SH (1996) Expression of transduced genes in mice generated by infecting
blastocysts with avian leukosis virus-based retroviral vectors. Proc Natl Acad Sci USA 93, 4931-4936.
Felgner JH,
Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner
PL (1994) Enhanced gene delivery and
mechanism studies with a novel series of cationic lipid formulations. J Biol Chem 269, 2550-2561.
Felgner PL
and Ringold GM (1991) Cationic
liposome-mediated transfection. Nature
337, 387-388.
Felgner PL,
Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, Ringold GM, and
Danielsen M (1987) Lipofection: a
highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA 84, 7413-7417.
Felgner PL,
Rhodes G (1991) Gene therapeutics. Nature 349, 351-352.
Fender P,
Ruigrok RW, Gout E, Buffet S, Chroboczek J (1997) Adenovirus dodecahedron, a new vector for human gene
transfer. Nat Biotechnol 15, 52-56.
Feng M,
Jackson WH, Goldman CK, Rancourt C, Wang M, Dusing SK, Siegal G, and Curiel DT
(1997) Stable in vivo gene
transduction via a novel adenoviral/retroviral chimeric vector. Nature Biotechnol 15, 866-870.
Fenjves ES,
Gordon DA, Persing LK, Williams DL, Taichman LB (1989) Systemic distribution of apolipoprotein E secreted by grafts
of epidermal keratinocytes: Implications for epidermal function and gene
therapy. Proc Natl Acad Sci USA 86,
8803-8807.
Fernex C,
Dubreuil P, Mannoni P, Bagnis C (1997)
Cre/loxP-mediated excision of a neomycin resistance expression unit from an
integrated retroviral vector increases long terminal repeat-driven
transcription in human hematopoietic cells. J Virol 71, 7533-7540.
Ferrara N,
Carver-Moore K, Chen H, Dowd M, Lu L, O'Shea KS, Powell-Braxton L, Hillan KJ,
Moore MW (1996) Heterozygous
embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-442.
Ferrari G,
Rossini S, Giavazzi R, Maggioni D, Nobili N, Soldati M, Ungers G, Mavilio F,
Gilboa E, Bordignon C (1991) An in
vivo model of somatic cell gene therapy for human severe combined
immunodeficiency. Science 251,
1363-1366.
Ferrari S,
Moro E, Pettenazzo A, Behr J-P, Zacchello F, and Scarpa M (1997) ExGen 500 is an efficient vector for gene delivery to lung
epithelial cells in vitro and in vivo. Gene
Therapy 4, 1100-1106.
Field AK,
Davies ME, DeWitt, Perry HC, Liou R, Germershausen J, Karkas JD, Ashton WT,
Johnston DBR, Tolman RL (1983)
9-{[2-Hydroxy-1-(hydroxymethyl) ethoxy]methyl} guanine: A selective inhibitor
of herpes group virus replication. Proc Natl
Acad Sci USA 80, 4139-4143.
Field SJ,
Tsai F-Y, Kuo F, Zubiaga AM, Kaelin WGJr, Livingston DM, Orkin SH, and
Greenberg ME (1996) E2F-1 functions
in mice to promote apoptosis and suppresses proliferation. Cell 85, 549-561.
Fields S
and Jang SK (1990) Presence of a
potent transcription activating sequence in the p53 protein. Science 249:
1046-1049.
Filion MC
and Phillips NC (1997) Toxicity and
immunomodulatory activity of liposomal vectors formulated with cationic lipids
toward immune effector cells. Biochim
Biophys Acta 1329, 345-356.
Finke S,
Trojaneck B, Moller P, Schadendorf D, Neubauer A, Huhn D, Schmidt-Wolf IG (1997) Increase of cytotoxic sensitivity
of primary human melanoma cells transfected with the interleukin-7 gene to
autologous and allogeneic immunologic effector cells. Cancer Gene Ther 4, 260-268.
Finlay CA, Hinds PW, Levine AJ (1989) The p53 proto-oncogene can act as a suppressor of
transformation. Cell 57, 1083-1093.
Fisher KJ,
Choi H, Burda J, Chen SJ, Wilson JM (1996)
Recombinant adenovirus deleted of all viral genes for gene therapy of cystic
fibrosis. Virology 217, 11-22.
Fisher KJ,
Jooss K, Alston J, Yang Y, Haecker SE, High K, Pathak R, Raper SE, Wilson JM (1997) Recombinant adeno-associated
virus for muscle directed gene therapy.
Nat Med 3, 306-312.
Fisher LJ,
Jinnah HA, Kale LC, Higgins GA, Gage FH (1991)
Survival and function of intrastriatally grafted primary fibroblasts
genetically modified to produce L-dopa. Neuron
6, 371-380.
Flamme I,
von Reutern M, Drexler HC, Syed-Ali S, Risau W (1995) Overexpression of vascular endothelial growth factor in the
avian embryo induces hypervascularization and increased vascular permeability
without alterations of embryonic pattern formation. Dev Biol 171, 399-414.
Flotte TR,
Barraza-Ortiz X, Solow R, Afione SA, Carter BJ, Guggino WB (1995) An improved system for packaging
recombinant adeno-associated virus vectors capable of in vivo transduction. Gene Ther 2, 29-37.
Flugelman
MY, Jaklitch MT, Newman KD, Casscells W, Bratthauer GL, and Dichek DA (1992) Low level in vivo gene transfer
into the arterial wall through a perforated balloon catheter. Circulation 85, 1110-1117.
Folkman J
and DÕAmore PA (1996) Blood vessel
formation: what is its molecular basis? Cell
87, 1153-1155.
Folkman J
and Klagsbrun M (1987) Angiogenic
factors. Science 235, 442-447.
Fong G,
Rossant J, Gertsenstein M, and Breitman ML (1995) Role of the Flt-1 receptor tyrosine kinase in regulating the
assembly of vascular endothelium. Nature
376, 66-70.
Forrester
WC, van Genderen C, Jenuwein T, and Grosschedl R (1994) Dependence of enhancer-mediated transcription of the
immunoglobulin m gene on nuclear matrix attachment regions. Science 265, 1221-1225.
Foster BJ
and Kern JA (1997) HER2-targeted
gene transfer. Hum Gene Ther 8,
719-727.
Frederich
RC, Hamann A, Anderson S, Lollmann B, Lowell BB, Flier JS (1995) Leptin levels reflect body lipid content in mice: evidence
for diet-induced resistance to leptin action. Nat Med 1, 1311-1314.
Fredman JN and Engler JA (1993) Adenovirus precursor to terminal protein interacts with the
nuclear matrix in vivo and in vitro. J.
Virol. 67, 3384-3395.
Friedman PN, Kern SE, Vogelstein B, Prives C (1990) Wild-type but not mutant p53
proteins inhibit the replication activities of simian virus 40 large tumor
antigen. Proc Natl Acad Sci USA 87,
9275-9279.
Friedmann T
(1992) Gene therapy of cancer
through restoration of tumor-suppressor functions? Cancer 70, 1810-1817.
Friedmann
T, Yee J-K (1995) Pseudotyped
retroviral vectors for studies of human gene therapy. Nature Med 1, 275-277.
Fritz JD,
Herweijer H, Zhang G, and Wolff JA (1996) Gene transfer into mammalian cells
using histone-condensed plasmid DNA. Hum Gene Ther 7, 1395-1404.
Fujiwara T,
Cai DW, Georges RN, Mukhopadhyay T, Grimm EA, and Roth JA (1994) Therapeutic effect of a retroviral wild-type p53 expression
vector in an orthotopic lung cancer model. J
Natl Cancer Inst 86, 1458-1462.
Fukumoto S,
Nishizawa Y, Hosoi M, Koyama H, Yamakawa K, Ohno S, Morii H (1997) Protein kinase C d inhibits
the proliferation of vascular smooth muscle cells by suppressing G1 cyclin
expression. J Biol Chem 272,
13816-13822.
Galipeau J, Benaim E, Spencer HT, Blakley RL, Sorrentino BP
(1997) A bicistronic retroviral
vector for protecting hematopoietic cells against antifolates and
P-glycoprotein effluxed drugs. Hum Gene
Ther 8, 1773-1783.
Gannon JV,
Lane DP (1987) p53 and DNA
polymerase a compete for binding to SV40 T antigen. Nature 329, 456-458.
Gao X,
Huang L (1991) A novel cationic
liposome reagent for efficient transfection of mammalian cells. Biochem Biophys Res Commun 179,
280-285.
Gassmann M,
Donoho G, and Berg P (1995)
Maintenance of an extrachromosomal plasmid vector in mouse embryonic stem
cells. Proc Natl Acad Sci USA 92,
1292-1296.
Gately S,
Twardowski P, Stack MS, Cundiff DL, Grella D, Castellino FJ, Enghild J, Kwaan
HC, Lee F, Kramer RA, Volpert O, Bouck N, Soff GA (1997) The mechanism of cancer-mediated conversion of plasminogen to
the angiogenesis inhibitor angiostatin.
Proc Natl Acad Sci USA 94, 10868-10872.
Gavaghan H
(1995) A shot in the arm for gene
therapy company. Nature Med 1, 392.
Geller AI
and Freese A (1990) Infection of
cultured central nervous system neurons with a defective herpes simplex virus 1
vector results in stable expression of Escherichia coli b-galactosidase.
Proc Natl Acad Sci USA 87,
1149-1153.
Georgiev
GP, Kiselev SL and Lukanidin EM (1998)
Genes involved in the control of tumor progression and their possible use for
gene therapy. Gene Ther Mol Biol 1,
381-398.
Gerontakis
S, Strasser A, Metcalf D, Grigoriadis G, Scheerlinck J-PY, and Grumont RJ (1996) Rel-deficient T cells exhibit
defects in production of interleukin 3 and granulocyte-macrophage
colony-stimulating factor. Proc Natl
Acad Sci USA 93, 3405-3409.
Gerrard AJ,
Hudson DL, Brownlee GG, Watt FM (1993)
Towards gene therapy for haemophilia B using primary human keratinocytes. Nature Genet 3, 180-183.
Ghitescu L,
Fixman A, Simionescu M and Simionescu N (1986)
Specific binding sites for albumin restricted to plasmalemmal vesicles of
continuous capillary endothelium: Receptor-mediated transcytosis. J Cell Biol 102, 1304-1311.
Ghivizzani
SG, Lechman ER, Tio C, MulŽ KM, Chada S, McCormack JE, Evans CH, and Robbins PD
(1997) Direct retrovirus-mediated
gene transfer to the synovium of the rabbit knee: implications for arthritis
gene therapy. Gene Ther 4, 977-982.
Gilardi P,
Courtney M, Pavirani A, Perricaudet M (1990)
Expression of human a
1-antitrypsin using a recombinant adenovirus vector. FEFS Lett 267, 60-62.
Gilboa E (1996) Immunotherapy of cancer with
genetically modified tumor vaccines.
Semin Oncol 23, 101-107.
Gilboa E
and Smith G (1994) Gene therapy for
infectious diseases: The AIDS model. Trends
Genet 10, 139-144.
Gilgenkrantz
H, Duboc D, Juillard V, Couton D, Pavirani A, Buillet JG, Briand P, Kahn A (1995) Transient expression of genes
transferred in vivo into heart using
first-generation adenoviral vectors: Role of the immune response. Hum Gene Ther 6, 1265-1274.
Gillio Tos
A, Cignetti A, Rovera G, Foa R (1996)
Retroviral vector-mediated transfer of the tumor necrosis factor a gene into
human cancer cells restores an apoptotic cell death program and induces a
bystander-killing effect. Blood 87,
2486-2495.
Gilmour SK,
Verma AK, Madara T, and O'Brien TG (1987)
Regulation of ornithine decarboxylase gene expression in mouse epidermis and
epidermal tumors during two stage tumorigenesis. Cancer Res 47, 1221-1225.
Ginsberg D, Mechta F, Yaniv M, Oren M (1991) Wild-type p53 can down-modulate the activity of various
promoters. Proc Natl Acad Sci USA 88:
9979-9983.
Giordano
FJ, Ping P, McKirnan MD, Nozaki S, DeMaria AN, Dillmann WH, Mathieu-Costello O,
Hammond HK (1995) Intracoronary gene
transfer of fibroblast growth factor-5 increases blood flow and contractile
function in an ischemic region of the heart. Nature Med 2, 534-539.
Giovannangeli
C, Perrouault L, Escude C, Gryaznov S, HŽlne C (1996) Efficient inhibition of transcription elongation in vitro by
oligonucleotide phosphoramidates targeted to proviral HIV DNA. J Mol Biol 261, 386-398.
Goldman CK,
Soroceanu L, Smith N, Gillespie GY, Shaw W, Burgess S, Bilbao G, Curiel DT (1997) In vitro and in vivo gene
delivery mediated by a synthetic polycationic amino polymer. Nat Biotechnol 15, 462-466.
Good PD,
Krikos AJ, Li SX, Bertrand E, Lee NS, Giver L, Ellington A, Zaia JA, Rossi JJ,
Engelke DR (1997) Expression of
small, therapeutic RNAs in human cell nuclei. Gene Ther 4, 45-54.
Gorman CM,
Aikawa M, Fox B, Fox E, Lapuz C, Michaud B, Nguyen H, Roche E, Sawa T,
Wiener-Kronish JP (1997) Efficient
in vivo delivery of DNA to pulmonary cells using the novel lipid EDMPC. Gene Ther 4, 983-992.
Gottesman
MM amd Pastan I (1988) The multidrug
transporter, a double-edged sword. J
Biol Chem 263, 12163-12166.
Gottfredsson
M, Bohjanen PR (1997) Human
immunodeficiency virus type I as a target for gene therapy. Front Biosci 2, D619-D634.
Gottschalk
S, Christiano RJ, Smith LC, and Woo SLC (1993)
Folate receptor mediated DNA delivery into tumor cells: Potosomal disruption
results in enhanced gene expression. Gene
Ther 1, 185-191.
GšzŸkara
EM, Parris CN, Weber CA, Salazar EP, Seidman MM, Watkins JF, Prakash L ,
Kraemer KH (1994) The human DNA
repair gene, ERCC2 (XPD), corrects
ultraviolet hypersensitivity and ultraviolet hypermutability of a shuttle
vector replicated in xeroderma pigmentosum group D cells. Cancer Res 54, 3837-3844.
Graeber TG,
Osmanian C, Jacks T, Housman DE, Koch CJ, Lowe SW, and Giaccia AJ (1996) Hypoxia-mediated selection of
cells with diminished apoptotic potential in solid tumours. Nature 379, 88-91.
Graham RA,
Burchell JM, Beverley P, Taylor-Papadimitriou J (1996) Intramuscular immunisation with MUC1 cDNA can protect C57
mice challenged with MUC1-expressing syngeneic mouse tumour cells. Int J Cancer 65, 664-670.
Greber UF,
Webster P, Weber J, and Helenius A (1996)
The role of the adenovirus protease in virus entry into cells. EMBO J 15, 1766-1777.
Green NK,
Youngs DJ, Neoptolemos JP, Friedlos F, Knox RJ, Springer CJ, Anlezark GM,
Michael NP, Melton RG, Ford MJ, Young LS, Kerr DJ, Searle PF (1997) Sensitization of colorectal and
pancreatic cancer cell lines to the prodrug
5-(aziridin-1-yl)-2,4-dinitrobenzamide (CB1954) by retroviral transduction and
expression of the E. coli nitroreductase gene. Cancer Gene Ther 4, 229-238.
Grossman M,
Rader DJ, Muller DW, Kolansky DM, Kozarsky K, Clark BJ 3rd, Stein EA, Lupien
PJ, Brewer HB Jr, Raper SE, et al (1995)
A pilot study of ex vivo gene therapy for homozygous familial
hypercholesterolaemia. Nat Med 1,
1148-1154.
Grossman M,
Raper SE, Kozarsky K, Stein EA, Engelhardt JF, Muller D, Lupien PJ, Wilson JM (1994) Successful ex vivo gene therapy
directed to liver in a patient with familial hypercholesterolaemia. Nat Genet 6, 335-341.
Grossman M,
Raper SE, Wilson JM (1992)
Transplantation of genetically modified autologous hepatocytes into nonhuman
primates: feasibility and short-term toxicity. Hum Gene Ther 3,
501-510.
Guieysse
AL, Praseuth D, HŽlne C (1997)
Identification of a triplex DNA-binding protein from human cells. J Mol Biol 267, 289-298.
Gunzburg
WH, Salmons B (1996) Development of
retroviral vectors as safe, targeted gene delivery systems. J Mol Med 74, 171-182.
Guo ZS,
Wang LH, Eisensmith RC, Woo SL (1996)
Evaluation of promoter strength for hepatic gene expression in vivo following
adenovirus-mediated gene transfer. Gene
Ther 3, 802-810.
Guzman RJ,
Hirskowitz EA, Brody SL, Crystal RG, Epstein SE, and Finkel T (1994) In vivo suppression of
injury-induced vascular smooth muscle cell accumulation using
adenovirus-mediated transfer of the herpes simplex virus thymidine kinase gene.
Proc Natl Acad Sci USA 91, 10732-10736.
Haffe HA,
Danel C, Longenecker G, Metzger M, Setoguchi Y et al, (1992) Adenovirus-mediated in vivo gene transfer and expression in
normal rat liver. Nature Genet 1,
372-378.
Haj-Ahmad Y
and Graham FL (1986) Development of
a helper-independent human adenovirus vector and its use in the transfer of the
herpes simplex virus thymidine kinase gene. J Virol 57, 267-274.
Halaas JL,
Boozer C, Blair-West J, Fidahusein N, Denton DA, Friedman JM (1997) Physiological response to
long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci USA 94, 8878-8883.
Halaas JL,
Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK,
Friedman JM (1995) Weight-reducing
effects of the plasma protein encoded by the obese gene. Science 269, 543-546.
Halbert CL,
Standaert TA, Aitken ML, Alexander IE, Russell DW, Miller AD (1997) Transduction by adeno-associated
virus vectors in the rabbit airway: efficiency, persistence, and readministration. J Virol 71, 5932-5941.
Haluska,
F.G., Tsujimoto, Y. and Croce, C.M. (1987)
Oncogene activation by chromosome translocation in human malignancy. Annu. Rev. Genetics 21, 321-347.
Hammes H-P,
Brownlee M, Jonczyk A, Sutter A, Preissner KT (1995) Subcutaneous injection of a cyclic peptide antagonist of
vitronectin receptor-type integrins inhibits retinal neovascularization. Nature Med 2, 529-533.
Hamouda T,
McPhee R, Hsia SC, Read GS, Holland TC, King SR (1997) Inhibition of human immunodeficiency virus replication by the
herpes simplex virus virion host shutoff protein. Virol 71, 5521-5527.
Han J, Sabbatini P, Perez D, Rao L, Modha D, and White E (1996) The E1B 19K protein blocks
apoptosis by interacting with and inhibiting the p53-inducible and
death-promoting Bax protein. Genes Dev
10, 461-477.
Hanazono Y,
Yu JM, Dunbar CE, Emmons RV (1997)
Green fluorescent protein retroviral vectors: low titer and high recombination
frequency suggest a selective disadvantage.
Hum Gene Ther 8, 1313-1319.
Hanna AK,
Fox JC, Neschis DG, Safford SD, Swain JL, Golden MA (1997) Antisense basic fibroblast growth factor gene transfer
reduces neointimal thickening after arterial injury. J Vasc Surg 25, 320-325.
Hansson JH,
Nelson-Williams C, Suzuki H, Schild L, Shimkets R, Lu Y, Canessa C, Iwasaki T,
Rossier B, Lifton RP (1995)
Hypertension caused by a truncated epithelial sodium channel g subunit:
genetic heterogeneity of Liddle syndrome. Nat
Genet 11, 76-82.
Harms JS,
Splitter GA (1995) Intergeron-g
inhibits transgene expression driven by SV40 or CMV promoters but augments
expression driven by the mammalian MHC I promoter. Hum Gene Ther 6, 1291-1297.
Harrell RL,
Rajanayagam S, Doanes AM, Guzman RJ, Hirschowitz EA, Crystal RG, Epstein SE,
Finkel T (1997) Inhibition of
vascular smooth muscle cell proliferation and neointimal accumulation by
adenovirus-mediated gene transfer of cytosine deaminase. Circulation 96, 621-627.
Hart Sl (1994) Cell binding and internalization
by filamentous phage displaying a cyclic Arg-Gly-Asp-containing peptide. J Biol Chem 269, 12468-12474.
Hay JG,
McElvaney NG, Herena J, Crystal RG (1995)
Modification of nasal epithelial potential differences of individuals with
cystic fibrosis consequent to local administration of a normal CFTR cDNA
adenovirus gene transfer vector. Hum
Gene Ther 6, 1487-1496.
Hay, R.T. (1985)
Origin of adenovirus DNA replication. Role of the Nuclear Factor I binding site
in vivo. J. Mol. Biol. 186, 129-136.
Hayday,
A.,C., Gillies, S.D., Saito, H., Wood, C., Wiman, K., Hayward, W.S. and
Tonegawa, S. (1984) Activation of a
translocated human c-myc gene by an
enhancer in the immunoglobulin heavy-chain locus. Nature 307, 334-340.
Hayward WS,
Neel BG, Astrin SM (1981) Activation
of a cellular onc gene by promoter insertion in ALV-induced lymphoid leukosis. Nature 290, 475-480.
Hazinski
TA, Ladd PA, DeMatteo CA (1991)
Localization and induced expression of fusion genes in the rat lung. Am J Respir Cell Mol Biol 4, 206-209.
Heise C, Sampson-Johannes A, Williams A, McCormick F, Von
Hoff DD, Kirn DH (1997) ONYX-015, an
E1B gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral
efficacy that can be augmented by standard chemotherapeutic agents. Nat Med 3, 639-645.
Helin K,
Lees JA, Vidal M, Dyson N, Harlow E, Fattaey A (1992) A cDNA encoding a pRB-binding protein with properties of the
transcription factor E2F. Cell 70,
337-350.
Hermeking H and Eick D (1994)
Mediation of c-Myc-induced apoptosis by p53. Science 265, 2091-2093.
Hermonat
PL, and Muzyczka N (1984) Use of adeno-associated
virus as a mammalian DNA cloning vector: Transduction of neomycin resistance
into mammalian tissue culture cells. Proc
Natl Acad Sci USA 81, 6466-6470.
Hermonat
PL, Quirk JG, Bishop BM, Han L (1997)
The packaging capacity of adeno-associated virus (AAV) and the potential for
wild-type-plus AAV gene therapy vectors.
FEBS Lett 407, 78-84.
Herrmann
JL, Beham AW, Sarkiss M, Chiao PJ, Rands MT, Bruckheimer EM, Brisbay S,
McDonnell TJ (1997) Bcl-2 suppresses
apoptosis resulting from disruption of the NF-kB survival
pathway. Exp Cell Res 237, 101-109.
Hershfield
MS, Buckley RH, Greenberg ML, Melton AL, Schiff R, Hatem C, Kurtzberg J,
Markert ML, Kobayashi RH, Kobayashi AL, et al (1987) Treatment of adenosine deaminase deficiency with polyethylene
glycol-modified adenosine deaminase. N
Engl J Med 316, 589-596.
Herz J and
Gerard RD (1993) Adenovirus-mediated
transfer of low density lipoprotein receptor gene acutely accelerates
cholesterol clearance in normal mice. Proc
Natl Acad Sci USA 90, 2812-2816.
Herzog RW,
Hagstrom JN, Kung SH, Tai SJ, Wilson JM, Fisher KJ, High KA (1997) Stable gene transfer and
expression of human blood coagulation factor IX after intramuscular injection
of recombinant adeno-associated virus.
Proc Natl Acad Sci USA 94, 5804-5809.
Hiebert SW,
Packham G, Strom DK, Haffner R, Oren M, Zambetti G, and Cleveland JL (1995) E2F-1:DP-1 induces p53 and
overrides survival factors to trigger apoptosis. Mol Cell Biol 15,
6864-6874.
Hirschhorn
R, Roegner-Maniscalco V, Kuritsky L, Rosen FS (1981) Bone marrow transplantation only partially restores purine
metabolites to normal in adenosine deaminase-deficient patients. J Clin Invest 68, 1387-1393.
Hoeben RC (1998) Gene therapy
for haemophilia. Gene Ther
Mol Biol 1, 293-300.
Hofland
HEJ, Shephard L, Sullivan SM (1996)
Formation of stable cationic lipid/DNA complexes for gene transfer. Proc Natl Acad Sci USA 93, 7305-7309.
Hofmann C,
Lehnert W, and Strauss M (1997) The
baculovirus vector system for gene delivery into hepatocytes. Gene Ther Mol Biol 1,
Hollenberg
NK (1996) Genes, hypertension, and
intermediate phenotypes. Curr Opin
Cardiol 11, 457-463.
Hollstein
M, Sidransky D ,Vogelstein B, Harris CC (1991)
p53 mutations in human cancers. Science
253, 49-53.
Holt JT,
Arteaga CB, Robertson D, Moses HL (1996)
Gene therapy for the treatment of metastatic breast cancer by in vivo
transduction with breast-targeted retroviral vector expressing antisense c-fos
RNA. Hum Gene Ther 7, 1367-1380.
Horellou P,
Mallet J (1997) Gene therapy for
Parkinson's disease. Mol Neurobiol
15, 241-256.
Horn NA,
Meedi JA, Budahazi G, Marquet M (1995)
Cancer gene therapy using plasmid DNA: Purification of DNA for human clinical
trials. Hum Gene Ther 6, 565-573.
Horowitz
JM, Yandell DW, Park S-H, Canning S, Whyte P, Buchkovich K, Harlow E, Weinberg
RA, Dryja TP (1989) Point mutational
inactivation of the retinoblastoma antioncogene. Science 243, 937-940.
Hu E, Kim
JB, Sarraf P, and Spiegelman BM (1996)
Inhibition in adipogenesis through MAP kinase-mediated phosphoryl;ation of PPARg. Science 274, 2100-2103.
Huang H-JS,
Yee J-K, Shew J-Y, Chen P-L, Bookstein R, Friedmann T, Lee EYHP, Lee W-H (1988) Suppression of the neoplastic
phenotype by replacement of the RB gene in human cancer cells. Science 242, 1563-1566.
Huber BE,
Austin EA, Good SS, Knick VC, Tibbels S, Richards CA (1993) In vivo antitumor
activity of 5-fluorocytosine on human colorectal carcinaoma cells genetically
modified to express cytosine deaminase. Cancer
Res 53, 4619-4626.
Huber BE,
Austin EA, Richards CA, Davis ST, Good SS (1994)
Metabolism of 5-fluorocytosine to 5-fluorouracil in human colorectal tumor
cells transduced with the cytosine deaminase gene: Significant antitumor
effects when only a small percentage of tumor cells express cytosine deaminase.
Proc Natl Acad Sci USA 91,
8302-8306.
Huber BE,
Richards CA, Krenitsky TA (1991)
Retroviral-mediated gene therapy for the treatment of hepatocellular
carcinaoma: An innovative approach for cancer therapy. Proc Natl Acad Sci USA 88, 8039-8043.
Hunger,
S.P., Ohyashiki, K., Toyama, K. and Cleary, M.L. (1992) Hlf, a novel
hepatic bZIP protein, shows altered DNA-binding properties following fusion to
E2A in t(17;19) acute lymphoblastic leukemia. Genes Dev. 6, 1608-1620.
Hunt KK,
Deng J, Liu TJ, Wilson-Heiner M, Swisher SG, Clayman G, Hung MC (1997) Adenovirus-mediated
overexpression of the transcription factor E2F-1 induces apoptosis in human
breast and ovarian carcinoma cell lines and does not require p53. Cancer Res 57, 4722-4726.
Hupp TR, Meek DW, Midgley CA, and Lane DP (1992) Regulation of the specific DNA
binding function of p53. Cell 71,
875-886.
Huygen K,
Content J, Denis O, Montgomery DL, Yawman AM, Deck RR, DeWitt CM, Orme IM,
Baldwin S, D'Souza C, Drowart A, Lozes E, Vandenbussche P, Van Vooren JP, Liu
MA, Ulmer JB (1996) Immunogenicity
and protective efficacy of a tuberculosis DNA vaccine. Nature Med 2, 893-898.
Hyde SC,
Gill DR, Higgins CF, Trezise AEO, MacVinish LJ, Cuthbert AW, Ratcliff R, Evans
MJ, Colledge WH (1993) Correction of
the ion transport defect in cystic fibrosis transgenic mice by gene therapy. Nature 362, 250-255.
Iida A,
Chen ST, Friedmann T, Yee JK (1996)
Inducible gene expression by retrovirus-mediated transfer of a modified
tetracycline-regulated system. J Virol
70, 6054-6059.
Ikonen E,
Aula P, Gron K, Tollersrud O, Halila R, Manninen T, Syvanen A-C, Pertonen L (1991) Spectrum of mutations in
aspartylglucosaminuria. Proc Natl Acad
Sci USA 88, 11222-11226.
Indolfi C,
Avvedimento EV, Rapacciuolo A, Di Lorenzo E, Esposito G, Stabile E, Feliciello
A, Mele E, Giuliano P, Condorelli G, et al (1995) Inhibition of cellular ras prevents smooth muscle cell
proliferation after vascular injury in vivo. Nat Med 1, 541-545.
Inouye RT,
Du B, Boldt-Houle D, Ferrante A, Park IW, Hammer SM, Duan L, Groopman JE,
Pomerantz RJ, Terwilliger EF (1997)
Potent inhibition of human immunodeficiency virus type 1 in primary T cells and
alveolar macrophages by a combination anti-Rev strategy delivered in an
adeno-associated virus vector. J Virol
71, 4071-4078.
Isaacs WB,
Bova GS, Morton RA, Bussemakers MJG, Brooks JD, and Ewing CM (1994) Molecular biology of prostate
cancer. Semin Oncol 21, 514-521.
Isaacs WB, Carter BS, and Ewing CM (1991) Wild-type p53 suppresses growth of human prostate cancer
cells containing mutant p53 alleles. Cancer
Res 51, 4716-4720.
Ishida A,
Sasaguri T, Kosaka C, Nojima H, Ogata J (1997)
Induction of the cyclin-dependent kinase inhibitor p21(Sdi1/Cip1/Waf1) by
nitric oxide-generating vasodilator in vascular smooth muscle cells. J Biol Chem 272, 10050-10057.
Ishizaki J,
Nevins JR, Sullenger BA (1996)
Inhibition of cell proliferation by an RNA ligand that selectively blocks E2F
function. Nat Med 2, 1386-1389.
Isner JM,
Pieczek A, Schainfeld R, Blair R, Haley L, Asahara T, Rosenfield K, Razvi S,
Walsh K, Symes JF (1996b) Clinical
evidence of angiogenesis after arterial gene transfer of phVEGF165 in patient
with ischaemic limb. Lancet 348,
370-374.
Isner JM,
Walsh K, Rosenfield K, Schainfeld R, Asahara T, Hogan K, and Pieczek A (1996a) Clinical protocol. Arterial gene
therapy for restenosis. Hum Gene Ther
7, 989-1011.
Iwanuma Y,
Chen FA, Egilmez NK, Takita H, Bankert RB (1997)
Antitumor immune response of human peripheral blood lymphocytes coengrafted
with tumor into severe combined immunodeficient mice. Cancer Res 57, 2937-2942.
Jaaskelainen
I, Monkkonen J, Urtti A (1994) Oligonucleotide-cationic liposome
interactions. A physicochemical study. Biochim
Biophys Acta 1195, 115-123.
Jaffee EM,
Pardoll DM (1997) Considerations for
the clinical development of cytokine gene-transduced tumor cell vaccines. Methods 12, 143-153.
Janicek MF,
Sevin BU, Nguyen HN, Averette HE (1995)
Combination anti-gene therapy targeting c-myc and p53 in ovarian cancer cell
lines. Gynecol Oncol 59, 87-92.
JŠnicke RU,
Walker PA, Lin XY, and Porter AG (1996)
Specific cleavage of the retinoblastoma protein by an ICE-like protease in
apoptosis. EMBO J 15, 6969-6978.
Jendraschak
E and Sage EH (1996) Regulation of
angiogenesis by SPARC and angiostatin: implications for tumor cell biology. Semin Cancer Biol 7, 139-146.
Jessberger
R, Heuss D, Doerfler W (1989)
Recombination in hamster cell nuclear extracts between adenovirus type 12 DNA
and two hamster preinsertion sequences. EMBO
J 8, 869-878.
Ji W and St
CW (1997) Inhibition of hepatitis B
virus by retroviral vectors expressing antisense RNA. J Viral Hepat 4, 167-173.
Jiao S,
Gurevich V, and Wolff JA (1993)
Long-term correction of rat model of Parkinson's disease by gene therapy. Nature 362, 450-453.
Jin L,
Zhang JJ, Chao L, Chao J (1997) Gene
therapy in hypertension: adenovirus-mediated kallikrein gene delivery in
hypertensive rats. Hum Gene Ther 8,
1753-1761.
Johnson P, Chung S, and Benchimol S (1993) Growth suppression of Friend virus-transformed
erythroleukemia cells by p53 protein is accompanied by hemoglobin production
and is sensitive to erythropoietin. Mol
Cell Biol 13, 1456-1463.
Johnston BH
(1988) The S1-sensitive form of
d(C-T)n.d(A-G)n: chemical evidence for a three-stranded structure in plasmids. Science 241, 1800-1804.
Joki T,
Nakamura M, and Ohno T (1995)
Activation of the radiosensitive EGR-1 promoter induces expression of the
herpes simplex virus thymidine kinase gene and sensitivity of human glioma
cells to ganciclovir. Hum Gene Ther
6, 1507-1513.
Jomary C,
Vincent KA, Grist J, Neal MJ, Jones SE (1997)
Rescue of photoreceptor function by AAV-mediated gene transfer in a mouse model
of inherited retinal degeneration. Gene
Ther 4, 683-690.
Jones,
K.A., Kadonaga, J.T., Rosenfeld, P.J., Kelly, T.J. and Tjian, R. (1987) A cellular DNA-binding protein
that activates eukaryotic transcription and DNA replication. Cell 48, 79-89.
Joshi RL,
Lamothe B, Cordonnier N, Mesbah K, Monthioux E, Jami J, and Bucchini D (1996) Targeted disruption of the
insulin receptor gene in the mouse results in neonatal lethality. EMBO J 15, 1542-1547.
Ju DW, Cao
X, Acres B (1997) Intratumoral
injection of GM-CSF gene encoded recombinant vaccinia virus elicits potent
antitumor response in a mixture melanoma model. Cancer Gene Ther 4, 139-144.
Junker U,
Baker J, Kalfoglou CS, Veres G, Kaneshima H, Bohnlein E (1997) Antiviral potency of drug-gene therapy combinations against
human immunodeficiency virus type 1.
AIDS Res Hum Retroviruses 13, 1395-1402.
Kaelin WG
Jr, Krek W, Sellers WR, DeCaprio JA, Ajchenbaum F, Fuchs CS, Chittenden T, Li
Y, Farnham PJ, Blanar MA, et al (1992)
Expression cloning of a cDNA encoding a retinoblastoma-binding protein with
E2F-like properties. Cell 70,
351-364.
Kafri T,
Blomer U, Peterson DA, Gage FH, Verma IM (1997)
Sustained expression of genes delivered directly into liver and muscle by
lentiviral vectors. Nat Genet 17,
314-317.
Kagami H,
O'Connell BC, Baum BJ (1996)
Evidence for the systemic delivery of a transgene product from salivary glands. Hum Gene Ther 7, 2177-2184.
Kahn P (1995) From genome to proteome: Looking
at a cell's proteins. Science 270,
369-370.
Kamata H,
Yagisawa H, Takahashi S, Hirata H (1994)
Amphiphilic peptides enhance the efficiency of liposome-mediated DNA
transfection. Nucleic Acids Res 22,
536-537.
Kamohara S,
Burcelin R, Halaas JL, Friedman JM, Charron MJ (1997) Acute stimulation of glucose metabolism in mice by leptin
treatment. Nature 389, 374-377
Kamps,
M.P., Look, A.T. and Baltimore, D. (1991) The human t(1;19) translocation in pre-B ALL produces multiple
nuclear E2A-Pbx1 fusion proteins with differing transforming potentials. Genes Dev. 5, 358-368.
Kaneda Y,
Iwai K, and Uchida T (1989)
Increased expression of DNA cointroduced with nuclear protein in adult rat
liver. Science 243, 375-378.
Kaneda Y,
Morishita R, Dzau VJ (1997)
Prevention of restenosis by gene therapy.
Ann N Y Acad Sci 811, 299-308.
Kaplan JM,
Armentano D, Sparer TE, Wynn SG, Peterson PA, Wadsworth SC, Couture KK,
Pennington SE, St George JA, Gooding LR, Smith AE (1997) Characterization of factors involved in modulating
persistence of transgene expression from recombinant adenovirus in the mouse
lung. Hum Gene Ther 8, 45-56.
Karanikas
V, Hwang LA, Pearson J, Ong CS, Apostolopoulos V, Vaughan H, Xing PX, Jamieson
G, Pietersz G, Tait B, Broadbent R, Thynne G, McKenzie IFC (1997) Antibody and T cell responses of
patients with adenocarcinoma immunized with mannan-MUC1 fusion protein. J Clin Invest 100, 2783-2792.
Karet FE,
Lifton RP (1997) Mutations
contributing to human blood pressure variation. Recent Prog Horm Res 52, 263-276.
Karlsson S
(1991) Treatment of genetic defects in hematopoietic cell function by gene
transfer. Blood 78, 2481-2492.
Kasahara N,
Dozy AM, Kan YW (1994)
Tissue-specific targeting of retroviral vectors through ligand-receptor interactions.
Science 266, 1373-1376.
Kastan MB,
Zhan Q, El-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B
and Fornace AJ (1992) A mammalian
cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71, 587-597.
Kato K,
Nakanishi M, Kaneda Y, Uchida T, Okada Y (1991)
Expression of hepatitis B virus surface antigen in adult rat liver.
Co-introduction of DNA and nuclear protein by a simplified liposome method. J Biol Chem 266, 3361-3364.
Kato T,
Iwamoto K, Ando H, Asakawa N, Tanaka I, Kikuchi J, Murakami Y (1996) Synthetic cationic amphiphile for
liposome-mediated DNA transfection with less cytotoxicity. Biol Pharm Bull 19, 860-863.
Kawabata K,
Takakura Y, Hashida M (1995) The
fate of plasmid DNA after intravenous injection in mice: involvement of
scavenger receptors in its hepatic uptake.
Pharm Res 12, 825-830.
Kay MA,
Landen CN, Rothenberg SR, Taylor LA, Leland F, Wiehle S, Fang B, Bellinger D,
Finegold M, Thompson AR, Read M, Brinkhous KM, Woo SLC (1994) In vivo hepatic
gene therapy: Complete albeit transient correction of factor IX deficiency in
hemophilia B dogs Proc Natl Acad Sci USA
91, 2353-2357.
Kay MA,
Rothenberg S, Landen CN, Bellinger DA, Leland F, Toman C, Finegold M, Thompson
AR, Read MS, Brinkhous KM, and Woo SLC (1993)
In vivo gene therapy of hemophilia B: Sustained partial correction in factor
IX-deficient dogs. Science 262,
117-119.
Kazazian HH
Jr, Wong C, Youssoufian H, Scott AF, Phillips DG, and Antonarakis S (1988) Haemophilia A resulting from de
novo insertion of L1 sequences represents a novel mechanism for mutation in
man. Nature 332, 164-166.
Kearns WG,
Afione SA, Fulmer SB, Pang MC, Erikson D, Egan M, Landrum MJ, Flotte TR,
Cutting GR (1996) Recombinant
adeno-associated virus (AAV-CFTR) vectors do not integrate in a site-specific
fashion in an immortalized epithelial cell line. Gene Ther 3, 748-755.
Keck PJ,
Hauser SD, Krivi G, Sanzo K, Warren T, Feder J, and Connolly DT (1989) Vascular permeability factor, an
endothelial cell mitogen related to PDGF. Science
246, 1309-1312.
Kern SE,
Kinzler KW, Bruskin A, Jarosz D, Friedman P, Prives C, Vogelstein B (1991) Identification of p53 as a
sequence-specific DNA-binding protein.
Science 252: 1708-1711.
Kern SE,
Pietenpol JA, Thiagalingam S, Seymour A, Kinzler KW, Vogelstein B (1992) Oncogenic forms of p53 inhibit
p53-regulated gene expression. Science
256, 827-830.
Kessler PD,
Podsakoff GM, Chen X, McQuiston SA, Colosi PC, Matelis LA, Kurtzman GJ, Byrne
BJ (1996) Gene delivery to skeletal
muscle results in sustained expression and systemic delivery of a therapeutic
protein. Proc Natl Acad Sci USA 93,
14082-14087.
Kim JS and
Pabo CO (1997) Transcriptional
repression by zinc finger peptides. Exploring the potential for applications in
gene therapy. J Biol Chem 272,
29795-29800.
Kim M,
Wright M, Deshane J, Accavitti MA, Tilden A, Saleh M, Vaughan WP, Carabasi MH,
Rogers MD, Hockett RD Jr, Grizzle WE, Curiel DT (1997) A novel gene therapy strategy for elimination of prostate
carcinoma cells from human bone marrow. Hum
Gene Ther 8, 157-170.
Kimura H,
Sakamoto T, Cardillo JA, Spee C, Hinton DR, Gordon EM, Anderson WF, and Ryan SJ
(1996) Retrovirus-mediated suicide
gene transduction in the vitreous cavity of the eye: Feasibility in prevention
of proliferative vitreoretinopathy. Hum
Gene Ther 7, 799-808.
Kirchgessner
CU, Patil CK, Evans JW, Cuomo CA, Fried LM, Carter T, Oettinger MA, Brown JM
(1995) DNA-dependent kinase (p350) as a candidate gene for the murine SCID
defect. Science 267, 1178-1183.
Kitsis RN,
Buttrick PM, McNally EM, Kaplan ML, Leinwand LA (1991) Hormonal modulation of a gene injected into rat heart in vivo. Proc Natl Acad Sci USA 88, 4138-4142.
Klefstrom
J, Arighi E, Littlewood T, JŠŠttelŠ M, Saksela E, Evan GI, Alitalo K (1997) Induction of TNF-sensitive
cellular phenotype by c-Myc involves p53 and impaired NF-kB
activation. EMBO J 16, 7382-7392.
Ko LJ and
Prives C (1996) p53: puzzle and paradigm. Genes Dev 10, 1054-1072.
Ko S-C,
Gotoh A, Thalmann GN, Zhau HE, Johnston DA, Zhang W-W, Kao C, and Chung LWK (1996) Molecular therapy with
recombinant p53 adenovirus in an androgen-independent, metastatic human
prostate cancer model. Hum Gene Ther
7, 1683-1691.
Kobayashi
K, Oka K, Forte T, Ishida B, Teng B, Ishimura-Oka K, Nakamuta M, Chan L (1996) Reversal of hypercholesterolemia
in low density lipoprotein receptor knockout mice by adenovirus-mediated gene
transfer of the very low density lipoprotein receptor. J Biol Chem 271, 6852-6860.
Koc ON,
Allay JA, Lee K, Davis BM, Reese JS, Gerson SL (1996) Transfer of drug resistance genes into hematopoietic
progenitors to improve chemotherapy tolerance. Semin Oncol 23, 46-65.
Koeberl DD,
Alexander IE, Halbert CL, Russell DW, Miller AD (1997) Persistent expression of human clotting factor IX from mouse
liver after intravenous injection of adeno-associated virus vectors. Proc Natl Acad Sci USA 94, 1426-1431.
Kohn DB,
Weinberg KI, Nolta JA, Heiss LH, Lenarsky C, Crooks GM, Hanley ME, Annett G,
Brooks JS, El-Khoureiy A, Lawrence K, Wells S, Moen RC, Bastian J,
Williams-Herman DE, Elder M, Wara D, Bowen T, Hershfield MS, Mullen CA, Blaese
RM, Parkman R (1995) Engraftment of
gene-modified umbilical cord blood cells in neonates with adenosine deaminase
deficiency. Nature Med 1, 1017-1023.
Kohwi Y and
Kohwi-Shigematsu T (1988) Magnesium
ion-dependent triple-helix structure formed by homopurine-homopyrimidine
sequences in supercoiled plasmid DNA. Proc
Natl Acad Sci USA 85, 3781-3785.
Kordower
JH, Winn SR, Liu Y-T, Mufson EJ, Sladek Jr JR , Hammang JP, Baetge EE, Emerich
DF (1994) The aged monkey basal
forebrain: Rescue and sprouting of axotomized basal forebrain neurons after
grafts of encapsulated cells secreting human nerve growth factor. Proc Natl Acad Sci USA 91, 10898-10902.
Korhonen J,
Lahtinen I, Halmekyto M, Alhonen L, Janne J, Dumont D, Alitalo K (1995) Endothelial-specific gene
expression directed by the tie gene promoter in vivo. Blood 86, 1828-1835.
Kostic V,
Jackson-Lewis V, de Bilbao F, Dubois-Dauphin M, Przedborski S (1997) Bcl-2: prolonging life in a transgenic
mouse model of familial amyotrophic lateral sclerosis. Science 277, 559-562.
Kotin RM,
Linden RM, Berns KI (1992)
Characterization of a preferred site on human chromosome 19q for integration of
adeno-associated virus DNA by non-homologous recombination. EMBO J 11, 5071-5078.
Kotin RM,
Siniscalco M, Samulski RJ, Zhu X, Hunter L, Laughlin CA, McLaughlin S, Muzyczka
N, Rocchi M, and Berns KI (1990)
Site-specific integration by adeno-associated virus. Proc Natl Acad Sci USA 87, 2211-2215
Kovesdi,
I., Reichel, R. and Nevins, J.R. (1987)
Role of an adenovirus E2 promoter
binding factor in E1A-mediated coordinate gene control. Proc. Natl. Acad. Sci. USA 84, 2180-2184.
Kozarsky
KF, Jooss K, Donahee M, Strauss JFIII, and Wilson JM (1996) Effective treatment of familial hypercholesterolaemia in the
mouse model using adenovirus-mediated transfer of the VLDL receptor gene. Nature Genet 13, 54-62.
Kozarsky
KF, McKinley DR, Austin LL, Raper SE, Stratford-Perricaudet LD, Wilson JM (1994) In vivo correction of low density
lipoprotein receptor deficiency in the Watanabe heritable hyperlipidemic rabbit
with recombinant adenoviruses. J Biol
Chem 269, 13695-13702.
Kruse CA,
Roper MD, Kleinschmidt-DeMasters BK, Banuelos SJ, Smiley WR, Robbins JM,
Burrows FJ (1997) Purified herpes
simplex thymidine kinase Retrovector particles. I. In vitro characterization,
in situ transduction efficiency, and histopathological analyses of gene
therapy-treated brain tumors. Cancer
Gene Ther 4, 118-128.
Kuhober A,
Pudollek HP, Reifenberg K, Chisari FV, Schlicht HJ, Reimann J, Schirmbeck R (1996) DNA immunization induces antibody
and cytotoxic T cell responses to hepatitis B core antigen in H-2b mice. J Immunol 156, 3687-3695.
Kuida K,
Lippke JA, Ku G, Harding MW, Livingston DJ, Su MS-S, and Flavell RA (1995) Altered cytokine export and
apoptosis in mice deficient in interleukin-1b converting enzyme. Science 267, 2000-2003.
Lafarge-Frayssinet
C, Duc HT, Frayssinet C, Sarasin A, Anthony D, Guo Y, Trojan J (1997) Antisense insulin-like growth factor
I transferred into a rat hepatoma cell line inhibits tumorigenesis by
modulating major histocompatibility complex I cell surface expression. Cancer Gene Ther 4, 276-285.
Laitinen M,
Pakkanen T, Donetti E, Baetta R, Luoma J, Lehtolainen P, Viita H, Agrawal R,
Miyanohara A, Friedmann T, Risau W, Martin JF, Soma M, YlŠ-Herttuala S (1997a) Gene transfer into the carotid
artery using an adventitial collar: comparison of the effectiveness of the
plasmid-liposome complexes, retroviruses, pseudotyped retroviruses, and
adenoviruses. Hum Gene Ther 8,
1645-1650.
Laitinen M,
Zachary I, Breier G, Pakkanen T, Hakkinen T, Luoma J, Abedi H, Risau W, Soma M,
Laakso M, Martin JF, YlŠ-Herttuala S (1997b)
VEGF gene transfer reduces intimal thickening via increased production of
nitric oxide in carotid arteries. Hum
Gene Ther 8, 1737-1744.
Lalwani AK,
Walsh BJ, Reilly PG, Muzyczka N, Mhatre AN (1996) Development of in vivo gene therapy for hearing disorders:
introduction of adeno-associated virus into the cochlea of the guinea pig. Gene Ther 3, 588-592.
Lane DP,
Crawford LV (1979) T antigen is
bound to a host protein in SV40-transformed cells. Nature 278: 261-263.
Lannutti
BJ, Gately ST, Quevedo ME, Soff GA, Paller AS (1997) Human angiostatin inhibits murine hemangioendothelioma tumor
growth in vivo. Cancer Res 57,
5277-5280.
Lappalainen
K, Miettinen R, Kellokoski J, Jaaskelainen I, Syrjanen S (1997) Intracellular distribution of oligonucleotides delivered by
cationic liposomes: light and electron microscopic study. Histochem Cytochem 45, 265-274.
Lazebnik
YA, Kaufmann SH, Desnoyers S, Poirier GG, and Earnshaw WC (1994) Cleavage of poly(ADP-ribose) polymerase by a proteinase with
properties like ICE. Nature 371,
346-347.
Le Gal La
Salle F, Robert JJ, Berrard S, Ridoux V, Stratford-Perricaudet LD, Perricaudet
M, Mallet J (1993) An adenovirus
vector in gene transfer into neurons and glia in the brain. Science 259, 988-990.
Le M,
Okuyama T, Cai SR, Kennedy SC, Bowling WM, Flye MW, Ponder KP (1997) Therapeutic levels of functional
human factor X in rats after retroviral-mediated hepatic gene therapy. Blood 89, 1254-1259.
Lechanteur
C, Princen F, Bue SL, Detroz B, Fillet G, Gielen J, Bours V, and Merville M-P (1997) HSV-1 thymidine kinase gene therapy for colorectal
adenocarcinoma-derived peritoneal carcinomatosis. Gene Ther 4, 1189-1194.
Ledley FD (1995) Nonviral gene therapy: The
promise of genes as pharmaceutical products. Hum Gene Ther 6, 1129-1144.
Lee CGL,
Vieira W, Pastan I, and Gottesman MM (1998)
Delivery Systems for the MDR1 gene. Gene Ther Mol Biol 1, 241-251.
Lee ER,
Marshall J, Siegel CS, Jiang C, Yew NS, Nichols MR, Nietupski JB, Ziegler RJ,
Lane MB, Wang KX, Wan NC, Scheule RK, Harris DJ, Smith AE, Cheng SH (1996) Detailed analysis of structures
and formulations of cationic lipids for efficient gene transfer to the lung. Hum Gene Ther 7, 1701-1717.
Lee RJ, Low
PS (1995) Folate-mediated tumor cell
targeting of liposome-entrapped doxorubicin in vitro. Biochim Biophys Acta 1233, 134-144.
Lee, W.-H.,
Bookstein, R., Hong, F., Young, L.-J., Shew, J.-Y. and Lee, E.Y-H.P (1987) Human retinoblastoma
susceptibility gene: cloning, identification and sequence. Science 235, 1394-1399.
Lehrman MA,
Goldstein JL, Russell DW, Brown MS (1987)
Duplication of seven exons in LDL receptor gene caused by Alu-Alu recombination
in a subject with familial hypercholesterolemia. Cell 48, 827-835.
Lesoon-Wood
LA, Kim WH, Kleinman HK, Weintraub BD, and Mixson AJ (1995) Systemic gene therapy with p53 reduces growth and metastases
of a malignant human breast cancer in nude mice. Hum Gene Ther 6, 395-405.
Leung DW,
Cachianes G, Kuang W-J, Goeddel DV, and Ferrara N (1989) Vascular endothelial growth factor is a secreted angiogenic
mitogen. Science 246, 1306-1309.
Levine AJ (1993)
The tumor suppressor genes. Annu Rev
Biochem 62: 623-651.
Levy MY,
Barron LG, Meyer KB, Szoka FC Jr (1996)
Characterization of plasmid DNA transfer into mouse skeletal muscle: evaluation
of uptake mechanism, expression and secretion of gene products into blood. Gene Ther 3, 201-211.
Lew D,
Parker SE, Latimer T, Abai AM, Kuwahara-Rundell A, Doh SG, Yang Z-Y, Laface D,
Gromkowski SH, Nabel GJ, Manthorpe M, and Norman J (1995) Cancer gene therapy using plasmid DNA: pharmacokinetic study
of DNA following injection in mice. Hum
Gene Ther 6, 553-564.
Lewis EB (1950) The phenomenon of position effect. Adv Genet 3, 73-115.
Lewis JG,
Lin KY, Kothavale A, Flanagan WM, Matteucci MD, DePrince RB, Mook RA Jr,
Hendren RW, Wagner RW (1996) A
serum-resistant cytofectin for cellular delivery of antisense
oligodeoxynucleotides and plasmid DNA. Proc
Natl Acad Sci USA 93, 3176-3181.
Li LP,
Schlag PM, Blankenstein T (1997)
Transient expression of SV 40 large T antigen by Cre/LoxP-mediated
site-specific deletion in primary human tumor cells. Hum Gene Ther 8, 1695-1700.
Li R and
Botchan MR (1993) The acidic
transcriptional activation domains of VP16 and p53 bind the cellular
replication protein A and stimulate in vitro BPV-1 DNA replication. Cell 73: 1207-1221.
Li R, Waga
S, Hannon GJ, Beach D, Stillman B (1994)
Differential effects by the p21 CDK inhibitor on PCNA-dependent DNA replication
and repair. Nature 371, 534-537.
Li S and
Huang L (1997) In vivo gene transfer
via intravenous administration of cationic lipid-protamine-DNA (LPD) complexes. Gene Ther 4, 891-900.
Li Z,
Shanmugam N, Katayose D, Huber B, Srivastava S, Cowan K, Seth P (1997) Enzyme/prodrug gene therapy
approach for breast cancer using a recombinant adenovirus expressing
Escherichia coli cytosine deaminase.
Cancer Gene Ther 4, 113-117.
Lidner V,
Reidy MA (1991) Proliferation of
smooth muscle cells after vascular injury if inhibited by an antibody against
basic fibroblast growth factor. Proc
Natl Acad Sci USA 88, 3739-3743.
Lieber A,
He CY, Kirillova I, Kay MA (1996)
Recombinant adenoviruses with large deletions generated by Cre-mediated
excision exhibit different biological properties compared with first-generation
vectors in vitro and in vivo. J Virol
70, 8944-8960.
Lieu FH,
Hawley TS, Fong AZ, Hawley RG (1997)
Transmissibility of murine stem cell virus-based retroviral vectors carrying
both interleukin-12 cDNAs and a third gene: implications for immune gene
therapy. Cancer Gene Ther 4,
167-175.
Lin KF,
Chao J, Chao L (1995) Human atrial
natriuretic peptide gene delivery reduces blood pressure in hypertensive rats. Hypertension 26, 847-853.
Lin KF,
Chao L, Chao J (1997) Prolonged
reduction of high blood pressure with human nitric oxide synthase gene
delivery. Hypertension 30, 307-313.
Linardopoulos
S, Papadakis E, Delakas D, Theodosiou V, Cranidis A, Spandidos DA (1993) Human lung and bladder carcinoma
tumors as compared to their adjacent normal tissue have elevated AP-1 activity
associated with the retinoblastoma gene promoter. Anticancer Res 13, 257-262.
Linzer DP
and Levine AJ (1979)
Characterization of a 54k dalton cellular SV40 tumor antigen present in SV40
transformed cells and uninfected embryonal carcinoma cells. Cell 17, 43-52.
Liotta LA,
Steeg PS, and Stetler-Stevenson WG (1991)
Review. Cancer metastasis and angiogenesis: An imbalance of positive and
negative regulation. Cell 64,
327-336.
Litzinger
DC, Brown JM, Wala I, Kaufman SA, Van GY, Farrell CL, Collins D (1996) Fate of cationic liposomes and
their complex with oligonucleotide in vivo. Biochim Biophys Acta 1281, 139-149.
Liu R,
Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, MacDonald ME, Stuhlmann H,
Koup RA, Landau NR (1996) Homozygous
defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed
individuals to HIV-1 infection. Cell
86, 367-377.
Liu X, Miller CW, Koeffler PH, Berk AJ (1993) The p53 activation domain binds the TATA box-binding polypeptide in holo-TFIID, and a neighboring p53
domain inhibits transcription. Mol Cell
Biol 13: 3291-3300.
Liu Z-g,
Hsu H, Goeddel DV, and Karin M (1996)
Dissection of TNF receptor 1 effector functions: JNK activation is not linked
to apoptosis while NF-kB activation prevents cell death. Cell 87, 565-576.
Lowe S and
Ruley HE (1993) Stabilization of the
p53 tumor suppressor is induced by adenovirus-5 E1A and accompanies apoptosis. Genes Dev 7, 535-545.
Lowe SW, Jacks T, Housman DE, and Ruley EH (1994) Abrogation of oncogene-associated
apoptosis allows transformation of p53-deficient cells. Proc Natl Acad Sci USA 91, 2026-2030.
Lubovy M,
McCune S, Dong JY, Prchal JF, Townes TM, Prchal JT (1996) Stable transduction
of recombinant adeno-associated virus into hematopoietic stem cells from normal
and sickle cell patients. Biol Blood
Marrow Transplant 2, 24-30.
Ludlow, J.W., Shon, J., Pipas, J.M., Livingston, D.M. and
DeCaprio, J.A. (1990) The retinoblastoma susceptibility gene
product undergoes cell cycle-dependent dephosphorylation and binding to and
release from SV40 large T. Cell 60,
387-396.
Luhrs CA,
Raskin CA, Durbin R, Wu B, Sadasivan E, McAllister W and Rothenberg SP (1992) Transfection of a glycosylated
phosphatidylinositol-anchored folate-binding protein complementary DNA provides
cells with the ability to survive in low folate medium. J Clin Invest 90, 840-847.
Luo F, Zhou
SZ, Cooper S, Munshi NC, Boswell HS, Broxmeyer HE, Srivastava A (1995) Adeno-associated virus 2-mediated
gene transfer and functional expression of the human granulocyte-macrophage
colony-stimulating factor. Exp Hematol
23, 1261-1267.
Lynch C,
Israel DI, Kaufman RJ, Miller AD (1993)
Sequences in the coding region of clotting FVIII act as dominant inhibitors of
RNA accumulation and protein production. Hum
Gene Ther 4, 259-272.
Lynch CM,
Clowes MM, Osborne WRA, Clowes AW, Miller AD (1992) Long-term expression of human adenosine deaminase in vascular
smooth muscle cells of rats: a model for gene therapy. Proc Natl Acad Sci USA 89, 1138-1142.
Mack DJ, Vartikar J, Pipas JM, Laimins LA (1993) Specific repression of
TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature 363: 281-283.
Mackensen
A, Lindemann A, Mertelsmann R (1997) Immunostimulatory cytokines in somatic
cells and gene therapy of cancer. Cytokine
Growth Factor Rev 8, 119-128.
Madrigal M,
Janicek MF, Sevin BU, Perras J, Estape R, Penalver M, Averette HE (1997) In vitro antigene therapy
targeting HPV-16 E6 and E7 in cervical carcinoma. Gynecol Oncol 64, 18-25.
Maffei M,
Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim S, Lallone R,
Ranganathan S, et al (1995) Leptin
levels in human and rodent: measurement of plasma leptin and ob RNA in obese
and weight-reduced subjects. Nat Med
1, 1155-1161.
Maffei M,
Stoffel M, Barone M, Moon B, Dammerman M, Ravussin E, Bogardus C, Ludwig DS,
Flier JS, Talley M, et al (1996)
Absence of mutations in the human OB gene in obese/diabetic subjects. Diabetes 45, 679-682.
Magovern
CJ, Mack CA, Zhang J, Rosengart TK, Isom OW, Crystal RG (1997) Regional angiogenesis induced in nonischemic tissue by an
adenoviral vector expressing vascular endothelial growth factor. Hum Gene Ther 8, 215-227.
Maher J,
Colonna F, Baker D, Luzzatto L, Roberts I (1994)
Retroviral-mediated gene transfer of a mutant H-ras gene into normal human bone
marrow alters myeloid cell proliferation and differentiation. Exp Hematol 22, 8-12.
Maher LJ
3d, Dervan PB, Wold B (1992) Analysis
of promoter-specific repression by triple-helical DNA complexes in a eukaryotic
cell-free transcription system.
Biochemistry 31, 70-81.
Mahvi DM,
Burkholder JK, Turner J, Culp J, Malter JS, Sondel PM, Yang NS (1996) Particle-mediated gene transfer of granulocyte-macrophage
colony-stimulating factor cDNA to tumor cells: implications for a clinically
relevant tumor vaccine. Hum Gene Ther
7, 1535-1543.
Mahvi DM,
Sondel PM, Yang NS, Albertini MR, Schiller JH, Hank J, Heiner J, Gan J, Swain
W, Logrono R (1997) Phase I/IB study
of immunization with autologous tumor cells transfected with the GM-CSF gene by
particle-mediated transfer in patients with melanoma or sarcoma. Hum Gene Ther 8, 875-891.
Maillard L
and Walsh K (1996) Growth-arrest
homeobox gene Gax: a molecular strategy to prevent arterial restenosis. Schweiz Med Wochenschr 126, 1721-1726.
Makarov SS,
Olsen JC, Johnston WN, Anderle SK, Brown RR, Baldwin AS Jr, Haskill JS, Schwab
JH (1996) Suppression of
experimental arthritis by gene transfer of interleukin 1 receptor antagonist
cDNA. Proc Natl Acad Sci USA 93,
402-406.
Malik P,
McQuiston SA, Yu XJ, Pepper KA, Krall WJ, Podsakoff GM, Kurtzman GJ, Kohn DB (1997) Recombinant adeno-associated
virus mediates a high level of gene transfer but less efficient integration in
the K562 human hematopoietic cell line.
J Virol 71, 1776-1783.
Malim MH,
Bšhnlein S, Hauber J, Cullen BR (1989)
Functional dissection of the HIV-1 Rev trans-activator--Derivation
of a trans-dominant repressor of Rev
function. Cell 58, 205-214.
Malosky S,
Kolansky DM (1996) Gene therapy for
ischemic heart disease. Curr Opin Cardiol 11, 361-368.
Mamounas M,
Leavitt M, Yu M, Wong-Staal F (1995)
Increased titer of recombinant AAV vectors by gene transfer with adenovirus
coupled to DNA-polylysine complexes.
Gene Ther 2, 429-432.
Mancini MA,
Shan B, Nickerson JA, Penman S, Lee WH (1994)
The retinoblastoma gene product is a cell cycle-dependent, nuclear
matrix-associated protein. Proc Natl
Acad Sci USA 91, 418-422.
Mandel RJ,
Spratt SK, Snyder RO, Leff SE (1997)
Midbrain injection of recombinant adeno-associated virus encoding rat glial
cell line-derived neurotrophic factor protects nigral neurons in a progressive
6-hydroxydopamine-induced degeneration model of Parkinson's disease in rats. Proc Natl Acad Sci USA 94, 14083-14088.
Manome Y,
Wen PY, Dong Y, Tanaka T, Mitchell BS, Kufe DW, Fine HA (1995) Viral vector transduction of the human deoxycytidine kinase
cDNA sensitizes glioma cells to the cytotoxic effects of cytosine arabinoside in vitro and in vivo. Nature Med 2,
567-573.
Marie J-P,
Zittoun R and Sikic BI (1991)
Multidrug resistance (mdr1) gene
expression in adult acute leukemias: correlations with treatment outcome and in
vitro drug sensitivity. Blood 78,
586-592.
Mariman,
E.C.M, van Eekelen, C.A.G., Reinders, R.J., Berns, A.J.M. and van Venrooij,
W.J. (1982) Adenoviral heterogeneous
nuclear RNA is associated with the host nuclear matrix during splicing. J Mol Biol 154, 103.
Marini III
FC, Cannon JP, Belmont JW, Shillitoe EJ, LaPeyre J-N (1995) In vivo marking of
spontaneous or vaccine-induced fibrosarcomas in the domestic house cat, using
an adenoviral vector containing a bifunctional fusion protein, GAL-TEK. Hum Gene Ther 6, 1215-1223.
Markowitz
D, Hesdorffer C, Ward M, Goff S, Bank A (1990)
Retroviral gene transfer using safe and efficient packaging cell lines. Ann N Y Acad Sci 612, 407-414.
Markowitz
S, Wang J, Myeroff L, Parsons R, Sun L, Lutterbaugh J, Fan RS, Zborowska E,
Kinzler KW, Vogelstein B, et al (1995)
Inactivation of the type II TGF-b receptor in colon cancer cells with microsatellite
instability. Science 268, 1336-1338.
Martin F
and Boulikas T (1998) The challenge
of liposomes in gene therapy. Gene Ther
Mol Biol 1,
173-214.
Martin PA (1997) Editorial: Bridging the
Òcommercialization gapÓ in Europe. Gene
Ther 4, 881-882.
Martin SJ
and Green DR (1995) Protease
activation during apoptosis: death by a thousand cuts? Cell 82, 349-352.
Mayordomo,
JI, Zorina T, Storkus WJ, Zitvogel L, Celluzzi C, Falo LD, Melief CJ, Ildstad
ST, Kast WM, Deleo AB, Lotze MT (1995)
Bone marrow-derived dendritic cells pulsed with synthetic tumour peptides
elicit protective and therapeutic antitumour immunity. Nature Med 1, 1297-1302.
Maze R,
Hanenberg H, Williams DA (1997)
Establishing chemoresistance in hematopoietic progenitor cells. Mol Med Today 3, 350-358.
McDonald
RJ, Lukason MJ, Raabe OG, Canfield DR, Burr EA, Kaplan JM, Wadsworth SC, St
George JA (1997) Safety of airway
gene transfer with Ad2/CFTR2: aerosol administration in the nonhuman primate. Hum Gene Ther 8, 411-422.
McKnight, R.A., Shamay, A., Sankaran, L., Wall, R.J.,
and Hennighausen, L. (1992) Matrix-attacment regions can impart
position-independent regulation of a tissue-specific gene in transgenic mice. Proc. Natl. Acad. Sci. 89, 6943-6947.
Mercer WE, Shields MT, Lin D, Appella, Ullrich SJ (1991) Growth supprssion induced by
wild-type p53 protein is accompanied by selective down-regulation of
proliferating-cell nuclear antigen expression. Proc Natl Acad Sci USA 88,
1958-1962.
Merritt AJ,
Potten CS, Kemp CJ, Hickman JA, Balmain A, Lane DP, and Hall PA (1994) The role of p53 in spontaneous
and radiation-induced apoptosis in the gastrointestinal tract of normal and
p53-deficient mice. Cancer Res 54,
614-617.
Mesri EA,
Federoff HJ, Brownlee M (1995)
Expression of vascular endothelial growth factor from a defective herpes
simplex virus type 1 amplicon vector induces angiogenesis in mice. Circ Res 76, 161-167.
Mhashilkar
AM, Biswas DK, LaVecchio J, Pardee AB, Marasco WA (1997) Inhibition of human immunodeficiency virus type 1 replication
in vitro by a novel combination of anti-Tat single-chain intrabodies and NF-kB
antagonists. J Virol 71, 6486-6494.
Michel ML,
Davis HL, Schleef M, Mancini M, Tiollais P, Whalen RG (1995) DNA-mediated immunization to the hepatitis B surface antigen
in mice: aspects of the humoral response mimic hepatitis B viral infection in
humans. Proc Natl Acad Sci USA 92,
5307-5311
Midoux P,
Mendes C, Legrand A, Raimond J, Mayer R, Monsigny M, Roche AC (1993) Specific gene transfer mediated
by lactosylated poly-L-lysine into hepatoma cells. Nucleic Acids Res 21, 871-878.
Migita M,
Medin JA, Pawliuk R, Jacobson S, Nagle JW, Anderson S, Amiri M, Humphries RK,
Karlsson S (1995) Selection of
transduced CD34+ progenitors and enzymatic correction of cells from
Gaucher patients, with bicistronic vectors.
Proc Natl Acad Sci USA 92, 12075-12079.
Mihara, K.,
Cao, X.-R., Yen, A., Chandler, S., Driscoll, B., Murphree, A.L., T'ang, A. and
Fung, Y.-K.T. (1989) Cell
cycle-dependent regulation of phosphorylation of the human retinoblastoma gene
product. Science 246, 1300-1303.
Millauer B,
Wizigmann-Voos S, SchnŸrch H, Martinez R, M¿ller NPH, Risau W, and Ullrich A (1993) High affinity VEGF binding and
developmental expression suggest Flk-1 as a major regulator of vasculogenesis
and angiogenesis. Cell 72, 835-846.
Miller DG,
Adam MA, Miller AD (1990) Gene
transfer by retrovirus vectors occurs only in cells that are actively
replicating at the time of infection. Mol
Cell Biol 10, 4239-4242.
Miller SD, Farmer G, Prives C (1995) p53 inhibits DNA replication in vitro in a
DNA-binding-dependent manner. Mol Cell
Biol 15, 6554-6560.
Mirkin SM,
Lyamichev VI, Drushlyak KN, Dobrynin VN, Filippov SA, Frank-Kamenetskii MD (1987) DNA H form requires a
homopurine-homopyrimidine mirror repeat.
Nature 330, 495-497.
Mitchell PJ
and Tjian R (1989) Transcriptional
regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 371-378
Miura M,
Zhu H, Rotello R, Hartwieg EA, and Huan J (1993)
Induction of apoptosis in fibroblasts by IL-1b-converting
enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell 75, 653-660.
Miyake K,
Tohyama T, Shimada T (1996) Two-step
gene transfer using an adenoviral vector carrying the CD4 gene and human
immunodeficiency viral vectors. Hum Gene
Ther 7, 2281-2286.
Miyanohara
A, Sharkey MF, Witztum JL, Steinberg D, Friedmann T (1988) Efficient expression of retroviral vector-transduced human
low density lipoprotein (LDL) receptor in LDL receptor-deficient rabbit
fibroblasts in vitro. Proc Natl Acad Sci
USA 85, 6538-6542.
Miyashita T
, Reed JC (1995) Tumor suppressor p53 is a direct transcriptional activator of the
human bax gene. Cell 80, 293-299.
Miyashita
T, Harigai M, Hanada M, Reed JC (1994b)
Identification of p53-dependent negative response element in the bcl-2 gene. Cancer Res 54, 3131-3135.
Miyashita
T, Krajewski S, Krajewska M, Wang HG, Lin HK, Liebermann DA, Hoffman B, Reed JC (1994a) Tumor suppressor p53 is a regulator of bcl-2 and bax gene
expression in vitro and in vivo. Oncogene 9, 1799-1805.
Miyatake S,
Martuza RL, Rabkin SD (1997)
Defective herpes simplex virus vectors expressing thymidine kinase for the
treatment of malignant glioma. Cancer
Gene Ther 4, 222-228.
Miyoshi H,
Takahashi M, Gage FH, Verma IM (1997)
Stable and efficient gene transfer into the retina using an HIV-based
lentiviral vector. Proc Natl Acad Sci
USA 94, 10319-10323.
Moelling K
(1997) DNA for genetic vaccination and therapy. Cytokines Cell Mol Ther 3, 127-135.
Moffatt M,
Cookson W (1995) Naked DNA: New
shots for allergy? Nature Med 2,
515-516.
Mogayzel PJ
Jr, Henning KA, Bittner ML, Novotny EA, Schwiebert EM, Guggino WB, Jiang Y,
Rosenfeld MA (1997) Functional human
CFTR produced by stable Chinese hamster ovary cell lines derived using yeast
artificial chromosomes. Hum Mol Genet
6, 59-68.
Momand J, Zambetti GP, Olson DC, George D, Levine AJ (1992) The mdm-2 oncogene product forms a complex with the p53 protein and
inhibits p53-mediated transactivation. Cell
69, 1237-1245.
Momparler
RL, Eliopoulos N, Bovenzi V, Letourneau S, Greenbaum M, Cournoyer D (1996) Resistance to cytosine
arabinoside by retrovirally mediated gene transfer of human cytidine deaminase
into murine fibroblast and hematopoietic cells. Cancer Gene Ther 3, 331-338.
Moolten FL
(1986) Tumor chemosensitivity
conferred by inserted herpes thymidine kinase genes: Paradigm for a prospective
cancer control strategy. Cancer Res
46, 5276-5281.
Moolten FL,
Wells JM (1990) Curability of tumors
bearing herpes thymidine kinase genes transferred by retroviral vectors. J Natl Cancer Inst 82, 297-300.
Morgan JR,
Barrandon Y, Green H, Mulligan RC (1987)
Expression of an exogenous growth hormone gene by transplantable human
epidermal cells. Science 237,
1476-1479.
Morgenstern
JP and Land H (1990) Advanced mammalian gene transfer: high titre retroviral
vectors with multiple drug selection markers and a complementary helper-free
packaging cell line. Nucleic Acids Res
18, 3587-3596.
Morishita
R, Gibbons GH, Ellison KE, Nakajima M, von der Leyen H, Zhang L, Kaneda Y,
Ogihara T, Dzau VJ (1994) Intimal
hyperplasia after vascular injury is inhibited by antisense cdk 2 kinase
oligonucleotides. J Clin Invest 93,
1458-1464.
Morishita
R, Gibbons GH, Ellison KE, Nakajima M, Zhang L, Kaneda Y, Ogihara T, Dzau VJ (1993) Single intraluminal delivery of
antisense cdc2 kinase and proliferating-cell nuclear antigen oligonucleotides
results in chronic inhibition of neointimal hyperplasia. Proc Natl Acad Sci USA 90, 8474-8478.
Morozov VA,
Noguiez-Hellin P, Laune S, Tamboise E, Salzmann JL, Klatzmann D (1997) Plasmovirus: replication cycle of
a novel nonviral/viral vector for gene transfer. Cancer Gene Ther 4, 286-293.
Morris MC,
Vidal P, Chaloin L, Heitz F, Divita G (1997)
A new peptide vector for efficient delivery of oligonucleotides into mammalian
cells. Nucleic Acids Res 25,
2730-2736.
Morsy MA,
Alford EL, Bett A, Graham FL, and Caskey CT (1993) Efficient adenoviral-mediated ornithine transcarmylase
expression in deficient mouse and human hepatocytes. J Clin Invest 92, 1580-1586.
Moser HE
and Dervan PB (1987)
Sequence-specific cleavage of double helical DNA by triple helix formation. Science 238, 645-650.
Moullier P,
Bohl D, Heard J-M, Danos O (1993)
Correction of lysosomal storage in the liver and spleen of MPS VII mice by
implantation of genetically modified skin fibroblasts. Nature Genet 4, 154-159.
Mounzih K,
Lu R, Chehab FF (1997) Leptin
treatment rescues the sterility of genetically obese ob/ob males. Endocrinology 138, 1190-1193.
Mudryj, M.,
Devoto, S.H., Hiebert, S.W., Hunter, T., Pines, J. and Nevins, J.R. (1991) Cell cycle regulation of the E2F
transcription factor involves an interaction with cyclin A. Cell 65, 1243-1253
Mudryj, M.,
Hiebert, S.W. and Nevins, J.R. (1990)
A role for the adenovirus inducible E2F transcription factor in a proliferation
dependent signal transduction pathway. EMBO
J. 9, 2179-2184.
Mujoo K,
Maneval DC, Anderson SC, Gutterman JU (1996)
Adenoviral-mediated p53 tumor suppressor gene therapy of human ovarian
carcinoma. Oncogene 12, 1617-1623.
Mukhopadhyay
T, Tainsky M, Cavender AC, Roth JA (1991)
Specific inhibition of K-ras
expression and tumorigenicity of lung cancer cells by antisense RNA. Cancer Res 51, 1744-1748.
Mul YM,
Verrijzer CP, and van der Vliet PC (1990)
Transcription factors NFI and NFIII/Oct-1 function independently, employing
different mechanisms to enhance adenovirus DNA replication J. Virol. 64, 5510-5518.
Mullen CA,
Kilstrup M, Blaese RM (1992)
Transfer of the bacterial gene for cytosine deaminase to mammalian cells
confers lethal sensitivity to 5-fluorocytosine: A negative selection system. Proc Natl Acad Sci USA 89, 33-37.
Muller DW (1997) The role of proto-oncogenes in
coronary restenosis. Prog Cardiovasc Dis
40, 117-128.
Muller-Ladner
U, Gay RE, Gay S (1997a) Cellular
pathways of joint destruction. Curr Opin
Rheumatol 9, 213-220
Muller-Ladner
U, Roberts CR, Franklin BN, Gay RE, Robbins PD, Evans CH, Gay S (1997b) Human IL-1Ra gene transfer into
human synovial fibroblasts is chondroprotective. J Immunol 158,
3492-3498.
Mummenbrauer T, Janus F, MŸller B, WiesmŸller L, Deppert W,
and Grosse F (1996) p53 protein
exhibits 3'-to-5' exonuclease activity. Cell
85, 1089-1099.
Murata M,
Takahashi S, Kagiwada S, Suzuki A, Ohnishi S-I (1992) pH-dependent membrane fusion and vesiculation of phospholipid
large unilamellar vesicles induced by amphiphilic anionic and cationic
peptides. Biochemistry 31,
1986-1992.
Murayama Y and Horiuchi S (1997) Antisense oligonucleotides to p53 tumor suppressor suppress
the induction of apoptosis by epidermal growth factor in NCI-H 596 human lung
cancer cells. Antisense Nucleic Acid
Drug Dev 7, 109-114.
Muthukkumar
S, Sells SF, Crist SA, Rangnekar VM (1996)
Interleukin-1 induces growth arrest by hypophosphorylation of the
retinoblastoma susceptibility gene product RB. J Biol Chem 271, 5733-5740.
Muzio M, Ni
J, Feng P, Dixit VM (1997) IRAK
(Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278, 1612-1615.
Muzzin P,
Eisensmith RC, Copeland KC, Woo SL (1996)
Correction of obesity and diabetes in genetically obese mice by leptin gene
therapy. Proc Natl Acad Sci USA 93,
14804-14808.
Nabel EG,
Plautz G, and Nabel GJ (1990)
Site-specific gene expression in vivo by direct gene transfer into arterial
wall. Science 249, 1285-1288.
Nabel EG,
Shum L, Pompili VJ, Yang Z-Y, San H, Shu HB, Liptay S, Gold L, Gordon D,
Derynck R, Nabel GJ (1993a) Direct
transfer of transforming growth factor b1 gene into
arteries stimulates fibrocellular hyperplasia. Proc Natl Acad Sci USA 90, 10759-10763.
Nabel EG,
Yang Z, Liptay S, San H, Gordon D, Haudenschild CC, et al. (1993c) Recombinbant platelet-derived
growth factor B gene expression in porcine arteries induces intimal hyperplasia
in vivo. J Clin Invest 91,
1822-1829.
Nabel EG,
Yang Z, Plautz G, Forough R, Zhan X, Haudenschild CC, et al (1993b)
Recombinant fibroblast growth factor-1 promotes intimal hyperplasia and
angiogenesis in arteries in vivo. Nature
362, 844-846.
Nabel GJ,
Nabel EG, Yang Z-Y, Fox BA, Plautz EG, Gao X, Huang L, Shu S, Gordon D, Chang
AE (1993d) Direct gene transfer with
DNA-liposome complexes in melanoma: Expression, biologic activity, and lack of
toxicity in humans. Proc Natl Acad Sci
USA 90, 11307-11311.
Nakao N,
Frodl EM, Widner H, Carlson E, Eggerding FA, Epstein CJ, Brundin P (1995) Overexpressing Cu/Zn superoxide
dismutase enhances survival of transplanted neurons in a rat model of
Parkinson's disease. Nature Med 1,
226-231.
Nakaoka T,
Gonda K, Ogita T, Otawara-Hamamoto Y, Okabe F, Kira Y, Harii K, Miyazono K,
Takuwa Y, Fujita T (1997) Inhibition
of rat vascular smooth muscle proliferation In vitro and In vivo by bone
morphogenetic protein-2. J Clin Invest
100, 2824-2832.
Nakaya T,
Iwai S, Fujinaga K, Sato Y, Otsuka E, Ikuta K (1997) Decoy approach using RNA-DNA chimera oligonucleotides to
inhibit the regulatory function of human immunodeficiency virus type 1 Rev
protein. Antimicrob Agents Chemother
41, 319-325.
Naviaux RK
and Verma IM (1992) Retroviral
vectors for persistent expression in vivo. Curr
Opin Biotechnol 3, 540-547.
Neri D,
Carnemolla B, Nissim A, Leprini A, Querze G, Balza E, Pini A, Tarli L, Halin C,
Neri P, Zardi L, Winter G (1997)
Targeting by affinity-matured recombinant antibody fragments of an angiogenesis
associated fibronectin isoform. Nat
Biotechnol 15, 1271-1275.
Nevins JR (1992) E2F: a link between the RB tumor
suppressor protein and viral oncoproteins. Science
258, 424-429.
Newman KD,
Dunn PF, Owens JW, Schulick AH, Virmani R, Sukhova G, Libby P, Dichek DA (1995) Adenovirus-mediated gene transfer
into normal rabbit arteries results in prolonged vascular cell activation,
inflammation, and neointimal hyperplasia. J
Clin Invest 96, 2955-2965.
Nguyen DM,
Wiehle SA, Koch PE, Branch C, Yen N, Roth JA, Cristiano RJ (1997b) Delivery of the p53 tumor
suppressor gene into lung cancer cells by an adenovirus/DNA complex. Cancer Gene Ther 4, 191-198.
Nguyen DM,
Wiehle SA, Roth JA, Cristiano RJ (1997a)
Gene delivery into malignant cells in vivo by a conjugated adenovirus/DNA
complex. Cancer Gene Ther 4,
183-190.
Nickels JT
and Broach JR (1996) A
ceramide-activated protein phosphatase mediates ceramide-induced G1 arrest of Saccharomyces cerevisiae. Genes
Dev 10, 382-394.
Nielsen LL, Dell J, Maxwell E, Armstrong L, Maneval D,
Catino JJ (1997) Efficacy of p53
adenovirus-mediated gene therapy against human breast cancer xenografts. Cancer Gene Ther 4, 129-138.
Nigro JM,
Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson
N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Harris CC,
Vogelstein B (1989) Mutations in the
p53 gene occur in diverse human tumour types. Nature 342, 705-708.
Nilson BH,
Morling FJ, Cosset FL, Russell SJ (1996)
Targeting of retroviral vectors through protease-substrate interactions. Gene Ther 3, 280-286.
Norrby K (1997) Angiogenesis: new aspects
relating to its initiation and control. APMIS
105, 417-437
Nowak R (1995) Entering the postgenome era. Science 270, 368-371.
Nussbaum RL
and Polymeropoulos MH (1997)
Genetics of Parkinson's disease. Hum Mol
Genet 6, 1687-1691.
O'Neill,
E.A. Fletcher, C., Burrow, C.R., Heintz, N., Roeder, R.G., Kelly, T.J. (1988) Transcription factor OTF-1 is
functionally identical to the DNA replication factor NF-III. Science 241, 1210-1213.
O'Reilly
MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen
BR, Folkman J (1997) Endostatin: an
endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277-285.
O'Reilly
MS, Holmgren L, Chen C, Folkman J (1996)
Angiostatin induces and sustains dormancy of human primary tumors in mice. Nat Med 2, 689-692.
O'Reilly
MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage
EH, Folkman J (1994) Angiostatin: A
novel angiogenesis inhibitor that mediates the suppression of metastases by a
Lewis lung carcinoma. Cell 79,
315-328.
Ohno T,
Gordon D, San H, Pompili VJ, Imperiale MJ, Nabel GJ, and Nabel EG (1994) Gene therapy for vascular smooth
muscle cell proliferation after areterial injutry. Science 265, 781-784.
Ohno T, Yang Z, Ling X, Jaffe M, Nabel EG, Normolle D, Nabel
GJ (1997) Combination gene transfer
to potentiate tumor regression. Gene
Ther 4, 361-366.
Okada H,
Miyamura K, Itoh T, Hagiwara M, Wakabayashi T, Mizuno M, Colosi P, Kurtzman G,
Yoshida J (1996) Gene therapy
against an experimental glioma using adeno-associated virus vectors. Gene Ther 3, 957-964.
Okamoto K
and Beach D (1994) Cyclin G is a
transcriptional target of the p53 tumor suppressor protein. EMBO J 13, 4816-4822.
Okamoto T,
Kaneda Y, Yuzuki D, Huang SKS, Chi DDJ, and Hoon DSB (1997) Induction of antibody response to human tumor antigens by
gene therapy using a fusigenic viral liposome vaccine. Gene Ther 4, 969-976.
Okuyama Y,
Sowa Y, Fujita T, Mizuno T, Nomura H, Nikaido T, Endo T, Sakai T (1996) ATF site of human RB gene
promoter is a responsive element of myogenic differentiation. FEBS Lett 397, 219-224.
Oliner JD Kinzler KW, Meltzer PS, George DL, Vogelstein B (1992) Amplification of a gene encoding a p53-associated protein in
human sarcomas. Nature 358, 80-83.
Olsen JC,
Sechelski J (1995) Use of sodium
butyrate to enhance production of retroviral vectors expressing CFTR cDNA. Hum Gene Ther 6, 1195-1202.
Ono T,
Fujino Y, Tsuchiya T, Usuda M (1990)
Plasmid DNAs directly injected into mouse brain with lipofectin can be
incorporated and expressed by brain cells. Neurosci
Lett 117, 259-263.
Ory DS,
Neugeboren BA, Mulligan RC (1996) A
stable human-derived packaging cell line for production of high titer
retrovirus/vesicular stomatitis virus G pseudotypes. Proc Natl Acad Sci USA 93, 11400-11406.
Osaki T,
Tanio Y, Tachibana I, Hosoe S, Kumagai T, Kawase I, Oikawa S, Kishimoto T (1994) Gene therapy for carcinoembryonic
antigen-producing human lung cancer cells by cell type-specific expression of
herpes simplex virus thymidine kinase gene. Cancer Res 54, 5258-5261.
Otani K,
Nita I, Macaulay W, Georgescu HI, Robbins PD, Evans CH (1996) Suppression of antigen-induced arthritis in rabbits by ex
vivo gene therapy. J Immunol 156,
3558-3562.
Pages J-C,
Andreoletti M, Bennoun M, Vons C, Elcheroth J, Lehn P, Houssin D, Chapman J,
Briand P, Benarous R, Franco D, Weber A (1995)
Efficient retroviral-mediated gene transfer into primary culture of murine and
human hepatocytes: expression of the LDL receptor. Hum Gene Ther 6, 21-30.
Pages J-C,
Loux N, Bellusci S, Farge D, Bennoun M, Vons C, Jouanneau J, Franco D, Briand
P, Weber A (1996a) Hepatocyte growth
factor expressed by a retrovirus-producing cell line enhances retroviral
transduction of primary hepatocytes: implications for in vivo gene transfer. Biochem Biophys Res Commun 222,
726-731.
Pages JC,
Andreoletti M, Loux N, Vons C, Mahieu D, Bargy F, Chapman J, Briand P, Franco
D, Weber A (1996b) Towards gene
therapy in familial hypercholesterolemia (in french) C R Seances Soc Biol Fil
190, 53-65.
Paik SY,
Banerjea A, Chen CJ, Ye Z, Harmison GG, Schubert M (1997) Defective HIV-1 provirus encoding a multitarget-ribozyme
inhibits accumulation of spliced and unspliced HIV-1 mRNAs, reduces infectivity
of viral progeny, and protects the cells from pathogenesis. Hum Gene Ther 8, 1115-1124.
Paleyanda
RK, Velander WH, Lee TK, Scandella DH, Gwazdauskas FC, Knight JW, Hoyer LW,
Drohan WN, and Lubon H (1997)
Transgenic pigs produce functional human factor VIII in milk. Nature Biotech 15, 971-975.
Palmer TD,
Hock RA, Osborne WRA, Miller AD (1987)
Efficient retrovirus-mediated transfer and expression of a human adenosine
deamnase gene in diploid skin fibroblasts from an adenosine deaminase-deficient
human. Proc Natl Acad Sci USA 84,
1055-1059.
Palmer TD,
Rosman GJ, Osborne WRA, Miller AD (1991)
Genetically modified skin fibroblasts persist long after transplantation but
gradually inactivate introduced genes. Proc
Natl Acad Sci USA 88, 1330-1334.
Pang S,
Taneja S, Dardashti K, Cohan P, Kaboo R, Sokoloff M, Tso C-L, Dekernion JB, and
Belldegrun AS (1995) Prostate tissue
specificity of the prostate-specific antigen promoter isolated from a patient
with prostate cancer. Hum Gene Ther
6, 1417-1426.
Papathanasiou MA, Kerr NCK, Robbins JH, McBride OW, Alamo Jr
I, barrett SF, Hickson ID, Fornace Jr AJ (1991)
Induction by ionizing radiation of the gadd45
gene in cultured human cells: Lack of mediation by protein kinase C. Mol Cell Biol 11, 1009-1016.
Park K,
Choe J, Osifchin NE, Templeton DJ, Robbins PD, Kim SJ (1994) The human retinoblastoma susceptibility gene promoter is
positively autoregulated by its own product. J Biol Chem 269, 6083-6088.
Parker SE,
Vahlsing HL, Serfilippi LM, Franklin CL, Doh SG, Gromkowski SH, Lew D,
Manthorpe M, Norman J (1995) Cancer
gene therapy using plasmid DNA: Safety evaluation in rodents and non-human
primates. Hum Gene Ther 6, 575-590.
Parker WB,
King SA, Allan PW, Bennett LLJr, Secrist JAIII, Montgomery JA, Gilbert KS, Waud
WR, Wells AH, Gillespie GY, and Sorscher EJ (1997) In vivo gene
therapy of cancer with E. coli purine
nucleoside phosphorylase. Hum Gene Ther
8, 1637-1644.
Parkman R (1986) The application of bone marrow
transplantation to the treatment of genetic diseases. Science 232, 1373-1378.
Patterson
BC and Sang QA (1997) Angiostatin-converting
enzyme activities of human matrilysin (MMP-7) and gelatinase B/type IV
collagenase (MMP-9). J Biol Chem
272, 28823-28825.
Pennacchio
LA et al (1996) Mutations in the
gene encoding cystatin B in progressive myoclonous epilepsy (EPM1). Science 271, 1731-1734.
Perrouault
L, Asseline U, Rivalle C, Thuong NT, Bisagni E, Giovannangeli C, Le Doan T,
HŽlne C (1990) Sequence-specific
artificial photo-induced endonucleases based on triple helix-forming
oligonucleotides. Nature 344,
358-360.
Perry ME,
Piette J, Zawadzki JA, Harvey D and Levine AJ (1993) The mdm-2 gene is induced in response to UV light in a p53-dependent manner. Proc Natl Acad Sci USA 90, 11623-11627.
Peters C,
Rommerskirch W, Modaressi S, von Figura K (1991)
Restoration of arylsulphatase B activity in human mucopolysaccharidosis-type-VI
fibroblasts by retroviral-vector-mediated gene transfer. Biochem J 276,499-504.
Peters K-R,
Carley WW and Palade GE (1985)
Endothelial plasmalemmal vesicles have a characteristic striped bipolar surface
structure. J Cell Biol 101,
2233-2238.
Peterson
KR, Clegg CH, Li Q, Stamatoyannopoulos G (1997)
Production of transgenic mice with yeast artificial chromosomes. Trends Genet 13, 61-66.
Phillips MI
(1997) Antisense inhibition and
adeno-associated viral vector delivery for reducing hypertension. Hypertension 29, 177-187.
Phillips
MI, Mohuczy-Dominiak D, Coffey M, Galli SM, Kimura B, Wu P, Zelles (1997) Prolonged reduction of high blood
pressure with an in vivo, nonpathogenic, adeno-associated viral vector delivery
of AT1-R mRNA antisense. Hypertension
29, 374-380.
Pietenpol
JA, Holt JT, Stein RW, Moses HL (1990)
Transforming growth factor b 1
suppression of c-myc gene transcription: role in inhibition of keratinocyte
proliferation. Proc Natl Acad Sci USA
87, 3758-3762.
Plank C,
Mechtler K, Szoka FC Jr, Wagner E (1996)
Activation of the complement system by synthetic DNA complexes: a potential
barrier for intravenous gene delivery. Hum
Gene Ther 7, 1437-1446.
Plate KH,
Breier G, Weich HA, and Risau W (1992)
Vascular endothelial growth factor is a potential tumor angiogenesis factor in
human gliomas in vivo. Nature 359, 845-848.
Pochon
NA-M, Heyd B, DŽglon N, Joseph J-M, Zurn AD, Baetge EE, Hammang JP, Goddard M,
Lysaght M, Kaplan F, Kato AC, Schluep M, Hirt L, Regli F, Porchet F, and de
Tribolet N (1996) Clinical Protocol:
Gene therapy for amyotrophic lateral sclerosis (ALS) using a
polymer-encapsulated xenogenic cell line engineered to secrete hCNTF. Hum Gene Ther 7, 851-860.
Podda S,
Ward M, Himelstein A, Richardson C, De La Flor-Weiss E, Smith L, Gottesman M,
Pastan I, Bank A (1992) Transfer and
expression of the human multiple drug resistance gene into live mice. Proc Natl Acad Sci USA 89, 9676-9680.
Polyak K, Xia Y, Zweier JL, Kinzler KW, and Vogelstein B (1997) A model for p53-induced
apoptosis. Nature 389, 300-305.
Polymeropoulos
MH, Higgins JJ, Golbe LI, Johnson WG, Ide SE, Di Iorio G, Sanges G, Stenroos
ES, Pho LT, Schaffer AA, Lazzarini AM, Nussbaum RL, and Duvoisin RC (1996) Mapping of a gene for ParkinsonÕs
Disease to chromosome 4q21-q23. Science
274, 1197-1199.
Polymeropoulos
MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein
J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos
T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the a-synuclein
gene identified in families with Parkinson's disease. Science 276, 2045-2047.
Pombo A,
Ferreira J, Bridge E, and Carmo-Fonseca M (1994)
Adenovirus replication and transcription sites are spatially separated in the
nucleus of infected cells. EMBO J.
13, 5075-5085.
Ponnazhagan
S, Erikson D, Kearns WG, Zhou SZ, Nahreini P, Wang XS, Srivastava A (1997a) Lack of site-specific
integration of the recombinant adeno-associated virus 2 genomes in human cells. Hum Gene Ther 8, 275-284.
Ponnazhagan
S, Yoder MC, Srivastava A (1997b)
Adeno-associated virus type 2-mediated transduction of murine hematopoietic
cells with long-term repopulating ability and sustained expression of a human
globin gene in vivo. J Virol 71,
3098-3104.
Porteous
DJ, Dorin JR, McLachlan G, Davidson-Smith H, Davidson H, Stevenson BJ,
Carothers AD, Wallace WA, Moralee S, Hoenes C, Kallmeyer G, Michaelis U,
Naujoks K, Ho LP, Samways JM, Imrie M, Greening AP, Innes JA (1997) Evidence for safety and efficacy
of DOTAP cationic liposome mediated CFTR gene transfer to the nasal epithelium
of patients with cystic fibrosis. Gene
Ther 4, 210-218.
Powell JS,
Clozel JP, Muller RK, Kuhn H, Hefti F, Hosang M, Baumgartner HR (1989) Inhibitors of
angiotensin-converting enzyme prevent myointimal proliferation after vascular
injury. Science 245, 186-188.
Praseuth D,
Perrouault L, Le Doan T, Chassignol M, Thuong N, HŽlne C (1988) Sequence-specific binding and photocrosslinking of a and b
oligodeoxynucleotides to the major groove of DNA via triple-helix formation. Proc Natl Acad Sci USA 85, 1349-1353.
Prehn JH,
Bindokas VP, Jordan J, Galindo MF, Ghadge GD, Roos RP, Boise LH, Thompson CB,
Krajewski S, Reed JC, Miller RJ (1996)
Protective effect of transforming growth factor-b1 on b-amyloid
neurotoxicity in rat hippocampal neurons.
Mol Pharmacol 49, 319-328.
Prives C (1994)
How loops, B sheets, and helices help us to understand p53. Cell 78: 543-546.
Prives C and Manfredi JJ (1993) The p53 tumor suppressor protein: meeting review. Genes Dev 7, 529-534.
Pruijn, G.J.M., van Driel, W. and van der Vliet, P.C.
(1986) Nuclear factor III, a novel
sequence-specific DNA-binding protein from HeLa cells stimulating adenovirus
DNA replication. Nature 322,
656-659.
Pulaski BA,
Yen K-Y, Shastri N, Maltby KM, Penney DP, Lord EM, and Frelinger JG (1996) Interleukin 3 enhances cytotoxic
T lymphocyte development and class I major histocompatibility complex
"re-presentation" of exogenous antigen by tumor-infiltrating
antigen-presenting cells. Proc Natl Acad
Sci USA 93, 3669-3674.
Putzer BM,
Hitt M, Muller WJ, Emtage P, Gauldie J, Graham FL (1997) Interleukin 12 and B7-1 costimulatory molecule expressed by
an adenovirus vector act synergistically to facilitate tumor regression. Proc Natl Acad Sci USA 94,
10889-10894.
Qin L, Ding
Y, Bromberg JS (1996) Gene transfer
of transforming growth factor-b1 prolongs
murine cardiac allograft survival by inhibiting cell-mediated immunity. Hum Gene Ther 7, 1981-1988.
Qin XQ,
Livingston DM, Kaelin WG Jr, Adams PD (1994)
Deregulated transcription factor E2F-1 expression leads to S-phase entry and
p53-mediated apoptosis. Proc Natl Acad
Sci USA 91, 10918-10922.
Quesada P (1998) Poly (ADP-ribosyl)ation as one of
the molecular events that accompany mammalian spermatogenesis. Gene Ther Mol Biol 1, 681-699.
Rade JJ,
Schulick AH, Virmani R, Dichek DA (1996)
Local adenoviral-mediated expression of recombinant hirudin reduces neointima
formation after arterial injury. Nature
Med 2, 293-298.
Rader DJ (1997) Gene therapy for atherosclerosis.
Int J Clin Lab Res 27, 35-43.
Raffo AJ,
Perlman H, Chen M-W, Day ML, Streitman JS, Buttyan R (1995) Overexpression of bcl-2 protects prostate cancer cells from
apoptosis in vitro and confers
resistance to androgen depletion in vivo.
Cancer Res 55, 4438-4445.
Rajagopal P
and Feigon J (1989) Triple-strand
formation in the homopurine:homopyrimidine DNA oligonucleotides d(G-A)4 and
d(T-C)4. Nature 339, 637-640.
Rak J,
Mitsuhashi Y, Bayko L, Filmus J, Shirasawa S, Sasazuki T, Kerbel RS (1995) Mutant ras oncogenes upregulate VEGF/VPF expression: Implications for
induction and inhibition of tumor angiogenesis. Cancer Res 55, 4575-4580.
Rakhmilevich
AL, Janssen K, Turner J, Culp J, Yang NS (1997) Cytokine gene therapy of cancer using
gene gun technology: superior antitumor activity of interleukin-12. Hum Gene Ther 8, 1303-1311.
Ramesh N,
Shin YK, Lau S, Osborne WRA (1995)
High-level expression from a cytomegalovirus promoter in macrophage cells. Hum Gene Ther 6, 1323-1327.
Ramesh R,
Marrogi AJ and Freeman SM (1998)
Tumor killing using the HSV-tk suicide gene. Gene Ther Mol Biol 1, 253-263.
Ramezani A,
Ding SF, Joshi S (1997) Inhibition
of HIV-1 replication by retroviral vectors expressing monomeric and multimeric
hammerhead ribozymes. Gene Ther 4,
861-867.
Rapaport D,
Ovadia M, Shai Y (1995) A synthetic
peptide corresponding to a conserved heptad repeat domain is a potent inhibitor
of Sendai virus-cell fusion: An emerging similarity with functional domains of
other viruses. EMBO J 14, 5524-5531.
Raper SE,
Grossman M, Rader DJ, Thoene JG, Clark BJ 3rd, Kolansky DM, Muller DW, Wilson
JM (1996) Safety and feasibility of
liver-directed ex vivo gene therapy for homozygous familial
hypercholesterolemia. Ann Surg 223,
116-126.
Raycroft L,
Wu H, Lozano G (1990)
Transcriptional activation by wild-type but not transforming mutants of the p53
anti-oncogene. Science 249:
1049-1051.
Reddy JC,
Hosono S, Licht JD (1995) The
transcriptional effect of WT1 is modulated by choice of expression vector. J Biol Chem 270, 29976-29982.
Richards
CA, Austin EA, and Huber BE (1995)
Transcriptional regulatory sequences of carcinoembryonic antigen:
identification and use with cytosine deaminase for tumor-specific gene therapy.
Hum Gene Ther 6, 881-893.
Richman DD
(1996) HIV Therapeutics. Science 272, 1886-1887.
Riley DJ,
Nikitin AY, Lee WH (1996)
Adenovirus-mediated retinoblastoma gene therapy suppresses spontaneous
pituitary melanotroph tumors in Rb+/- mice. Nat Med 2, 1316-1321.
Riordan JE,
Rommens JM, Kerem B-S, Alon N, Rozmahel R, Grzelczak Z, Zielenski J, Lok S,
Plavsic N, Chou J-L Drumm MI, Iannuzzi MC, Collins FS, Tsui L-C (1989) Identification of the cystic
fibrosis gene: Cloning and characterization of complementary DNA. Science 245, 1066-1073.
Robbins,
P.D., Horowitz, J.M. and Mulligan, R.C. (1990) Negative regulation of human c-fos expression by the retinoblastoma
gene product. Nature 346, 668-671.
Rodolfo M,
Zilocchi C, Melani C, Cappetti B, Arioli I, Parmiani G, Colombo MP (1996) Immunotherapy of experimental
metastases by vaccination with interleukin gene-transduced adenocarcinoma cells
sharing tumor-associated antigens. Comparison between IL-12 and IL-2
gene-transduced tumor cell vaccines. J
Immunol 157, 5536-5542.
Rodriguez
R, Schuur ER, Lim HY, Henderson GA, Simons JW, Henderson DR(1997) Prostate attenuated replication
competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate-specific
antigen-positive prostate cancer cells. Cancer
Res 57, 2559-2563.
Roessler BJ
and Davidson BL (1994) Direct
plasmid mediated transfection of adult murine brain cells in vivo using
cationic liposomes. Neurosci Lett
167, 5-10.
Roessler
BJ, Allen ED, Wilson JM, Hartman JW, Davidson BL (1993) Adenoviral-mediated gene transfer to rabbit synovium in vivo.
J Clin Invest 92, 1085-1092
Rohde M,
Warthoe P, Gjetting T, Lukas J, Bartek J, Strauss M (1996) The retinoblastoma protein modulates expression of genes
coding for diverse classes of proteins including components of the
extracellular matrix. Oncogene 12,
2393-2401.
Rolling F,
Nong Z, Pisvin S, Collen D (1997)
Adeno-associated virus-mediated gene transfer into rat carotid arteries. Gene Ther 4, 757-761.
R¿mer J,
Bugge TH, Pyke C, Lund LR, Flick MJ, Degen JL, Dano K (1996) Impaired wound healing in mice with a disrupted plasminogen
gene. Nat Med 2, 287-292.
Rommerskirch
W, Fluharty AL, Peters C, von Figura K, Gieselmann V (1991) Restoration of arylsulphatase A activity in
human-metachromatic-leucodystrophy fibroblasts via retroviral-vector-mediated
gene transfer. Biochem J 280,
459-461.
Roninson
IB, Chin JE, Choi K, Gros P, Housman DE, Fojo A, Shen D-W, Gottesman MM, Pastan
I (1986) Isolation of human mdr DNA sequencs amplified in
multidruf-resistant KB carcinoma cells. Proc
Natl Acad Sci USA 83, 4538-4542.
Rosenberg
SA (1992) The immunotherapy and gene
therapy of cancer. J Clin Oncol 10,
180-199.
Rosenberg
SA, Packard BS, Aebersold PM, Solomon D, Topalian SL, Toy ST, Simon P, Lotze
MT, Yang JC, Seipp CA, Simpson C, Carter C, Bock S, Schwartzentruber D, Wei JP,
and White DE (1988) Use of tumor
infiltrating lymphocytes and interleukin-2 in the immunotherapy of patients
with metastatic melanoma. N Engl J Med
319, 1676-1680.
Rosenberg,
SA, Anderson WF, Blaese MR, Ettinghausen SE, Hwu P, Karp SE, Kasid A, Mule JJ,
Parkinson DR, Salo JC, Schwartzentruber DJ, Topalian Sl, Weber JS, Yannelli JR,
Yang JC, and Linehan WM (1992)
Initial proposal of clinical research project. Immunization of cancer patients
using autologous cancer cells modified by insertion of the gene for
interleukin-2. Hum Gene Ther 3,
75-90.
Rosenecker
J, Zhang W, Hong K, Lausier J, Geppetti P, Yoshihara S, Papahdjopoulos D, Nadel
JA (1996) Increased liposome
extravasation in selected tissues: Effect of substance P. Proc Natl Acad Sci USA 93, 7236-7241.
Rosenfeld
MA, Siegfried W, Yoshimura K, Yoneyama K, Fukayama M, Stier LE, PŠŠkkš PK,
Gilardi P, Stratford-Perricaudet L, Perricaudet M, Jallat S, Pavirani A, Lecocq
J-P, and Crystal RG (1991)
Adenovirus-mediated transfer of recombinant a1-antitrypsin
gene to the lung epithelium in vivo. Science
252, 431-434.
Rosenfeld
MA, Yoshimura K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Fukayama M,
Bargon J, Stier LE, Stratford-Perricaudet L, Perricaudet M, Guggino WB,
Pavirani A, Lecocq J-P, and Crystal RG (1992)
In vivo transfer of the human cystic fibrosis transmembrane conductance
regulator gene to the airway epithelium. Cell
68, 143-155.
Rosenfeld
MR, Bergman I, Schramm L, Griffin JA, Kaplitt MG, Meneses PI (1997) Adeno-associated viral vector
gene transfer into leptomeningeal xenografts. J Neurooncol 34, 139-144.
Rosenfeld MR, Meneses P, Dalmau J, Drobnjak M, Cordon-Cardo
C, Kaplitt MG (1995) Gene transfer
of wild-type p53 results in restoration of tumor-suppressor function in a
medulloblastoma cell line. Neurology
45, 1533-1539.
Rosenzweig
M, Marks DF, Hempel D, Heusch M, Kraus G, Wong-Staal F, Johnson RP (1997) Intracellular immunization of
rhesus CD34+ hematopoietic progenitor cells with a hairpin ribozyme
protects T cells and macrophages from simian immunodeficiency virus infection. Blood 90, 4822-4831.
Ross G,
Erickson R, Knorr D, Motulsky AG, Parkman R, Samulski J, Straus SE, and Smith
BR (1996) Gene therapy in the United States: a five-year status report. Hum
Gene Ther 7, 1781-1790.
Ross R (1993) The pathogenesis of
atherosclerosis: a perspective for the 1990s. Nature 362, 801-809.
Ross R (1995) Genetically modified mice as
models of transplant atherosclerosis. Nature
Med 2, 527-528.
Roth JA (1996) Clinical protocol. Modification
of tumor suppressor gene expression and induction of apoptosis in non-small
cell lung cancer (NSCLC) with an adenovirus vector expressing wild-type p53 and
cisplatin. Hum Gene Ther 7,
1013-1030.
Roth JA,
Nguyen D, Lawrence DD, Kemp BL, Carrasco CH, Ferson DZ, Hong WK, Komaki R, Lee
JJ, Nesbitt JC, Pisters KMW, Putnam JB, Schea R, Shin DM, Walsh GL, Dolormente
MM, Han C-I, Martin FD, Yen N, Xu K, Stephens LC, McDonnell TJ, Mukhopadhyay T,
and Cai D (1996) Retrovirus-mediated
wild-type p53 gene transfer to tumors of patients with lung cancer. Nature Med 2, 985-991.
Rubenstein
RC, McVeigh U, Flotte TR, Guggino WB, Zeitlin PL (1997) CFTR gene transduction in neonatal rabbits using an
adeno-associated virus (AAV) vector.
Gene Ther 4, 384-392.
Russ AP,
Friedel C, Grez M, von Melchner H (1996)
Self-deleting retrovirus vectors for gene therapy. J Virol 70, 4927-4932.
Russell DW,
Alexander IE, and Miller AD (1995)
DNA synthesis and topoisomerase inhibitors increase transduction by
adeno-associated virus. Proc Natl Acad
Sci USA 92, 5719-5723.
Russell DW,
Alexander IE, Miller AD (1995) DNA
synthesis and topoisomerase inhibitors increase transduction by
adeno-associated virus vectors. Proc
Natl Acad Sci USA 92, 5719-5723.
Russell SJ
(1996) Peptide-displaying phages for
targeted gene delivery. Nature Med
2, 276-277.
Rutledge
EA, Russell DW (1997)
Adeno-associated virus vector integration junctions. J Virol 71, 8429-8436.
Sabbatini P, Chiou S-K, Rao L, White E (1995) Modulation of p53-mediated transcriptional repression and
apoptosis by the adenovirus E1B 19K protein. Mol Cell Biol 15, 1060-1070.
Safa AR,
Glover CJ, Meyers MB, Biedler JL, Felsted RL (1986) Vinblastine photoaffinity labeling of a high molecular weight
surface membrane glycoprotein specific for multidrug-resistant cells. J Biol Chem 261, 6137-6140.
Saijo Y,
Perlaky L, Wang H, Busch H (1994)
Pharmacokinetics, tissue distribution, and stability of antisense
oligodeoxynucleotide phosphorothioate ISIS 3466 in mice. Oncol Res 6, 243-249.
Sakai T,
Ohtani N, McGee TL, Robbins PD, Dryja TP (1991)
Oncogenic germ-line mutations in Sp1 and ATF sites in the human retinoblastoma
gene. Nature 353, 83-86.
Saleh M (1996) Ectopic expression of vascular
endothelial growth factor (VEGF) by C6 glioma cells does not increase tumour
growth in vivo despite an increase in
angiogenesis. Int J Oncol 9, 33-41.
Saleh MN,
Khazaeli MB, Wheeler RH, Bucy RP, Liu T, Everson MP, Munn DH, Schlom J,
LoBuglio AF (1995) Phase II trial of
murine monoclonal antibody D612 combined with recombinant human monocyte
colony-stiumlating factor (rhM-CSF) in pateints with metastatic
gastrointestinal cancer. Cancer Res
55, 4339-4346.
Salvetti A,
Moullier P, Cornet V, Brooks D, Hopwood JJ, Danos O, Heard J-M (1995) In vivo delivery of human a-L-Iduronidase in mice implanted with
neo-organs. Hum Gene Ther 6,
1153-1159.
Sanda MG,
Ayyagari SR, Jaffee EM, Epstein JI, Clift SL, Cohen LK, Dranoff G, Pardoll DM,
Mulligan RC, Simons JW (1994)
Demonstration of a rational strategy for human prostate cancer gene therapy. J Urol 151, 622-628.
Sandig V,
Hofmann C, Steinert S, Jennings G, Schlag P, Strauss M (1996) Gene transfer into hepatocytes and human liver tissue by
baculovirus vectors. Hum Gene Ther
7, 1937-1945.
Sandig V
and Strauss M (1996) Liver-directed
gene transfer and application to therapy. J
Mol Med 74, 205-212.
Santoro C,
Mermod N, Andrews PC, and Tjian R.(1988)
A family of human CCAAT-box-binding proteins active in transcription and DNA
replication: cloning and expression of multiple cDNAs. Nature 334, 218-224.
Sargiacomo
M, Sudol M, Tang ZL and Lisanti MP (1993)
Signal transducing molecules and glycosyl-phosphatidylinositol-linked proteins
form a caveolin-rich insoluble complex in MDCK cells. J. Cell Biol. 122, 789-807.
Sarnow P, Ho YS, Williams J, Levine AJ (1982) Adenovirus E1b-58kd tumor antigen and SV40 large tumor
antigen are physically associated with the same 54 kd cellular protein in
transformed cells. Cell 28, 387-394.
Savani RC
and Turley EA (1995) The role of
hyaluronan and its receptors in restenosis after balloon angioplasty:
development of a potential therapy. Int
J Tissue React 17, 141-151.
Sawchuk SJ,
Boivin GP, Duwel LE, Ball W, Bove K, Trapnell B, Hirsch R (1996) Anti-T cell receptor monoclonal antibody prolongs transgene
expression following adenovirus-mediated in vivo gene transfer to mouse
synovium. Hum Gene Ther 7, 499-506.
Scarlatti
G, Tresoldi E, Bjorndal A, Fredriksson R, Colognesi C, Deng HK, Malnati MS,
Plebani A, Siccardi AG, Littman DR, Fenyo EM, Lusso P (1997) In vivo evolution of HIV-1 co-receptor usage and sensitivity
to chemokine-mediated suppression. Nat
Med 3, 1259-1265.
Schaack, J., Ho, W. Y.-W., Freimuth, P., and Shenk,
T. (1990) Adenovirus terminal
protein mediates both nuclear matrix association and efficient transcription of
adenovirus DNA Genes Dev 4,
1197-1208.
Scharfmann
R, Axelrod JH, and Verma IM (1991).
Long-term in vivo expression of retrovirus-mediated gene transfer in mouse
fibroblast implants. Proc Natl Acad Sci
USA 88, 4626-4630.
Schild L (1996) The ENaC channel as the primary
determinant of two human diseases: Liddle syndrome and pseudohypoaldosteronism.
Nephrologie 17, 395-400.
Schlake T,
Klehr-Wirth D, Yoshida M, Beppu T, and Bode J (1994) Gene expression within a chromatin domain: the role of core
histone hyperacetylation. Biochemistry
33, 4197-4206.
Schwartz B,
Benoist C, Abdallah B, Rangara R, Hassan A, Scherman D, Demeneix BA (1996) Gene transfer by naked DNA into
adult mouse brain. Gene Ther 3,
405-411.
Schwartz B,
Benoist C, Abdallah B, Scherman D, Behr J-P, and Demeneix BA (1995) Lipospermine-based gene transfer
into the newborn mouse brain is optimized by a low lipospermine/DNA charge
ratio. Hum Gene Ther 6, 1515-1524.
Schwarzenberger
P, Spence SE, Gooya JM, Michiel D, Curiel DT, Ruscetti FW, Keller JR (1996) Targeted gene transfer to human
hematopoietic progenitor cell lines through the c-kit receptor. Blood 87, 472-478.
Seibel P,
Trappe J, Villani G, Klopstock T, Papa S, and Reichman H: Transfection of
mitochondria: strategy towards a gene therapy of mitochondrial DNA diseases.
Nucleic Acids Res 23: 10-17, 1995.
Senger DR,
van de Water L, Brown LF, Nagy JA, Yeo K-T, Yeo T-K, Berse B, Jackman RW,
Dvorak AM, and Dvorak HF (1993)
Vascular permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev 12, 303-324.
Serio D,
Rizvi TA, Cartas M, Kalyanaraman VS, Weber IT, Koprowski H, Srinivasan A (1997) Development of a novel anti-HIV-1
agent from within: effect of chimeric Vpr-containing protease cleavage site
residues on virus replication. Proc Natl
Acad Sci USA 94, 3346-3351.
Seth P (1994) Adenovirus-dependent release of
choline from plasma membrane vesicles at an acidic pH is mediated by the penton
base protein. J Virol 68, 1204-1206.
Seth P,
FitzGerald D, Ginsberg H, Willingham M and Pastan I (1984) Evidence that the penton base of adenovirus is involved in
potentiation of toxicity of Pseudomonas exotoxin conjugated to epidermal growth
factor. Mol Cell Biol 4, 1528-1533.
Seto E, Usheva A, Zambetti GP, Momand J, Horikoshi N,
Weinmann R, Levine AJ, Shenk T (1992)
Wild-type p53 binds to the TATA-binding protein and represses transcription. Proc Natl Acad Sci USA 89, 12028-12032.
Shalaby F,
Rossant J, Yamaguchi TP, Gertsenstein M, Wu X, Breitman ML, and Schuh AC (1995) Failure of blood island formation
and vasculogenesis in Flk-1-defficient mice. Nature 376, 62-66.
Shan B and Lee WH (1994)
Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis. Mol Cell Biol 14, 8166-8173.
Shan B,
Chang CY, Jones D, Lee WH (1994) The
transcription factor E2F-1 mediates the autoregulation of RB gene expression. Mol Cell Biol 14, 299-309.
Shan B, Zhu
X, Chen PL, Durfee T, Yang Y, Sharp D, Lee WH (1992) Molecular cloning of cellular genes encoding
retinoblastoma-associated proteins: identification of a gene with properties of
the transcription factor E2F. Mol. Cell.
Biol. 12, 5620-5631.
Sharma S,
Cantwell M, Kipps TJ, Friedmann T (1996)
Efficient infection of a human T-cell line and of human primary peripheral
blood leukocytes with a pseudotyped retrovirus vector. Proc Natl Acad Sci USA 93, 11842-11847.
Shen F,
Ross JF, Wang X, and Ratnam M (1994)
Identification of a novel folate receptor, a truncated receptor, and receptor
type b in hematopoietic cells: cDNA cloning, expression, immunoreactivity, and
tissue specificity. Biochemistry 33,
1209-1215.
Shen Y and Shenk T (1994)
Relief of p53-mediated transcriptional repression by the adenovirus E1B 19-kDa
protein or the cellular Bcl-2 protein. Proc
Natl Acad Sci USA 91, 8940-8944.
Shevelev A,
Burfeind P, Schulze E, Rininsland F, Johnson TR, Trojan J, Chernicky CL, HŽlne
C, Ilan J, Ilan J (1997) Potential
triple helix-mediated inhibition of IGF-I gene expression significantly reduces
tumorigenicity of glioblastoma in an animal model. Cancer Gene Ther 4, 105-112.
Shi CS and
Kehrl JH (1997) Activation of
stress-activated protein Kinase/c-Jun N-terminal kinase, but not NF-kB, by the
tumor necrosis factor (TNF) receptor 1 through a TNF receptor-associated factor
2- and germinal center kinase related-dependent pathway. J Biol Chem 272, 32102-32107.
Shih CC,
Stoye JP, Coffin JM (1988) Highly
preferred targets for retrovirus integration. Cell 53, 531-537.
Shiio Y,
Sawada J, Handa H, Yamamoto T, Inoue J (1996)
Activation of the retinoblastoma gene expression by Bcl-3: implication for
muscle cell differentiation. Oncogene
12, 1837-1845.
Shiio Y, Yammoto T, Yamaguchi N (1992) Negative regulation of Rb expression by the p53 gene product.
Proc Natl Acad Sci USA 89,
5206-5210.
Shimkets
RA, Warnock DG, Bositis CM, Nelson-Williams C, Hansson JH, Schambelan M, Gill
JR Jr, Ulick S, Milora RV, Findling JW, et al (1994) Liddle's syndrome: heritable human hypertension caused by
mutations in the b subunit of the epithelial
sodium channel. Cell 79, 407-414.
Shirodkar, S., Ewen, M., DeCaprio, J.A., Morgan, J.,
Livingston, D.M. and Chittenden, T. (1992)
The transcription factor E2F interacts with the retinoblastoma product and a
p107-cyclin A complex in a cell cycle-regulated manner. Cell 68, 157-166.
Shivakumar CV, Brown DR, Deb S, Deb SP (1995) Wild-type human p53 transactivates the human proliferating
cell nuclear antigen promoter. Mol Cell
Biol 15, 6785-6793.
Shweiki D,
Itin A, Soffer D, and Keshet E (1992)
Vascular endothelial growth factor induced by hypoxia may mediate
hypoxia-initiated angiogenesis. Nature
359, 843-845.
Sime PJ,
Xing Z, Graham FL, Csaky KG, Gauldie J (1997) Adenovector-mediated gene
transfer of active transforming growth factor-b1 induces
prolonged severe fibrosis in rat lung. J
Clin Invest 100, 768-776.
Simons M,
Edelman ER, Rosenberg RD (1994)
Antisense proliferating cell nuclear antigen oligonucleotides inhibit intimal
hyperplasia in a rat carotid artery injury model. J Clin Invest 93,
2351-2356.
Singh D and
Rigby PW (1996) The use of histone
as a facilitator to improve the efficiency of retroviral gene transfer. Nucleic Acids Res 24, 3113-3114.
Smith JD,
Wong E, Ginsberg M (1995) Cytochrome
P450 1A1 promoter as a genetic switch for the regulatable and physiological
expression of a plasma protein in transgenic mice. Proc Natl Acad Sci USA 92, 11926-11930.
Smith ML,
Chen I-T, Zhan Q, Bae I, Chen C-Y, Gilmer TM, Kastan MB, O'Connor PM, Fornace
Jr AJ (1994) Interaction of the
p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 266: 1376-1380.
Smith RC,
Branellec D, Gorski DH, Guo K, Perlman H, Dedieu JF, Pastore C, Mahfoudi A,
Denefle P, Isner JM, Walsh K (1997)
p21CIP1-mediated inhibition of cell proliferation by overexpression of the gax
homeodomain gene. Genes Dev 11,
1674-1689.
Smith RC,
Wills KN, Antelman D, Perlman H, Truong LN, Krasinski K, Walsh K (1997) Adenoviral constructs encoding
phosphorylation-competent full-length and truncated forms of the human
retinoblastoma protein inhibit myocyte proliferation and neointima formation. Circulation 96, 1899-1905.
Smith TAG,
Mehaffey MG, Kayda DB, Saunders JM, Yei S, Trapnell BC, McClelland A, Kaleko M
(1993) Adenovirus mediated
expression of therapeutic plasma levels of human factor IX in mice. Nature Genet 5, 3970-402.
Snyder RO,
Miao CH, Patijn GA, Spratt SK, Danos O, Nagy D, Gown AM, Winther B, Meuse L,
Cohen LK, Thompson AR, Kay MA (1997)
Persistent and therapeutic concentrations of human factor IX in mice after
hepatic gene transfer of recombinant AAV vectors. Nat Genet 16, 270-276.
Somia NV,
Zoppe M, Verma IM (1995) Generation
of targeted retroviral vectors by using single-chain variable fragment: an
approach to in vivo gene delivery. Proc
Natl Acad Sci USA 92, 7570-7574.
Song S,
Wang Y, Bak SY, Lang P, Ullrey D, Neve RL, O'Malley KL, Geller AI (1997) An HSV-1 vector containing the
rat tyrosine hydroxylase promoter enhances both long-term and cell
type-specific expression in the midbrain.
J Neurochem 68, 1792-1803.
Song YK,
Liu F, Chu S, Liu D (1997)
Characterization of cationic liposome-mediated gene transfer in vivo by
intravenous administration. Hum Gene
Ther 8, 1585-1594.
Sorgi FL,
Bhattacharya S, Huang L (1997)
Protamine sulfate enhances lipid-mediated gene transfer. Gene Ther 4, 961-968.
Sorrentino
BP, Brandt SJ, Bodine D, Gottesman M, Pastan I, Cline A, Nienhuis AW (1992) Selection of drug-resistant bone
marrow cells in vivo after retroviral transfer of human MDR1. Science 257,
99-103.
Sorscher
EJ, Peng S, Bebok Z, Allan PW, Bennett LLJ, and Parker WB (1994) Tumor cell bystander killing in colonic carcinoma utilizing
the Escherichia coli DeoD gene to generate toxic purines. Gene Ther 1, 233-238.
Sowa Y,
Shiio Y, Fujita T, Matsumoto T, Okuyama Y, Kato D, Inoue J, Sawada J, Goto M,
Watanabe H, Handa H, Sakai T (1997)
Retinoblastoma binding factor 1 site in the core promoter region of the human
RB gene is activated by hGABP/E4TF1.
Cancer Res 57, 3145-3148.
Spaete,
R.R. and Frenkel, N. (1982) The
herpes simplex virus amplicon: a new eucaryotic defective-virus
cloning-amplifying vector. Cell 30, 295-304.
Spiegelman
BM and Flier JS (1996) Adipogenesis
and obesity: rounding out the big picture. Cell
87, 377-389.
Stahl F (1996) Meiotic recombination in yeast:
coronation of the double-strand-break repair model. Cell 87, 965-968.
Stathakis
P, Fitzgerald M, Matthias LJ, Chesterman CN, Hogg PJ (1997) Generation of angiostatin by reduction and proteolysis of
plasmin. Catalysis by a plasmin reductase secreted by cultured cells. J Biol Chem 272, 20641-20645.
Stenger JE,
Mayr GA, Mann K, Tegtmeyer P (1992)
Formation of stable p53 homotetramers and multiples of tetramers. Mol Carcinog 5, 102-106.
Stephan D,
San H, Yang ZY, Gordon D, Goelz S, Nabel GJ, Nabel EG (1997) Inhibition of vascular smooth muscle cell proliferation and
intimal hyperplasia by gene transfer of b-interferon.
Mol Med 3, 593-599.
Stinchcomb
DT (1995) Constraining the cell
cycle: Regulating cell division and differentiation by gene therapy. Nature Med 1, 1004-1006.
Stuart E, Haffner R, Oren M, Gruss P (1995) Loss of p53 function through PAX-mediated transcriptional
repression. EMBO J 14, 5638-5645.
StŸrzbecher
H-W, Donzelmann B, Henning W, Knippschild U, Buchhop S (1996) p53 is linked directly to homologous recombination processes
via RAD51/RecA protein interaction. EMBO
J 15, 1992-2002.
Su H, Chang
JC, Xu SM, and Kan YW (1996)
Selective killing of AFP-positive hepatocellular carcinoma cells by
adeno-associated virus transfer of ther herpes simplex virus thymidine kinase
gene. Hum Gene Ther 7, 463-470.
Suchi M,
Dinur T, Desnick RJ, Gatt S, Pereira L, Gilboa E, Schuchman EG (1992) Retroviral-mediated transfer of
the human acid sphingomyelinase cDNA: Correction of the metabolic defect in
cultured Niemann-Pick disease cells. Proc
Natl Acad Sci USA 89, 3227-3231.
Sugimoto Y,
Aksentijevich I, Murray G, Brady RO, Pastan I, Gottesman MM (1995) Retroviral coexpression of a
multidrug resistance gene (MDR1) and
human a-galactosidase A for gene therapy of fabry disease. Hum Gene Ther 6, 905-915.
Sun TQ,
Fernstermacher DA, Vos JM (1994)
Human artificial episomal chromosomes for cloning large DNA fragments in human
cells. Nat Genet 8, 33-41.
Suri C,
Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, Sato TN, and
Yancopoulos GD (1996) Requisite role
of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic
angiogenesis. Cell 87, 1171-1180.
Suzuki K,
Hayashi N, Miyamoto Y, Yamamoto M, Ohkawa K, Ito Y, Sasaki Y, Yamaguchi Y,
Nakase H, Noda K, Enomoto N, Arai K, Yamada Y, Yoshihara H, Tujimura T, Kawano
K, Yoshikawa K, and Kamada T (1996)
Expression of vascular permeability factor/vascular endothelial factor in human
hepatocellular carcinoma. Cancer Res
56, 3004-3009.
Svensson U
and Persson R (1984) Entry of
adenovirus 2 into HeLa cells. J Virol
51, 687-694.
Swantek JL,
Cobb MH, Geppert TD (1997) Jun
N-terminal kinase/stress-activated protein kinase (JNK/SAPK) is required for
lipopolysaccharide stimulation of tumor necrosis factor a (TNF-a)
translation: glucocorticoids inhibit TNF-a
translation by blocking JNK/SAPK. Mol
Cell Biol 17, 6274-6282.
Szary J,
Missol E, Tarnawski R, Szala S (1997)
Selective augmentation of radiation effects by 5-fluorocytosine on murine
B16(F10) melanoma cells transfected with cytosine deaminase gene. Cancer Gene Ther 4, 269-272.
Szostak,
J.W., Orr-Weaver, T.L., Rothstein, R.J. and Stahl, F.W. (1983) The
double-strand-break repair model for recombination. Cell 33, 25-35.
Tahara H,
Lotze MT, Robbins PD, Storkus WJ, Zitvogel L (1995) IL-12 gene therapy using direct injection of tumors with
genetically engineered autologous fibroblasts. Hum Gene Ther 6, 1607-1624.
Tahara H,
Zitvogel L, Storkus WJ, Robbins PD, Lotze MT (1996) Murine models of
cancer cytokine gene therapy using interleukin-12. Ann N Y Acad Sci 795, 275-283.
Takahashi
JC, Saiki M, Miyatake S, Tani S, Kubo H, Goto K, Aoki T, Takahashi JA, Nagata
I, Kikuchi H (1997)
Adenovirus-mediated gene transfer of basic fibroblast growth factor induces in
vitro angiogenesis. Atherosclerosis 132,
199-205.
Takahashi
T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK, Vinocour M, Levitt M, Pass H,
Gazdar AF, Minna JD (1989) p53: A
frequent target for genetic abnormalities in lung cancer. Science 246: 491-494.
Takehara T,
Hayashi N, Yamamoto M, Miyamoto Y, Fusamoto H, Kamada T (1996) In vivo gene
transfer and expression in rat stomach by submucosal injection of plasmid DNA. Hum Gene Ther 7, 589-593.
Takeshita
S, Isshiki T, Mori H, Tanaka E, Tanaka A, Umetani K, Eto K, Miyazawa Y, Ochiai
M, Sato T (1997) Microangiographic
assessment of collateral vessel formation following direct gene transfer of
vascular endothelial growth factor in rats.
Cardiovasc Res 35, 547-552.
Takeshita
S, Losordo DW, Kearney M, Rossow ST, and Isner JM (1994b) Time course of recombinant protein secretion after
liposome-mediated gene transfer in a rabbit arterial organ culture model. Lab Invest 71, 387-391.
Takeshita
S, Zheng LP, Brogi E, Kearney M, Pu L-Q, Bunting S, Ferrara N, Symes JF, and
Isner JM (1994a) Therapeutic
angiogenesis. A single intraarterial bolus of vascular endothelial growth
factor augments revascularization in a rabbit ischemic limb model. J Clin Invest 93, 662-670.
Takle GB,
Thierry AR, Flynn SM, Peng B, White L, Devonish W, Galbraith RA, Goldberg AR,
George ST (1997) Delivery of
oligoribonucleotides to human hepatoma cells using cationic lipid particles
conjugated to ferric protoporphyrin IX (heme). Antisense Nucleic Acid Drug Dev 7, 177-185.
Tamayose K,
Hirai Y, Shimada T (1996) A new
strategy for large-scale preparation of high-titer recombinant adeno-associated
virus vectors by using packaging cell lines and sulfonated cellulose column
chromatography. Hum Gene Ther 7,
507-513.
Tamura H,
Schild L, Enomoto N, Matsui N, Marumo F, Rossier BC (1996) Liddle disease caused by a missense mutation of b subunit of
the epithelial sodium channel gene. J
Clin Invest 97, 1780-1784.
Tartaglia
LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA,
Clark FT, Deeds J, et al (1995)
Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263-1271.
Tatulain
SA, Hinterdorfer P, Baber G, Tamm LK (1995)
Influenza hemagglutinin assumes a tilted conformation during membrane fusion as
determined by attenuated total reflection FTIR spectroscopy. EMBO J 14, 5514-5523.
Templeton
NS, Lasic DD, Frederik PM, Strey HH, Roberts DD, Pavlakis GN (1997) Improved DNA: liposome complexes
for increased systemic delivery and gene expression. Nat Biotechnol 15, 647-652.
Tepper RI,
Pattengale PK, Leder P (1989) Murine
Interleukin-4 displays potent anti-tumor activity in vitro. Cell 57, 503-512.
Thierry AR
and Dritschilo A (1992)
Intracellular availability of unmodified, phosphorothioated and liposomally
encapsulated oligodeoxynucleotides for antisense activity. Nucleic Acids Res 20, 5691-5698.
Thierry AR,
Lunardi-Iskandar Y, Bryant JL, Rabinovitch P, Gallo RC, and Mahan LC (1995) Systemic gene therapy:
biodistribution and long-term expression of a transgene in mice. Proc Natl Acad Sci USA 92, 9742-9746.
Thompson L
(1992) At age 2, gene therapy enters
a growth phase. Science 258,
744-746.
Thompson, E.M., Christians, E., Stinnakre, M.G., and
Renard, J.P. (1994) Scaffold attachment regions stimulate
HSP70.1 expression in mouse preimplantation embryos but not in differentiated
tissues. Mol Cell Biol 14,
4694-4703.
Thut CJ, Chen J-L, Klemm R, and Tjian R (1995) p53 transcriptional activation
mediated by coactivators TAFII40 and TAFII60. Science 267, 100-104.
Tischer E,
Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, and Abraham JA (1991) The human gene for vascular
endothelial growth factor. Multiple protein forms are encoded through
alternative exon splicing. J Biol Chem
266, 11947-11954.
Tomita N,
Morishita R, Higaki J, Aoki M, Nakamura Y, Mikami H, Fukamizu A, Murakami K,
Kaneda Y, Ogihara T (1995) Transient
decrease in high blood pressure by in vivo transfer of antisense
oligodeoxynucleotides against rat angiotensinogen. Hypertension 26, 131-136.
Tomita N,
Morishita R, Higaki J, Tomita S, Aoki M, Ogihara T, Kaneda Y (1996) In vivo gene transfer of insulin
gene into neonatal rats by the HVJ-liposome method resulted in sustained
transgene expression. Gene Ther 3,
477-482.
Troelstra
C, van Gool A, de Wit J, Vermeulen W, Bootsma D and Hoeijmakers JHJ (1992) ERCC6, a member of a subfamily of putative helicases, is involved
in Cockayne's syndrome and preferential repair of active genes. Cell 71, 939-953.
Trono D,
Feinberg MB, Baltimore D (1989)
HIV-1 Gag mutants can dominantly interfere with the replication of the
wild-type virus. Cell 59, 113-120
Trouche D, Le Chalony C, Muchardt C, Yaniv M, Kouzarides T (1997) RB and hbrm cooperate to repress
the activation functions of E2F1. Proc
Natl Acad Sci USA 94, 11268-11273.
Troy CM,
Stefanis L, Prochiantz A, Greene LA, and Shelanski ML (1996) The contrasting roles of ICE family proteases and
interleukin-1b in apoptosis induced by trophic factor withdrawal and by
copper/zinc superoxide dismutase down-regulation. Proc Natl Acad Sci USA 93, 5635-5640.
Truant R, Xiao H, Ingles J, Greenblatt J (1993) Direct interaction between the
transcriptional activation domain of human p53 and the TATA box-binding
protein. J Biol Chem 268: 2284-2287.
Tsurumi Y,
Kearney M, Chen D, Silver M, Takeshita S, Yang J, Symes JF, Isner JM (1997) Treatment of acute limb ischemia
by intramuscular injection of vascular endothelial growth factor gene. Circulation 96 (9 Suppl):II-II3828.
Tsurumi Y,
Takeshita S, Chen D, Kearney M, Rossow ST, Passeri J, Horowitz JR, Symes JF,
Isner JM (1996) Direct intramuscular
gene transfer of naked DNA encoding vascular endothelial growth factor augments
collateral development and tissue perfusion. Circulation 94, 3281-3290.
Tsutsumi-Ishi Y, Tadokoro K, Hanaoka F, Tsuchida N (1995) Response of heat shock element
with the human HSP70 promoter to
mutated p53 genes. Cell Growth Differ 6, 1-8.
Tucker,
P.A., Tsernoglou, D., Tucker, A.D., Coenjaerts, F.E.J., Leenders, H., and van
der Vliet, P.C. (1994) Crystal
structure of the adenovirus DNA binding protein reveals a hook-on model for
cooperative DNA binding. EMBO J 13,
2994-3002.
Tursz T,
Cesne AL, Baldeyrou P, Gautier E, Opolon P, Schatz C, Pavirani A, Courtney M,
Lamy D, Ragot T, Saulnier P, Andremont A, Monier R, Perricaudet M, Le Chevalier
T (1996) Phase I study of a
recombinant adenovirus-mediated gene transfer in lung cancer patients. J Natl Cancer Inst 88, 1857-1863.
Uchiyama et
al, (1993) Transfection of
interleukin 2 gene into human melanoma cells augments cellular immune response.
Cancer Res 53, 949-952.
Ueda K,
Cardarelli C, Gottesman MM and Pastan I (1987) Expression of a full-length cDNA
for the human ÒMDR1Ó gene confers resistance
to colchicine, doxorubicin, and vinblastine. Proc. Natl. Acad. Sci. USA 84, 3004-3008.
Ueno H, Masuda S, Nishio S, Li JJ, Yamamoto H, Takeshita A (1997a) Adenovirus-mediated transfer of
cyclin-dependent kinase inhibitor-p21 suppresses neointimal formation in the
balloon-injured rat carotid arteries in vivo. Ann N Y Acad Sci 811, 401-411.
Ueno H,
Yamamoto H, Ito S, Li JJ, Takeshita A (1997b)
Adenovirus-mediated transfer of a dominant-negative H-ras suppresses neointimal
formation in balloon-injured arteries in vivo. Arterioscler Thromb Vasc Biol 17, 898-904.
Ueno NT, Yu
D, Hung MC (1997) Chemosensitization
of HER-2/neu-overexpressing human breast cancer cells to paclitaxel (Taxol) by
adenovirus type 5 E1A. Oncogene 15,
953-960.
Upadhyay S,
Li G, Liu H, Chen YQ, Sarkar FH, Kim H-R (1995)
bcl-2 suppresses expression of p21WAF1/CIP1 in breast epithelial cells. Cancer Res 55, 4520-4524.
Urashima M,
Ogata A, Chauhan D, Vidriales MB, Teoh G, Hoshi Y, Schlossman RL, DeCaprio JA,
Anderson KC (1996) Interleukin-6
promotes multiple myeloma cell growth via phosphorylation of retinoblastoma
protein. Blood 88, 2219-2227.
Van Belle
E, Tio FO, Chen D, Maillard L, Chen D, Kearney M, Isner JM (1997) Passivation of metallic stents
after arterial gene transfer of phVEGF165 inhibits thrombus formation and
intimal thickening. J Am Coll Cardiol
29, 1371-1379.
Van
Beusechem VW, Valerio D (1996) Gene transfer into hematopoietic stem
cells of nonhuman primates. Hum Gene
Ther 7, 1649-1668.
van den
Heuvel SJL, van Laar T, Kast WM, Melief CJM, Zantema A, van der Eb AJ (1990) Association between the cellular
p53 and the adenovirus 5 E1B-55kd proteins reduces the oncogenicity of
Ad-transformed cells. EMBO J 9,
2621-2629.
van Gent
DC, Mizuuchi K, Gellert M (1996) Similarities between initiation of V(D)J
recombination and retroviral integration. Science 271, 1592-1594.
Van Heek M,
Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, Sybertz EJ, Strader
CD, Davis HR Jr (1997) Diet-induced
obese mice develop peripheral, but not central, resistance to leptin. J Clin Invest 99, 385-390.
Vanin EF,
Cerruti L, Tran N, Grosveld G, Cunningham JM, Jane SM (1997) Development of high-titer retroviral producer cell lines by
using Cre-mediated recombination. J
Virol 71, 7820-7826.
Vassalli
J-D, Saurat J-H (1996) Cuts and
scrapes? Plasmin heals! Nature Med
2, 284-285.
Velculescu
VE, Zhang L, Vogelstein B, Kinzler KW (1995)
Serial analysis of gene expression. Science
270, 484-487.
Venkatesh
LK, Arens MQ, Subramanian T, Chinnadurai G (1990) Selective induction of toxicity to human cells expressing
human immunodeficiency virus type 1 Tat by a conditionally cytotoxic adenovirus
vector. Proc Natl Acad Sci USA 87,
8746-8750.
Veres G,
Escaich S, Baker J, Barske C, Kalfoglou C, Ilves H, Kaneshima H, Bohnlein E (1996) Intracellular expression of RNA
transcripts complementary to the human immunodeficiency virus type 1 gag gene
inhibits viral replication in human CD4+ lymphocytes. J Virol 70, 8792-8800.
Verrijzer
CP, Kal AJ, and van der Vliet PC (1990)
The DNA binding domain (POU domain) of the transcription factor Oct-1 suffices
for stimulation of DNA replication. EMBO
J. 9, 1883-1888.
Vierboom
MP, Nijman HW, Offringa R, van der Voort EI, van Hall T, van den Broek L,
Fleuren GJ, Kenemans P, Kast WM, Melief CJ (1997) Tumor eradication by wild-type p53-specific cytotoxic T
lymphocytes. J Exp Med 186, 695-704.
Vieweg J,
Boczkowski D, Roberson KM, Edwards DW, Philip M, Philip R, Rudoll T, Smith C,
Robertson C, and Gilboa E (1995)
Efficient gene transfer with adeno-associated virus-based plasmids complexed to
cationic liposomes for gene therapy of human prostate cancer. Cancer Res 55, 2366-2372.
Vieweg J,
Rosenthal F, Bannerji R, Heston W, Fair W, Gansbacher B, and Gilboa E (1994) Immunotherapy of prostate cancer
in the Dunning rat model: Use of cytokine gene modified tumor vaccines. Cancer Res 54: 1760-1765.
Vikkula M,
Boon LM, Carraway III KL, Calvert JT, Diamonti AJ, Goumnerov B, Pasyk KA,
Marchuk DA, Warman ML, Cantley LC, Mulliken JB, and Olsen BR (1996) Vascular dysmorphogenesis caused
by an activating mutation in the receptor tyrosine kinase TIE2. Cell 87, 1181-1190.
Vile RG and
Russell SJ (1995) Retroviruses as
vectors. Br Med Bull 51, 12-30.
Villarreal
FJ, Lee AA, Dillmann WH, Giordano FJ (1996)
Adenovirus-mediated overexpression of human transforming growth factor-b1 in rat
cardiac fibroblasts, myocytes and smooth muscle cells. Mol Cell Cardiol 28, 735-742.
Vincent AJ,
Esandi MC, Avezaat CJ, Vecht CJ, Sillevis Smitt P, van Bekkum DW, Valerio D,
Hoogerbrugge PM, Bout A (1997)
Preclinical testing of recombinant adenoviral herpes simplex virus-thymidine
kinase gene therapy for central nervous system malignancies. Neurosurgery 41, 442-451.
Voeller HJ,
Sugars LY, Pretlow T, and Gelmann EP (1994)
p53 mutations in human prostate cancer specimens. J Urol 151, 492-495.
Vogelstein B (1990)
A deadly inheritance. Nature 348,
681-682.
Vogelstein B and Kinzler K (1992) p53 function and dysfunction. Cell 70: 523-526.
von der
Leyden HE, Gibbons GH, Morishita R, Lewis NP, Zhang L., Nakajima M, Kaneda Y,
Cooke JP, and Dzau VJ (1995) Gene
therapy inhibiting neointimal vascular lesion: in vivo transfer of endothelial cell nitric oxide synthase gene. Proc Natl Acad Sci USA 92, 1137-1141.
Wachtel SR,
Bencsics C, Kang UJ (1997) Role of
aromatic L-amino acid decarboxylase for dopamine replacement by genetically
modified fibroblasts in a rat model of Parkinson's disease. Neurochem 69, 2055-2063.
Wagner AJ,
Kokontis JM, and Hay N (1994)
Myc-mediated apoptosis requires wild-type p53 in a mannert independent of cell
cycle arrest and ability of p53 to induce p21waf1/cip1.
Genes Dev 8, 2817-2830.
Wagner E,
Cotten M, Foisner R, Birnstiel ML (1991)
Transferrin-polycation-DNA complexes: The effect of polycations on the
structure of the complex and DNA delivery to cells. Proc Natl Acad Sci USA 88, 4255-4259.
Wagner E,
Plank C, Zatloukal K, Cotten M, and Birnstiel ML (1992a) Influenza virus hemagglutinin HA-2 N-terminal fusogenic
peptides augment gene transfer by transferrin-polylysine-DNA complexes: Toward
a synthetic virus-like gene-transfer vehicle. Proc Natl Acad Sci USA 89, 7934-7938.
Wagner E,
Zatloukal K, Cotten M, Kirlappos H, Mechtler K, Curiel DT, and Birnstiel ML (1992b) Coupling of adenovirus to
tranferrin-polylysine/DNA complexes greatly enhances receptor-mediated gene
delivery and expression of transfected genes. Proc Natl Acad Sci USA 89, 6099-6103.
Walsh CE,
Nienhuis AW, Samulski RJ, Brown MG, Miller JL, Young NS, and Liu JM (1994) Phenotypic correction of Fanconi
anemia in human hematopoietic cells with a recombinant adeno-associated virus
vector . J Clin Invest 94,
1440-1448.
Wang B,
Ugen KE, Srikantan V, Agadjanyan MG, Dang K, Refaeli Y, Sato AI, Boyer J,
Williams WV, Weiner DB (1993) Gene
inoculation generates immune responses against human immunodeficiency virus
type 1. Proc Natl Acad Sci USA 90,
4156-4160.
Wang C-Y
and Huang L (1987) pH-sensitive
immunoliposomes mediate target-cell-specific delivery and controlled expression
of a foreign gene in mouse. Proc Natl
Acad Sci USA 84, 7851-7855.
Wang EH, Friedman PN, Prives C (1989) The murine p53 protein blocks replication of SV40 DNA in
vitro by inhibiting the initiation functions of SV40 large T antigen. Cell 57, 379-392.
Wang J, Kim
H-H, Yuan X, and Herrin DL (1997)
Purification, biochemical characterization and protein-DNA interactions of the
I-CreI endonuclease produced in Escherichia
coli. Nucleic Acids Res 25,
3767-3776.
Wang JM,
Zheng H, Blaivas M, Kurachi K (1997)
Persistent systemic production of human factor IX in mice by skeletal
myoblast-mediated gene transfer: feasibility of repeat application to obtain
therapeutic levels. Blood 90,
1075-1082.
Wang L,
Zoppe M, Hackeng TM, Griffin JH, Lee KF, Verma IM (1997) A factor IX-deficient mouse model for hemophilia B gene
therapy. Proc Natl Acad Sci USA 94,
11563-11566.
Wang NP, To
H, Lee WH, Lee EY (1993) Tumor
suppressor activity of RB and p53 genes in human breast carcinoma cells. Oncogene 8, 279-288.
Wang S and
Vos J-M (1996) A hybrid herpesvirus
infectious vector based on Epstein-Barr virus and Herpes Simplex virus type 1
for gene transfer into human cells in vitro and in vivo. J Virol 70, 8422-8430.
Wang X,
Zelenski NG, Yang J, Sakai J, Brown MS, Goldstein JL (1996) Cleavage of
sterol regulatory element binding proteins (SREBPs) by CPP32 during apoptosis. EMBO J 15, 1012-1020.
Wang Y and
Becker D (1997) Antisense targeting
of basic fibroblast growth factor and fibroblast growth factor receptor-1 in
human melanomas blocks intratumoral angiogenesis and tumor growth. Nat Med 3, 887-893.
Wang Y,
O'Malley BW Jr, Tsai SY, O'Malley BW (1994)
A regulatory system for use in gene transfer. Proc Natl Acad Sci USA 91, 8180-8184.
Wang Z-Q,
Auer B, Sting L, Berghammer H, Haidacher D, Schweiher M, and Wagner EF (1995) Mice lacking ADPRT and
poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev 9, 509-520.
Ward M,
Richardson C, Piuoli P, Smith L, Podda S, Goff S, Hesdorffer C, and Bank A (1994) Transfer and expression of the
human multiple drug resistance gene in human CD34+ cells. Blood 84, 1408-1414.
Wattiaux R,
Jadot M, Warnier-Pirotte MT, Wattiaux-De Coninck S (1997) Cationic lipids destabilize lysosomal membrane in vitro. FEBS Lett 417, 199-202.
Webb A,
Cunningham D, Cotter F, Clarke PA, di Stefano F, Ross P, Corbo M, Dziewanowska
Z (1997) BCL-2 antisense therapy in
patients with non-Hodgkin lymphoma.
Lancet 349, 1137-1141.
Webster MK
and Donoghue DJ (1998) Constitutive
activation of fibroblast growth factor receptors in human developmental
syndromes. Gene Ther Mol Biol 1,
365-379.
Weih F,
Ryseck R-P, Chen L, and Bravo R (1996)
Apoptosis of nur77/N10-transgenic
thymocytes involves the Fas/Fas ligand pathway. Proc Natl Acad Sci USA
93, 5533-5538.
Weir L,
Chen D, Pastore C, Isner JM, Walsh K (1995)
Expression of gax, a growth arrest homeobox gene, is rapidly down-regulated in
the rat carotid artery during the proliferative response to balloon injury. J Biol Chem 270, 5457-5461.
Weiss DJ,
Liggitt D, Clark JG (1997) In situ
histochemical detection of b-galactosidase
activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene
expression and endogenous b-galactosidase
activity. Hum Gene Ther 8,
1545-1554.
Weitzman
MD, Fisher KJ, Wilson JM (1996)
Recruitment of wild-type and recombinant adeno-associated virus into adenovirus
replication centers. J Virol 70,
1845-1854.
Werness BA, Levine AJ, Howley PM (1990) Association of human papillomavirus types 16 and 18 E6
proteins with p53. Science 248,
76-79.
Westerman
KA, Leboulch P (1996) Reversible
immortalization of mammalian cells mediated by retroviral transfer and
site-specific recombination. Proc Natl
Acad Sci USA 93, 8971-8976.
White EM,
Allis CD, Goldfarb DS, Srivastva A, Weir JW, and Gorovsky MA: Nucleus-specific
and temporally restricted localization of proteins in Tetrahymena macronuclei and micronuclei. J Cell Biol 109:
1983-1992, 1989.
White RJ (1998) Control of growth and
proliferation by the retinoblastoma protein. Gene Therapy Mol Biol 1, 613-628.
White, E. (1993)
Death-defying acts: a meeting review on apoptosis. Genes Dev. 7, 2277-2284.
Whyte, P.,
Buchkovich, K.J., Horowitz, J.M., Friend, S.H., Raybuck, M., Weinberg, R.A. and
Harlow, E. (1988) Association between an oncogene and an
anti-oncogene: the adenovirus E1A proteins bind to the retinoblastoma gene
product. Nature 334, 124-129.
Wieder R,
Wang H, Shirke S, Wang Q, Menzel T, Feirt N, Jakubowski AA, Gabrilove JL (1997) Low level expression of basic FGF
upregulates Bcl-2 and delays apoptosis, but high intracellular levels are
required to induce transformation in NIH 3T3 cells. Growth Factors 15, 41-60.
Wilcock D and Lane DP (1991)
Localization of p53, retinoblastoma and host replication proteins at sites of
viral replication in herpes-infected cells. Nature 349, 429-431.
Will K and Deppert W (1998)
Analysis of mutant p53 for MAR-DNA binding: determining the dominant-oncogenic
function of mutant p53. Gene Ther Mol
Biol Vol 1, 543-549.
Will K,
Warnecke G, Albrechtsen N, Boulikas T, and Deppert W (1998) High affinity MAR/SAR-binding is a common property of murine
and human mutant p53. J Cell Biochem In
press
Williams
SA, Chang L, Buzby JS, Suen Y, Cairo MS (1996)
Cationic lipids reduce time and dose of c-myc antisense oligodeoxynucleotides
required to specifically inhibit Burkitt's lymphoma cell growth. Leukemia 10, 1980-1989.
Wills KN,
Maneval DC, Menzel P, Harris MP, Sutjipto S, Vaillancourt M-T, Huang W-M,
Johnson DE, Anderson SC, Wen SF, Bookstein R, Shepard HM, Gregory RJ (1994) Development and characterization
of recombinant adenoviruses encoding human p53 for gene therapy of cancer. Hum Gene Ther 5, 1079-1088.
Wilson C, Bellen HJ and
Gehring WJ (1990) Position effects on eukaryotic gene
expression. Annu Rev Cell Biol 6, 679-714.
Wilson JM (1995) Gene therapy for cystic fibrosis:
challenges and future directions. J Clin Invest 96, 2547-2554.
Wilson JM,
Danos O, Grossman M, Raulet DH, Mulligan RC (1990) Expression of human adenosine deaminase inmice reconstituted
with retrovirus-transduced hematopoietic stem cells. Proc Natl Acad Sci USA 87, 439-443.
Wilson JM,
Grossman M, Raper SE, Baker JR, Newton RS, and Thoene JG (1992) Clinical protocol. Ex
vivo gene therapy of familial hypercholesterolemia. Hum Gene Ther 3, 179-222.
Wiltrout
RH, Gregorio TA, Fenton RG, Longo DL, Ghosh P, Murphy WJ, Komschlies KL (1995) Cellular and molecular studies
in the treatment of murine renal cancer. Semin
Oncol 22, 9-16.
Witte ON
and Baltimore D (1977) Mechanism of
formation of pseudotypes between vesicular stomatitis virus and murine leukemia
virus. Cell 11, 505-511.
Wolfe JH,
Sands MS, Barker JE, Gwynn B, Rowe LB, Vogler CA, and Birkenmeier EH (1992) Reversal of pathology in murine
mucopolysaccharidosis type VII by somatic cell gene transfer. Nature 360, 749-753.
Wolff JA,
Fisher LJ, Xu L, Jinnah HA, Langlais PJ, Iuvone PM, O'Malley KL, Rosenberg MB,
Shimohama S, Friedmann T, Gage FH (1989)
Grafting fibroblasts genetically modified to produce L-dopa in a rat model of
Parkinson disease. Proc Natl Acad Sci
USA 86, 9011-9014.
Wu P, de
Fiebre CM, Millard WJ, King MA, Wang S, Bryant SO, Gao YP, Martin EJ, Meyer EM
(1996) An AAV promoter-driven
neuropeptide Y gene delivery system using Sendai virosomes for neurons and rat
brain. Gene Ther 3, 246-253.
Wu X and
Levine AJ (1994) p53 and E2F-1
cooperate to mediate apoptosis. Proc
Natl Acad Sci USA 91, 3602-3606.
Wyman TB,
Nicol F, Zelphati O, Scaria PV, Plank C, Szoka FC Jr (1997) Design, synthesis, and characterization of a cationic peptide
that binds to nucleic acids and permeabilizes bilayers. Biochemistry 36, 3008-3017.
Xiao H,
Pearson A, Coulombe B, Truant R, Zhang S, Regier JL, Triezenberg SJ, Reinberg
D, Flores O, Ingles CJ, Greenblatt J (1994)
Binding of basal transcription factor TFIIH to the acidic activation domains of
VP16 and p53. Mol Cell Biol 14,
7013-7024.
Xiao X,
Xiao W, Li J, Samulski RJ (1997) A
novel 165-base-pair terminal repeat sequence is the sole cis requirement for
the adeno-associated virus life cycle. J
Virol 71, 941-948.
Xing X, Liu
V, Xia W, Stephens LC, Huang L, Lopez-Berestein G, Hung MC (1997) Safety studies of the
intraperitoneal injection of E1A--liposome complex in mice. Gene Ther 4, 238-243.
Xing Z,
Tremblay GM, Sime PJ, Gauldie J (1997)
Overexpression of granulocyte-macrophage colony-stimulating factor induces
pulmonary granulation tissue formation and fibrosis by induction of
transforming growth factor-b1 and
myofibroblast accumulation. Am J Pathol
150, 59-66.
Yamamoto R, Murakami K,
Taira K, and Kumar PKR (1998)
Isolation and characterization of an RNA that binds with high affinity to Tat
protein of HIV-1 from a completely random pool of RNA. Gene Ther Mol Biol 1, 451-466.
Yamamoto S,
Suzuki S, Hoshino A, Akimoto M, Shimada T (1997)
Herpes simplex virus thymidine kinase/ganciclovir-mediated killing of tumor
cell induces tumor-specific cytotoxic T cells in mice. Cancer Gene Ther 4, 91-96.
Yamanaka S,
Balestra ME, Ferrell LD, Fan J, Arnold KS, Taylor S, Taylor JM, Innerarity TL (1995) Apolipoprotein B mRNA-editing
protein induces hepatocellular carcinoma and dysplasia in transgenic animals. Proc Natl Acad Sci USA 92, 8483-8487.
Yang AG,
Bai X, Huang XF, Yao C, Chen S (1997)
Phenotypic knockout of HIV type 1 chemokine coreceptor CCR-5 by intrakines as
potential therapeutic approach for HIV-1 infection. Proc Natl Acad Sci USA 94, 11567-11572.
Yang C, Cirielli C, Capogrossi MC, and Passaniti A (1995) Adenovirus-mediated wild-type p53
expression induces apoptosis and suppresses tumorigenesis of prostatic tumor
cells. Cancer Res 55, 4210-4213.
Yang CC,
Xiao X, Zhu X, Ansardi DC, Epstein ND, Frey MR, Matera AG, Samulski RJ (1997) Cellular recombination pathways
and viral terminal repeat hairpin structures are sufficient for
adeno-associated virus integration in vivo and in vitro. J Virol 71, 9231-9247.
Yang JP and
Huang L (1997) Overcoming the
inhibitory effect of serum on lipofection by increasing the charge ratio of
cationic liposome to DNA. Gene Ther
4, 950-960.
Yang Y, Li
Q, Ertl HC, and Wilson JM (1995)
Cellular and humoral immune responses to viral antigens create barriers to
lung-directed gene therapy with recombinant adenoviruses. J Virol 69, 2004-2015.
Yang Y,
Nunes FA, Berencsi K, Furth EE, Gonczol E, and Wilson JM (1994a) Cellular immunity to viral antigens limits E1-deleted
adenoviruses for gene therapy. Proc Natl
Acad Sci USA 91, 4407-4411.
Yang Y,
Nunes FA, Berencsi K, Gonczol E, Engelhardt JF, Wilson JM (1994b) Inactivation of E2a in recombinant adenoviruses improves the
prospect for gene therapy in cystic fibrosis. Nat Genet 7, 362-369.
Yang Y,
Vanin EF, Whitt MA, Fornerod M, Zwart R, Schneiderman RD, Grosveld G, Nienhuis
AW (1995) Inducible, high-level
production of infectious murine leukemia retroviral vector particles
pseudotyped with vesicular stomatitis virus G envelope protein. Hum Gene Ther 6, 1203-1213.
Yang Z-Y,
Perkins ND, Ohno T, Nabel EG, Nabel GJ (1995)
The p21 cyclin-dependent kinase inhibitor suppresses tumorigenicity in vivo. Nature Med 1, 1052-1056.
Yang ZY, Simari RD, Perkins ND, San H, Gordon D, Nabel GJ,
Nabel EG (1996) Role of the p21
cyclin-dependent kinase inhibitor in limiting intimal cell proliferation in
response to arterial injury. Proc Natl
Acad Sci USA 93, 7905-7910.
Yanofsky
SD, Baldwin DN, Butler JH, Holden FR, Jacobs JW, Balasubramanian P, Chinn JP,
Cwirla SE, Peters-Bhatt E, Whitehorn EA, Tate EH, Akeson A, Bowlin TL, Dower
WJ, Barrett RW (1996) High affinity
type I interleukin 1 receptor antagonists discovered by screening recombinant
peptide libraries. Proc Natl Acad Sci
USA 93, 7381-7386.
Yao SN,
Smith KJ, Kurachi K (1994) Primary
myoblast-mediated gene transfer: persistent expression of human factor IX in
mice. Gene Ther 1, 99-107.
Yee JK,
Miyanohara A, LaPorte P, Bouic K, Burns JC, Friedmann T (1994) A general method for the generation of high-titer, pantropic
retroviral vectors: highly efficient infection of primary hepatocytes. Proc Natl Acad Sci USA 91, 9564-9568.
Yew NS,
Wysokenski DM, Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W,
Cheng SH (1997) Optimization of
plasmid vectors for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584.
Yew PR and
Berk AJ (1992) Inhibition of p53
transactivation required for transformation by adenovirus early 1B protein. Nature 357, 82-85.
YlŠ-Herttuala
S (1996) Gene therapy for
cardiovascular diseases. Ann Med 28,
89-93.
Yokoyama Y, Takahashi Y, Morishita S, Hashimoto M, Tamaya T
(1997) Introduction of
p21(Waf1/Cip1) gene into a carcinoma cell line of the uterine cervix with
inactivated p53. Cancer Lett 116,
233-239.
Yonish-Rouach E, Grunwald D, Wilder S, Kimchi A, May E,
Lawrence J-J, May P, and Oren M (1993)
p53-mediated cell death: relationship to cell cycle control. Mol Cell Biol 13, 1415-1423.
Yoshimura
K, Rosenfeld MA, Nakamura H, Scherer EM, Pavirani A, Lecocq J-P, Crystal RG (1992) Expression of the human cystic
fibrosis transmembrane conductance regulator gene in the mouse lung after in vivo intratracheal plasmid-mediated
gene transfer. Nucleic Acids Res 30,
3233-3240.
Youdim MBH
and Riederer P (1997) Understanding
ParkinsonÕs disease. Scientific Am.
Jan 1997, 52-59.
Yovandich
J, O'Malley Jr B, Sikes M, Ledley FD (1995)
Gene transfer to synovial cells by intra-articular administration of plasmid
DNA. Hum Gene Ther 6, 603-610.
Yu D, Matin
A, Xia W, Sorgi F, Huang L, Hung MC (1995)
Liposome-mediated in vivo E1A gene transfer suppressed dissemination of ovarian
cancer cells that overexpress HER-2/neu.
Oncogene 11, 1383-1388.
Yuan J,
Shaham S, Ledoux S, Ellis HM, and Horvitz HR (1993) The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1b-converting
enzyme. Cell 75, 641-652.
Yung WK (1994) New approaches to molecular
therapy of brain tumors. Curr Opin
Neurol 7, 501-505.
Zabner J,
Cheng SH, Meeker D, Launspach J, Balfour R, Perricone MA, Morris JE, Marshall
J, Fasbender A, Smith AE, Welsh MJ (1997)
Comparison of DNA-lipid complexes and DNA alone for gene transfer to cystic
fibrosis airway epithelia in vivo. J
Clin Invest 100, 1529-1537.
Zacksenhaus
E, Gill RM, Phillips RA, Gallie BL (1993)
Molecular cloning and characterization of the mouse RB1 promoter. Oncogene 8, 2343-2351.
Zaitsev SV,
Haberland A, Otto A, Vorob'ev VI, Haller H, Bottger M (1997) H1 and HMG17 extracted from calf thymus nuclei are efficient
DNA carriers in gene transfer. Gene Ther
4, 586-592.
Zakrzewska
KE, Cusin I, Sainsbury A, Rohner-Jeanrenaud F, Jeanrenaud B (1997) Glucocorticoids as
counterregulatory hormones of leptin: toward an understanding of leptin
resistance. Diabetes 46, 717-719.
Zambetti GP and Levine AJ (1993) A comparison of the biological activities of wild-type and
mutant p53. FASEB J 7, 855-865.
Zambetti GP, Bargonetti J, Walker K, Prives C, Levine AJ (1992) Wild-type p53 mediates positive
regulation of gene expression through a specific DNA sequence element. Genes Dev 6, 1143-1152.
Zardo G,
Marenzi S and Caiafa P (1998)
Correlation between DNA methylation and poly(ADP-ribosyl)ation processes. Gene Ther Mol Biol 1, 661-679.
Zaretsky JZ, Candotti F, Boerkoel C, Adams EM, Yewdell JW,
Blaese RM, Plotz PH (1997)
Retroviral transfer of acid a-glucosidase
cDNA to enzyme-deficient myoblasts results in phenotypic spread of the
genotypic correction by both secretion and fusion. Hum Gene Ther 8, 1555-1563.
Zastawny RL, Salvino R, Chen J, Benchimol S, Ling V (1993) The core promoter region of the
P-glycoprotein gene is sufficient to confer differential responsiveness to
wild-type and mutant p53. Oncogene
8, 1529-1535.
Zatloukal
K, Cotten M, Berger M, Schimdt W, Wagner E, Birnstiel ML (1994) In vivo production
of human factor VIII in mice after intrasplenic implantation of primary
fibroblasts transfected by receptor-mediated, adenovirus-augmented gene
delivery. Proc Natl Acad Sci USA 91,
5148-5152.
Zelphati O,
Szoka FC Jr (1997) Intracellular
distribution and mechanism of delivery of oligonucleotides mediated by cationic
lipids. Pharm Res 13, 1367-1372.
Zennaro MC,
Farman N, Bonvalet JP, Lombes M (1997)
Tissue-specific expression of a and b messenger
ribonucleic acid isoforms of the human mineralocorticoid receptor in normal and
pathological states. J Clin Endocrinol
Metab 82, 1345-1352.
Zhang H, Yang
Y, Horton JL, Samoilova EB, Judge TA, Turka LA, Wilson JM, Chen Y (1997) Amelioration of collagen-induced
arthritis by CD95 (Apo-1/Fas)-ligand gene transfer. J Clin Invest 100,
1951-1957.
Zhang JF,
Hu C, Geng Y, Blatt LM, Taylor MW (1996)
Gene therapy with an adeno-associated virus carrying an interferon gene results
in tumor growth suppression and regression.
Cancer Gene Ther 3, 31-38.
Zhang LX,
Wu M, Han JS (1992) Suppression of
audiogenic epileptic seizures by intracerebral injection of a CCK gene vector. Neuroreport 3, 700-702.
Zhang W-W,
Alemany R, Wang J, Koch PE, Ordonez NG, Roth JA (1995) Safety evaluation of Ad5CMV-p53 in vitro and in vivo.
Hum Gene Ther 6, 155-164.
Zhang WW,
Fang X, Mazur W, French BA, Georges RN, Roth JA (1994) High-efficiency gene transfer and high-level expression of
wild-type p53 in human lung cancer cells mediated by recombinant adenovirus. Cancer Gene Ther 1, 5-13.
Zhang XY,
Ni YS, Saifudeen Z, Asiedu CK, Supakar PC, Ehrlich M (1995) Increasing binding of a transcription factor immediately
downstream of the cap site of a cytomegalovirus gene represses expression. Nucleic Acids Res 23, 3026-3033.
Zhang Y,
Proenca R, Maffei M, Barone M, Leopold L, Friedman JM (1994) Positional
cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.
Zhao JE,
Lochumuller H, Nalbantoglu J, Allen C, Prescott S, Massie B, Karpati G (1997) Study of adenovirus-mediated
dystrophin minigene transfer to skeletal muscle by combined microscopic display
of adenoviral DNA and dystrophin. Hum
Gene Ther 8, 1565-1573.
Zhao S-C,
Banerjee D, Mineishi S, and Bertino JR (1997)
Post-transplant methotrexate administration leads to improved curability of
mice bearing a mammary tumor transplanted with marrow transduced with a mutant
human dihydrofolate reductase cDNA. Hum
Gene Ther 8, 903-909.
Zhonghe,
Z., Nickerson, J.A., Krochmalnic, G., and Penman, S. (1987) Alterations in nuclear matrix structure after adenovirus
infection. J Virology 61, 1007-1018.
Zhou H,
Zeng G, Zhu X, Tang J, Chen G, Huang Q, Peng T, Hu B (1995) Enhanced
adeno-associated virus vector expression by adenovirus protein-cationic
liposome complex. A novel and high efficient way to introduce foreign DNA into
endothelial cells. Chin Med J (Engl)
108, 332-337.
Zhou P,
Goldstein S, Devadas K, Tewari D, Notkins AL (1997) Human CD4+ cells transfected with IL-16 cDNA are
resistant to HIV-1 infection: inhibition of mRNA expression. Nat Med 3, 659-664.
Zhou SZ, Li
Q, Stamatoyannopoulos G, Srivastava A (1996)
Adeno-associated virus 2-mediated transduction and erythroid cell-specific
expression of a human b-globin
gene. Gene Ther 3, 223-229.
Zhu C,
Bogue MA, Lim D-S, Hasty P, Roth DB (1996)
Ku86-deficient mice exhibit severe combined immunodeficiency and defective
processing of V(D)J recombination intermediates. Cell 86, 379-389.
Zhu N,
Liggitt D, Liu Y, and Debs R (1993)
Systemic gene expression after intravenous DNA delivery into adult mice. Science 261, 209-211.
Zhu NL, Wu
L, Liu PX, Gordon EM, Anderson WF, Starnes VA, Hall FL (1997) Downregulation of cyclin G1 expression by retrovirus-mediated
antisense gene transfer inhibits vascular smooth muscle cell proliferation and
neointima formation. Circulation 96,
628-635.
Zhu Y,
Carroll M, Papa FR, Hochstrasser M, and D'Andrea AD (1996) DUB-1, a
deubiquitinating enzyme with growth-suppressing activity. Proc Natl Acad Sci USA 93, 3275-3279.
Ziegler A,
Jonason AS, Leffell DJ, Simon JA, Sharma HW, Kimmelman J, Remington L, Jacks T,
and Brash DE (1994) Sunburn and p53
in the onset of skin cancer. Nature
372, 773-776.
Zou Z,
Anisowicz A, Hendrix MJC, Thor A, Neveu M, SHeng S, Rafidi K, Seftor E, Sager R
(1994) Maspin, a serpin with
tumor-suppressing acivity in human mammary epithelial cells. Science 263, 526-529.
Zufferey R,
Nagy D, Mandel RJ, Naldini L, Trono D (1997)
Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15, 871-875.
Zuidam NJ,
Barenholz Y (1997) Electrostatic
parameters of cationic liposomes commonly used for gene delivery as determined
by 4-heptadecyl-7-hydroxycoumarin. Biochim
Biophys Acta 1329, 211-222.
Appendix
1. RAC-approved human gene therapy protocols
Using retrovirus, protocols:
1-117
Using adenovirus: 118-157
With naked plasmid: 158-164
Adeno-Associated virus: 165,
166
Immunotherapy or other:
167-186
Cationic lipids: 187-220 on
page 203-206 of following article (Martin and Boulikas, 1998)
(Last updated: 21 November
1997)
|
RETROVIRAL GENE DELIVERY |
|
|
|
|
Disease |
Protocol
title |
Procedures |
Principal investigator
|
|
1.
Gene Marking /Cancer |
The
Treatment of Patients with Advanced Cancer Using Cyclophosphamide,
Interleukin-2 and Tumor Infiltrating Lymphocytes. |
In Vitro /Tumor Infiltrating Lymphocytes /Retrovirus
/Neomycin Phosphotransferase cDNA /Intravenous |
Rosenberg,
Steven A |
|
2.
Gene Therapy /Phase I /Monogenic Disease /Severe
Combined Immune Deficiency due to Adenosine
Deaminase Deficiency |
Treatment
of Severe Combined Immune Deficiency (SCID) due to Adenosine Deaminase (ADA)
Deficiency with Autologous Lymphocytes Transduced with the Human ADA Gene: An
Experimental Study. |
In Vitro /Autologous
Peripheral Blood Cells /CD34+
Autologous Peripheral Blood Cells /Cord Blood /Placenta Cells /Retrovirus
/Adenosine Deaminase cDNA /Neomycin Phosphotransferase cDNA /Intravenous |
Blaese,
R. Michael |
|
3.
Gene Therapy /Phase I /Cancer /Melanoma /Immunotherapy |
Gene
Therapy of Patients with Advanced Cancer Using Tumor Infiltrating Lymphocytes Transduced with the Gene Coding
for Tumor Necrosis Factor. |
In Vitro /Tumor
Infiltrating Lymphocytes /Retrovirus /Cytokine /Tumor Necrosis Factor cDNA /Neomycin Phosphotransferase cDNA
/Intravenous |
Rosenberg,
Steven A |
|
4.
Gene Marking /Cancer /Acute Myelogenous
Leukemia |
Autologous
Bone Marrow Transplant for Children with Acute Myelogenous Leukemia in First
Complete Remission: Use of Marker Genes to Investigate the Biology of Marrow
Reconstitution and the Mechanism of Relapse. |
In Vitro /Autologous
Bone Marrow Cells /Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow
Transplant |
Brenner,
Malcolm K. |
|
5.
Gene Marking /Cancer /Neuroblastoma |
A Phase I /II Trial of High Dose
Carboplatin and Etoposide with Autologous Marrow Support for Treatment of
Stage D Neuroblastoma in First Remission: Use of Marker Genes to Investigate
the Biology of Marrow Reconstitution and the Mechanism of Relapse. |
In Vitro /Autologous
Bone Marrow Cells /Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow
Transplant |
Brenner,
Malcolm K. |
|
6.
Gene Marking /Cancer /Neuroblastoma |
A Phase
II Trial of High-Dose Carboplatin and Etoposide with Autologous Marrow
Support for Treatment of Relapse /Refractory Neuroblastoma Without Apparent
Bone Marrow Involvement. |
In Vitro /Autologous
Bone Marrow Cells /Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow
Transplant |
Brenner,
Malcolm K |
|
7.
Gene Marking /Cancer /Chronic Myelogenous
Leukemia |
Autologous
Bone Marrow Transplantation for Chronic Myelogenous Leukemia in which
Retroviral Markers are Used to Discriminate between Relapse which Arises from
Systemic Disease Remaining after PreparativeTherapy Versus Relapse due to
Residual Leukemic Cells in Autologous Marrow: A Pilot Trial. |
In Vitro /Autologous
Bone Marrow Cells /Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow
Transplant |
Deisseroth,
Albert B |
|
8.
Gene Marking /Acute Hepatic Failure |
Hepatocellular
Transplantation in Acute Hepatic Failure and Targeting Genetic Markers to
Hepatic Cells. |
In Vitro /Autologous
Hepatocytes /Retrovirus /Neomycin Phosphotransferase cDNA /Intrahepatic |
Ledley,
Fred D. |
|
9.
Gene Marking /Cancer /Melanoma |
The Administration
of Interleukin-2 and Tumor
Infiltrating Lymphocytes to Patients with Melanoma. |
In Vitro /Tumor
Infiltrating Lymphocytes /Retrovirus /Neomycin Phosphotransferase cDNA
/Intravenous |
Lotze,
Michael T |
|
10.
Gene Therapy /Phase I /Cancer /Melanoma /Renal Cell
/Colon /Breast /Immunotherapy |
Immunization
of Cancer Patients Using Autologous Cancer Cells Modified by Insertion of the
Gene for Tumor Necrosis Factor (TNF). |
In Vitro /Autologous
Tumor Cells /Lethally Irradiated /Retrovirus /Cytokine /Tumor Necrosis Factor
cDNA /Neomycin Phosphotransferase cDNA /Subcutaneous Injection |
Rosenberg,
Steven A |
|
11.
Gene Therapy /Phase I /Cancer /Melanoma /Renal Cell
/Colon /Immunotherapy |
Immunization
of Cancer Patients Using Autologous Cancer Cells Modified by Insertion of the
Gene for Interleukin-2 (IL-2).
|
In Vitro /Autologous
Tumor Cells /Lethally Irradiated /Retrovirus /Cytokine /Interleukin-2 cDNA /Subcutaneous Injection |
Rosenberg,
Steven A |
|
12.
Gene Marking /Cancer /Acute Myelogenous Leukemia
/Acute Lymphocytic Leukemia |
Retroviral-Mediated
Gene Transfer of Bone Marrow Cells during Autologous Bone Marrow
Transplantation for Acute Leukemia.
|
In Vitro /Autologous
Bone Marrow Cells /Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow
Transplant |
Cornetta,
Kenneth |
|
13.
Gene Marking /Cancer /Melanoma /Renal Cell |
The
Treatment of Patients with Metastatic Melanoma and Renal Cell Cancer Using In
Vitro Expanded and Genetically-Engineered (Neomycin Phosphotransferase) Bulk,
CD8+ and /or CD4+
Tumor Infiltrating Lymphocytes and
Bulk, CD8+ and /or CD4+ Peripheral Blood Leukocytes in
Combination with Recombinant Interleukin-2 Alone, or with Recombinant
Interleukin-2 and Recombinant a
Interferon. |
In Vitro /CD4+
Autologous Peripheral Blood Lymphocytes /CD8+ Autologous
Peripheral Blood Lymphocytes /CD4+ Autologous Tumor Infiltrating
Lymphocytes /CD8+ Autologous Tumor Infiltrating Lymphocytes
/Retrovirus /Neomycin Phosphotransferase cDNA /Intravenous |
Economou,
James S. and Belldegrun, Arie |
|
14.
Gene Therapy /Phase I /Cancer /Ovarian /Pro-Drug |
Gene
Transfer for the Treatment of Cancer.
|
In Vitro /Allogeneic
Tumor Cells /Lethally Irradiated /PA317 /Retrovirus /Herpes Simplex Virus
Thymidine Kinase cDNA /Ganciclovir /Intraperitoneal Administration |
Freeman,
Scott M |
|
15.
Gene Therapy /Infectious Disease /Human
Immunodeficiency Virus |
Phase I
Study to Evaluate the Safety of Cellular Adoptive Immunotherapy Using
Genetically Modified CD8+ HIV-Specific
T Cells in HIV Seropositive Individuals. |
In Vitro /CD8+
Allogeneic Cytotoxic T Lymphocytes /CD8+ Syngeneic Cytotoxic T
Lymphocytes /Retrovirus /Hygromycin Phosphotransferase /Herpes Simplex Virus
Thymidine Kinase cDNA /Intravenous
|
Greenberg,
Philip D. and Riddell, Stanley |
|
16.
Gene Therapy /Phase I /Cancer /Relapsed-Refractory
Neuroblastoma /Immunotherapy |
Phase I
Study of Cytokine-Gene Modified Autologous Neuroblastoma Cells for Treatment
of Relapsed /Refractory Neuroblastoma.
|
In Vitro /Autologous
Neuroblastoma Cells /Allogeneic Partially HLA-Matched /Retrovirus /Cytokine /Interleukin-2 cDNA /Subcutaneous
Injection |
Brenner,
Malcolm K. |
|
17.
Gene Therapy /Phase I /Cancer /Brain /Pro-Drug |
Gene
Therapy for the Treatment of Brain Tumors Using Intra-Tumoral Transduction
with the Thymidine Kinase Gene and Intravenous Ganciclovir. Sponsor: Genetic Therapy, Inc.
/Novartis |
In Vivo
/Autologous Tumor Cells /PA317 /Retrovirus /Herpes Simplex Virus Thymidine
Kinase cDNA /Ganciclovir /Intratumoral /Stereotactic Injection |
Oldfield,
Edward |
|
18.
Gene Marking /Cancer /Chronic Myelogenous Leukemia |
Use of Two
Retroviral Markers to Test Relative Contribution of Marrow and Peripheral
Blood Autologous Cells to Recovery After Preparative Therapy. |
In Vitro /Autologous
Bone Marrow Cells /Autologous Peripheral Blood Cells /Retrovirus /Neomycin
Phosphotransferase cDNA /Bone Marrow Transplant |
Deisseroth,
Albert B |
|
19.
Gene Therapy /Phase I /Cancer /Melanoma /Immunotherapy |
Immunization
with HLA-A2 matched Allogeneic Melanoma Cells that Secrete Interleukin-2 in
Patients with Metastatic Melanoma.
|
In Vitro /Allogeneic
Partially HLA-Matched /Retrovirus /Cytokine /Interleukin-2 cDNA /Subcutaneous Injection |
Gansbacher,
Bernd |
|
20.
Gene Therapy /Phase I /Cancer /Renal Cell /Immunotherapy |
Immunization
with Interleukin-2 Secreting Allogeneic HLA-A2 Matched Renal Cell Carcinoma
Cells in Patients with Advanced Renal Cell Carcinoma. |
In Vitro /Allogeneic
Partially HLA-Matched /Retrovirus /Cytokine /Interleukin-2 cDNA /Subcutaneous Injection |
Gansbacher,
Bernd |
|
21.
Gene Marking /Cancer /Multiple Myeloma |
Retroviral-Mediated
Gene Transfer of Bone Marrow and Peripheral Blood Stem Cells During
Autologous Bone Marrow Transplantation for Multiple Myeloma. |
In Vitro /CD34+
Autologous Peripheral Blood Cells /Intravenous /Autologous Bone Marrow Cells
/Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow Transplant |
Dunbar,
Cynthia |
|
22.
Gene Marking /Cancer /Breast |
Retroviral-Mediated
Gene Transfer of Bone Marrow and Peripheral Blood Stem Cells During
Autologous Bone Marrow Transplantation for Metastatic Breast Cancer. |
In Vitro /CD34+
Autologous Peripheral Blood Cells /Intravenous /Autologous Bone Marrow Cells
/Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow Transplant |
Dunbar,
Cynthia |
|
23.
Gene Marking /Cancer /Chronic Myelogenous Leukemia |
Retroviral-Mediated
Gene Transfer of Bone Marrow and Peripheral Blood Stem Cells During
Autologous Bone Marrow Transplantation for Chronic Myelogenous Leukemia. |
In Vitro /CD34+
Autologous Peripheral Blood Cells /Intravenous /Autologous Bone Marrow Cells
/Retrovirus /Neomycin Phosphotransferase cDNA /Bone Marrow Transplant |
Dunbar,
Cynthia |
|
24.
Gene Marking /Infectious Disease /Human
Immunodeficiency Virus |
A Study
of the Safety and Survival of the Adoptive Transfer of Genetically Marked
Syngeneic Lymphocytes in HIV
Infected Identical Twins. |
In Vitro /Syngeneic
Peripheral Blood Lymphocytes /Retrovirus /Neomycin Phosphotransferase cDNA
/Intravenous |
Walker,
Robert E |
|
25.
Gene Marking /Cancer |
Study on
Contribution of Genetically Marked Peripheral Blood Repopulating Cells to
Hematopoietic Reconstitution after Transplantation. |