Gene Ther Mol Biol Vol 1, 1-172. March, 1998.
Status of gene therapy in 1997: molecular mechanisms, disease targets,
and clinical applications
Teni Boulikas
Institute
of Molecular Medical Sciences, 460 Page Mill Road, Palo Alto, California 94306
and
Regulon Inc., 249 Matadero Avenue, Palo Alto, CA 94306
__________________________________________________________________________________________________
Correspondence: Teni Boulikas, Regulon Inc., 249 Matadero Avenue,
Palo Alto, CA 94306, Tel (650) 813-9264, Fax: (650) 424-9594, E-mail:
Boulikas@Worldnet.att.net
Key words: gene therapy, gene transfer, clinical trials,
cancer, immunotherapy, p53, adenovirus, retrovirus, adeno-associated virus,
HIV-1, HSV-1, EBV, AIDS, tumor vaccines, IFN-g, TNF-a, VEGF,
retinoblastoma, purine nucleoside phosphorylase, HSV-tk, E1A, E1B, Cre, LoxP,
recombination, HIV vectors, liposomes, fusogenic peptides, plasmovirus,
transcription factor, TIL, IL-2, IL-3, IL-7, IL-12, GM-CSF, prostate cancer,
p21, p16, apoptosis, Bcl-2, Bax, Bcl-xs, E2F, bystander effect, MDR1, IGF-I,
antisense, triplex DNA, ParkinsonÕs disease, lysosomal storage disease,
hemophilia, cystic fibrosis, CFTR, rheumatoid arthritis, hypertension, familial
hypercholesterolemia, LDL, angiopoietin, restenosis, angiogenesis, TGF-b, arterial
injury, atherosclerosis, ADA deficiency, obesity, leptin.
Summary
Gene therapy is a newly emerging field
of biomedical research aimed at introducing therapeutically important genes
into somatic cells of patients; a new and revolutionary era in molecular
medicine has begun. Diseases already shown to be amenable to therapy with gene
transfer in clinical trials include cancer (melanoma, breast, lymphoma, head
& neck, ovarian, colon, prostate, brain, chronic myelogenous leukemia,
non-small cell lung, lung adenocarcinoma, colorectal, neuroblastoma, glioma,
glioblastoma, astrocytoma, and others), AIDS, cystic fibrosis, adenosine
deaminase deficiency, cardiovascular diseases (restenosis, familial
hypercholesterolemia, peripheral artery disease), Gaucher disease, a1-antitrypsin
deficiency, rheumatoid arthritis and a few others. Human diseases expected to
be the object of clinical trials include hemophilia A and B, ParkinsonÕs
disease, ocular diseases, xeroderma pigmentosum, high blood pressure, obesity
and many others. The establishment of novel animal models for human disease,
the discovery of new genes, and improvements in successful gene delivery open
bright new prospects for molecular medicine. A wide variety of delivery
vehicles for genes have been tested including murine retroviruses, recombinant
adenoviral vectors, adeno-associated virus, HSV, EBV, HIV vectors, and
baculovirus. Nonviral gene delivery methods use cationic or neutral liposomes,
direct injection of plasmid DNA, and polymers. Various strategies to enhance
efficiency of gene transfer have been tested such as fusogenic peptides in
combination with liposomes, or polymers, to enhance the release of plasmid DNA
from endosomes. Recombinant retroviruses stably integrate into the DNA and
require host DNA synthesis; adenoviruses can infect nondividing cells but cause
immune reactions leading to the elimination of therapeutically transduced
cells. Adeno-associated virus (AAV) is not pathogenic, does not elicit immune
responses but new strategies are required to obtain high AAV titers for
preclinical and clinical studies. Wild-type AAVs integrate into chromosome 19
whereas recombinant AAVs are deprived of site-specific integration and may also
persist episomally; HSV vectors can infect nonreplicating cells such as neuron
cells, have a high payload capacity for foreign DNA but inflict cytotoxic
effects. It seems that each delivery system will be developed independently of
the others and that each will prove its strengths for specific applications. At
present, retroviruses are most commonly used in human clinical trials followed
by adenoviruses, cationic liposomes and AAV. Polymer-encapsulated syngeneic or
allogeneic cells implanted into a tissue of a patient can be used to secrete
therapeutic proteins; the method is in trials for amyotrophic lateral sclerosis
using the ciliary neurotrophic factor gene, and can be extended to Factor VIII
and IX for hemophilia, interleukin genes, dopamine-secreting cells to treat
Parkinson's disease, nerve growth factor for Alzheimer's disease and other
diseases. Ingenious techniques under development with great future prospects
for human gene therapy, include the Cre-LoxP recombinase system to rid of
undesirable viral DNA sequences used for gene transfer, use of tissue-specific
promoters to express a gene in a particular cell type or use of ligands, such
as peptides selected from random peptide libraries, recognizing surface molecules to direct the
gene vehicle to a particular cell type, designing p53 Ògene bombsÓ that explode
into tumor cells, exploit the HIV-1 virus to engineer vectors for gene
transfer, the combining of viruses with polymers or cationic lipids to improve
gene transfer, the attachment of nuclear localization signal peptides to
oligonucleotides to direct them to nuclei, and the invention of molecular
switch systems allowing genes to be turned on or off at will.
Although many human tumors are non- or
weakly immunogenic, the immune system can be reinforced and instructed to
eliminate cancer cells after transduction of patientÕs cells ex vivo with the
cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a, followed
by cell vaccination of the patient (e.g. intradermally) to potentiate
T-lymphocyte-mediated antitumor effects (cancer immunotherapy). DNA vaccination
with genes encoding tumor antigens and immunotherapy with synthetic tumor
peptide vaccines are further developments in this exciting field. The genes
used for cancer gene therapy in human clinical trials include a number of tumor
suppressor genes (p53, RB, BRCA1, E1A), antisense oncogenes (antisense c-fos, c-myc, K-ras), and suicide
genes (HSV-tk, in combination with ganciclovir, cytosine deaminase in
combination with 5-fluorocytosine). Important in gene therapy are also the
genes of bcl-2, MDR-1, p21, p16, bax, bcl-xs, E2F, IGF-I VEGF, angiostatin, CFTR, LDL-R, TGF-b, and
leptin. Reports on human clinical trials using adenoviral and retroviral
injections of the p53 gene have been very encouraging; future directions might
go toward the use of genes involved in the control of tumor progression and
metastasis. The molecular mechanisms of carcinogenesis have been largely
elucidated and improvements in gene delivery methods are likely to lead to the
final victory of the human race in the fight against cancer and other deadly
diseases.
Abbreviations:
a1-AT, a1-antitrypsin
5FC, 5-fluorocytosine
5FU, 5-fluorouracil
aa, amino acid
AAV, adeno-associated virus
Ad, adenovirus
ADA, adenosine deaminase
aFGF, acidic fibroblast growth factor
AIDS, acquired immunodeficiency syndrome
APCs, antigen-presenting cells
bFGF, basic fibroblast growth factor
bp, base pairs
CAT, chloramphenicol acetyltransferase
CD, cytosine deaminase
CDKs, cyclin-dependent kinases
CEA, carcinoembryonic antigen
CF, cystic fibrosis
CFTR, cystic fibrosis transmembrane regulator
cfu, colony forming units
CMV IE, cytomegalovirus immediate-early
CMV, cytomegalovirus
CNS, central nervous system
CNTF, ciliary neurotrophic factor
CTLs, cytotoxic T lymphocytes
DBD, DNA-binding domain
DSBs, double-strand DNA breaks
EBV, Epstein-Barr virus
EGF, epidermal growth factor
EGFR, epidermal growth factor receptor
FH, familial hypercholesterolemia
GCV, ganciclovir
GFP, green fluorescent protein
GM-CSF, granulocyte-macrophage colony stimulating factor
HIV-1, human immunodeficiency virus type 1
HPV, human papillomavirus
HSC, hematopoietic stem cells
HSV, herpes simplex virus
i.m., intramuscular
i.p., intraperitoneal
i.v., intravenous
ICE, interleukin-1b converting
enzyme
IFN-g,
interferon-g
IGF-I, insulin-like growth factor I
IGF-IR, insulin-like growth factor I receptor
IL, interleukin
IL-1b,
interleukin-1b
ITR, inverted terminal repeat
LAK, lymphokine-activated killer cells
LDL-R, low density lipoprotein receptor
LTR, long terminal repeat
mAb, monoclonal antibody
MAR, matrix-attached region
MeP-dR, 6-methylpurine-2Õ-deoxyriboside
MHC, major histocompatibility complex
MLV, murine leukemia virus
MMTV, mouse mammary tumor virus
Mo-MLV, Moloney murine leukemia virus
MOI, multiplicity of infection
MT, metallothionein
NeoR, neomycin phosphotransferase
NK, natural killer cells
nt, nucleotides
ODNs, oligodeoxynucleotides
ORFs, open reading frames
ORIs, origins of replication
PAI-1, plasminogen activator inhibitor-1
PARP, poly(ADP-ribose) polymerase
PBL, peripheral blood lymphocytes
PCNA, proliferating cell nuclear antigen
PDGF, platelet-derived growth factor
PGF, placenta growth factor
PKC, protein kinase C
PMGT, particle-mediated gene transfer
PNP, purine nucleoside phosphorylase
PSA, prostate specific antigen
PVR, proliferative vitreoretinopathy
RA, rheumatoid arthritis
RA-SF, rheumatoid arthritis synovial fibroblasts
rAAV, recombinant adeno-associated virus
RAC, recombinant advisory committee
RB, retinoblastoma
RLU, relative luciferase units
RSV, Rous sarcoma virus
s.c., subcutaneous
SCID, severe combined immunodeficient
SMC, smooth muscle cell
TAD, transactivation domain
TGF-b,
transforming growth factor-b
TIL, tumor-infiltrating lymphocyte
TK, thymidine kinase
TNF-a, tumor
necrosis factor a
tPA, tissue plasminogen activator
uPA, urokinase plasminogen activator
VEGF, vascular endothelial growth factor
VSMC, vascular smooth muscle cell
VSMC, vascular smooth muscle cells
VSV, vesicular stomatitis virus
wt, wild-type
I. Introduction
Monumental
progress in several fields including DNA replication, transcription factors and
gene expression, repair, recombination, signal transduction, oncogenes and
tumor suppressor genes, genome mapping and sequencing, and on the molecular
basis of human disease are providing the foundation of a new era of biomedical
research aimed at introducing therapeutically important genes into somatic
cells of patients. The main targets of gene therapy are to repair or replace
mutated genes, regulate gene expression and signal transduction, manipulate the
immune system, or target malignant and other cells for destruction (reviewed by
Anderson, 1992; Nowak, 1995; Boulikas, 1996a,b; Culver, 1996; Ross et al,
1996).
Two main approaches have been pursued for gene
transfer to somatic cells (i) direct
gene delivery using murine retroviruses, adenoviruses, adeno-associated virus,
HSV, EBV, liposomes, polymers, or direct plasmid injection (gene therapy in vivo); and (ii) ex vivo gene therapy involving removal of syngeneic cells
from a specific organ or tumor of an individual, genetic correction of the
defect in cell culture (ADA deficiency, LDL-R for FH) or transfer of a
different gene (IL-2 to tumor infiltrating lymphocytes to potentiate the cytotoxicity
to tumors, cytokine genes to tumor cells from a patient for cancer
immunotherapy, multidrug resistance gene transfer to render bone marrow cells
resistant to certain antineoplastic drugs), followed by reimplantation of the
cells. The reimplanted cells produce the therapeutic protein.
Several key factors or steps appear to be involved
for the effective gene transfer to somatic cells in a patient or animal model: (i) the type of vehicle used for gene delivery (liposomes, adenoviruses,
retroviruses, AAV, HSV, EBV, polymer, naked plasmid) which will determine not
only the half-life in circulation, the biodistribution in tissues, and efficacy
of delivery but also the route through the cell membrane and fate of the
transgene in the nucleus; (ii) interaction
of the gene-vehicle system with components in the serum or body fluids (plasma
proteins, macrophages, immune response cells); (iii) targeting to the cell type, organ, or tumor, and binding to
the cell surface; (iv) port and mode
of entrance to the cell (poration through the cell membrane, receptor-mediated
endocytosis), (v) release from
cytoplasmic compartments (endosomes, lysosomes), (vi) transport across the nuclear envelope (nuclear import); (vii) type and potency of regulatory
elements for driving the expression of the transferred gene in a particular
cell type including DNA sequences that determine integration versus maintenance
of a plasmid or recombinant virus/retrovirus as an extrachromosomal element; (viii) expression (transcription) of
the transgene producing heterogeneous nuclear RNA (HnRNA) which is then (ix) spliced and processed in the
nucleus to mature mRNA and is (x)
exported to the cytoplasm to be (xi)
translated into protein. Additional steps may include posttranslational
modification of the protein and addition of a signal peptide (at the gene
level) for secretion.
All steps can be experimentally manipulated and
improvements in each one can enormously enhance the level of expression and
therapeutic index of a gene therapy approach. It has been proposed that the
plasmid vector is unable to translocate to the nucleus unless complexed in the
cytoplasm with nuclear proteins possessing nuclear localization signals (NLSs).
NLSs are short karyophilic peptides on proteins destined to function in the
nucleus used for binding to specific transporter molecules in the cytoplasm,
mediating their passage through the pore complexes to the nucleus (see
Boulikas, 1998, this volume). NLS are present on histones, transcription
factors, nuclear enzymes, and a number of other nuclear proteins; nascent
chains of DNA-binding polypeptides could bind to the supercoiled plasmid in the
cytoplasm mediating its translocation to the nucleus.
During delivery of foreign DNA in vivo vehicles may be attacked by macrophages, lymphocytes, or
other components of the immune system and the vast majority will be cleared
from blood, intracellular, or other body fluids before it is given the chance
to reach the membrane of the cell target; the half-life of naked plasmids
injected intravenously into animals is about 5 min (Lew et al, 1995). Cationic
lipids, other than being very toxic, mediate efficient gene delivery passing
through biological membranes; those lipid-DNA complexes surviving the immediate
neutralization by serum proteins in the blood can reach the lung, heart and
other tissues after vein or artery injection with one heart beat and transform
endothelial vascular cells (reviewed by Boulikas, 1996d).
A variety of viral vectors have been developed to
exploit the characteristic properties of each group to maintain persistence and
viral gene expression in infected cells. Retroviral vectors and AAV integrate
into target chromosomes and the transgene they carry can be inactivated from
position effects from chromatin surroundings. Vectors with
persistence/integration functions may not result in high levels of gene
delivery in vivo.
Adenoviruses and retroviruses which are of the most
frequently used vehicles for gene transfer can accommodate up to 7kb of total
foreign DNA into their genome because of packaging limitations. This precludes
their use for the transfer of large genomic regions. Transfer of intact yeast
artificial chromosome (YAC) into transgenic mice will enable the analysis of
large genes or multigenic loci such as human b-globin
locus (reviewed by Peterson et al, 1997).
A small portion of plasmid molecules crossing the
cell membrane will escape degradation from nucleases in the lysosomes and
become released to the cytoplasm; even a smaller portion of these molecules will
enter nuclei; finally, after successfully reaching the nucleus, plasmids with
therapeutic genes are usually degraded by nuclear enzymes and transgene
expression is permanently lost after about 2-7 days from animal tissues
following successful gene delivery. During the peak of transgene expression
(usually 7-48 h from injection) the transgene transcript can follow the normal
fate of other nuclear transcripts when proper polyadenylation signals are
provided; its processed mRNA will be exported to the cytoplasm and translated
into the therapeutic protein.
The choice of the appropriate delivery system for
successful somatic gene transfer demands understanding of the drawbacks and
advantages of each delivery system, such as limitations in the total length of
the DNA that can be introduced, including the cDNA of the therapeutically
important gene and control elements. Understanding the pathophysiology of the
disease and the cell targets can give clues on the way of introducing the gene
(i.v., i.p., intratumoral, s.c. injection) or direct the gene therapist to
designing methods to target and secrete a therapeutic protein from a tissue
which is not the normal site of production of a therapeutic protein. The type
of control elements required for the anticipated tissue-specific expression of
the construct, the presence of viral or other origins of replication as well as
of the cDNA encoding the viral replication initiator protein for an episomal
replication of the transgene, sequences that prompt integration and others that
insulate the gene from the chromatin surroundings at the integration site, are
also important for successful gene transfer.
Cancer gene therapy and immunotherapy has been the
first priority of human gene therapy protocols. New gene targets are being
defined and new clinical protocols are being proposed and approved. Effective
eradication of a great variety of tumors with drugs which inhibit angiogenesis
has been extraordinarily successful on animal models and the method moves fast
to clinical trials; transfer of anti-angiogenesis genes will be the next step.
A number of anticancer genes are being tested in preclinical or clinical cancer
trials including p53, RB, BRCA1, E1A, bcl-2, MDR-1, HER2, p21, p16, bax,
bcl-xs, E2F, antisense IGF-I, antisense c-fos, antisense c-myc, antisense K-ras
and the cytokine genes GM-CSF, IL-12, IL-2, IL-4, IL-7, IFN-g, and TNF-a. A promising approach
is transfer of the herpes simplex virus thymidine kinase (HSV-tk) gene (suicide gene) and systemic
treatment with the prodrug ganciclovir which is converted by HSV-tk into a
toxic drug killing dividing cells. Theoretically, expression of therapeutic
genes preferentially in cancer cells could be achieved by regulatory elements
from tumor-specific genes such as carcinoembryonic antigen.
The first gene therapy products are expected to
receive FDA approval by the year 2000; the market for gene therapy products is
expected to exceed $45 billion by 2010.
This article reviews the molecular mechanisms and
recent developments for the gene therapy of cancer, HIV, ADA deficiency,
Parkinson's disease, lysosomal storage disease, hemophilia A and B, a1-antitrypsin deficiency, cystic fibrosis, rheumatoid
arthritis, hypertension, familial hypercholesterolemia,
atherosclerosis/restenosis, wound healing, and obesity including the treatment
of cancer and heart diseases with angiogenesis inhibitors and gene transfer to
the arterial wall. It is my intention to give a general overview rather to
exhaust the field.
DIVISION ONE: GENE DELIVERY SYSTEMS AND GENE
EXPRESSION
II. Gene delivery using retroviruses
A. Recombinant murine retroviruses
The recombinant Moloney murine leukemia virus (Mo-MLV
or MLV) has been extensively used for gene transfer. Retroviral vectors derived
from Mo-MLV promote the efficient transfer of genes into a variety of cell
types from many animal species; up to 8 kb of foreign DNA can be packaged in a
retroviral vector. Recombinant retroviruses have been the most frequently used
and promising vehicles for the delivery of therapeutic genes in human gene
therapy protocols (Appendix 1).
Retroviral vectors cause no detectable harm as they enter their target cells;
the retroviral nucleic acid becomes integrated into chromosomal DNA, ensuring
its long-term persistence and stable transmission to all future progeny of the
transduced cell.
The life cycle of the retrovirus is well understood
and can be effectively manipulated to generate vectors that can be efficiently
and safely packaged. An important contribution to their utility has been the
development of retrovirus packaging cells, which allow the production of
retroviral vectors in the absence of replication-competent virus.
Recombinant retroviruses stably integrate into the
DNA of actively dividing cells, requiring host DNA synthesis for this process
(Miller et al, 1990). Although this is a disadvantage for targeting cells at G0, such as the
totipotent bone marrow stem cells, it is a great advantage for targeting tumor
cells in an organ without affecting the normal cells in the surroundings. This
approach has been used to kill gliomas in rat brain tumors by injection of
murine fibroblasts stably transduced with a retroviral vector expressing the
HSV-tk gene (Culver et al, 1992; see below).
B. Retrovirus packaging cell lines
The use of retroviral vectors in human gene therapy
requires a packaging cell line which is incapable of producing
replication-competent virus and which produces high titers of
replication-deficient vector virus. The packaging cell lines have been stably
transduced with viral genes and produce constantly viral proteins needed by
viruses to package their genome. Wild-type virus can be produced through
recombinational events between the helper virus and a retroviral vector.
Methods are also available for generating cell lines which secrete a broad host
range retrovirus vectors in the absence of helper virus.
Retrovirus packaging cell lines containing the
gag-pol genes from spleen necrosis virus and the env gene from spleen necrosis
virus or from amphotropic murine leukemia virus on a separate vector have been
used; retrovirus vectors were produced from these helper cell lines without any
genetic interactions between the vectors and sequences in the helper cells
(Dougherty et al, 1989). An ecotropic packaging cell line and an amphotropic
packaging cell line, in which the viral gag and pol genes were on one plasmid
and the viral env gene were on another plasmid have been constructed; both
plasmids contained deletions of the packaging sequence and the 3' LTR; when the
fragmented helper virus genomes were introduced into 3T3 cells they produced
titers of retrovirus which were comparable to the titers produced from
packaging cells containing the helper virus genome on a single plasmid
(Markowitz et al, 1990).
The pBabe retroviral vector constructs which transmit
inserted genes at high titers and express them from the Mo-MLV LTR have been
designed with one of four different dominantly acting selectable markers,
allowing the growth of infected mammalian cells in the presence of G418,
hygromycin B, bleomycin/phleomycin or puromycin, respectively. The packaging
cell line, omega E, generated with separate gag/pol and ecotropic env
expression constructs, was designed in conjunction with the pBabe vectors to
reduce the risk of generation of wild type Mo-MLV via homologous recombination
events (Morgenstern and Land, 1990).
C. Pseudotyped retroviral vectors
The traditional retroviral vector enters the target
cell by binding of a viral envelope glycoprotein to a cell membrane viral
receptor. Coinfection of cells with a retrovirus and VSV (vesicular stomatitis
virus) produces progeny virions containing the genome of one virus encapsidated
by the envelope protein of the other (pseudotypes of viruses); this led to the
development of pseudotyped retroviral vectors where the Moloney murine leukemia
env gene product is replaced by the
VSV-G protein able to interact with other membrane-bound receptors as well as
with some components of the lipid bilayer (phosphatidylserine); because of the
ubiquitous distribution of these membrane components pseudotyped particles
display a very broad host range (Friedmann and Yee, 1995). Use of pseudotyped
vectors has been a significant advancement for retroviral gene transfer.
Pseudotypes of VSV and Mo-MLV, are released
preferentially at early times after infection of MuLV-producing cells with VSV;
at later times, after synthesis of M-MLV proteins has been inhibited by the VSV
infection, neither Mo-MLV virions nor the VSV (Mo-MLV) pseudotypes are made.
There appears to be a stringent requirement for recognition of the viral core
by homologous envelope components for the production of VSV (M-MLV) pseudotypes
(Witte and Baltimore, 1977).
The finding that the G protein of vesicular
stomatitis virus (VSV) can serve as the exclusive envelope protein component
for one specific retroviral vector that expresses VSV G protein was extended to
a general transient transfection scheme for producing very high-titer VSV
G-enveloped pseudotypes from any Moloney murine leukemia-based retroviral
vector (Yee et al, 1994). Pseudotyping
of MuLV particles with VSV-G expressed transiently in cells producing MLV Gag
and Pol proteins, has yielded vector preparations with a broader host range
that could be concentrated by ultracentrifugation. For example, this technology
allowed for efficient concentration of vector by ultracentrifugation to titers
> 109 colony-forming units/ml and offers hope for potential use
for gene transfer in vivo. Furthermore, these vectors could infect cells, such
as hamster and fish cell lines, that are ordinarily resistant to infection with
vectors containing the retroviral envelope protein (Burns et al, 1993).
A human 293-derived retroviral packaging cell line
was generated by Ory et al (1996) capable of producing high titers of
recombinant Mo-MLV particles that have incorporated the VSV-G protein. This new
packaging cell line may be used for direct in vivo gene transfer using
retroviral vectors because the retroviral/VSV-G pseudotypes generated with
these cells were significantly more resistant to human complement than commonly
used amphotropic vectors.
A human immunodeficiency virus type 1 (HIV-1)-based
retroviral vector containing the firefly luciferase reporter gene could be
pseudotyped with a broad-host-range VSV envelope glycoprotein G;
higher-efficiency gene transfer into CD34+ cells was achieved with a
VSV-G-pseudotyped HIV-1 vector than with a vector packaged in an amphotropic
envelope (Akkina et al, 1996).
Because the VSV-G protein is toxic to cells when
constitutively expressed, Yang et al (1995) have used steroid-inducible and
tetracycline-modulated promoter systems to derive stable producer cell lines
capable of substantial production of VSV-G pseudotyped MLV particles.
Similarly, the toxic G protein of VSV could be induced in a cell line by the
removal of tetracycline and the addition of estrogen; this cell line was
transduced with a modified tTA transactivator gene engineered with the
ligand-binding domain of the estrogen receptor to the carboxy terminus of the
tTA transactivator; a single retroviral vector could transduce both the
transactivator gene and the VSV-G protein gene controlled by the tTA-inducible
promoter into mammalian cells (Iida et al, 1996). The tetracycline-inducible
system was modified by fusing the ligand binding domain of the estrogen
receptor to the carboxy terminus of a tetracycline-regulated transactivator to
regulate VSV-G expression in a tetracycline-dependent manner that could be
modulated by b-estradiol in stable packaging cell lines (Chen et
al, 1996).
D. Limitations and advancements using retroviral
vectors
Before the in vivo gene therapy with retroviruses
becomes a successful reality a number of problems must be overcome. Despite the
extensive use of retroviral vectors in gene therapy, there are still problems
to be solved and there is an ultimate need for the development of new, improved
retroviral vectors and packaging systems to fuel further advances in the field
of human gene therapy. The principle limitation of retroviruses has been poor
gene expression in vivo which has been overcome through the use of
tissue-specific promoters. Use of internal ribosome entry sites from
picornaviruses in retroviral vectors has provided stable expression of multiple
gene enhancers (reviewed by Naviaux and Verma, 1992; Boris-Lawrie and Temin,
1993).
Little is known about the factors that influence the
efficiency of retroviral infection in vivo. Many commonly used experimental
animal strains, such as mice, harbor endogenous C-type proviruses, some of
which are expressed and have circulating antibodies against the viral envelope
glycoproteins that cross-react with the Mo-MLV; the efficiency of
retrovirus-mediated transfection in vivo using a variety of mouse strains was
affected by humoral immune competence and interference between endogenous MLVs
and exogenous recombinant Mo-MLV (Fassati et al, 1995).
One of the drawbacks of retroviruses for their
exploitation in gene therapy has been the low viral titers obtained, too low to achieve therapeutic levels of
gene expression; methods for the efficient concentration from large volumes of
supernatant and purification of amphotropic retrovirus particles have been
developed in several laboratories. For example, Bowles et al (1996) have used
concentration and further purification of virus particles by sucrose banding
ultracentrifugation; animal studies have shown that viral transduction
increased proportionally with titer of the retrovirus.
Transduced cells producing retrovirus are
tissue-incompatible and are, therefore, expected to be attacked by the immune
system; this will lead to the elimination of therapeutic cells from the body, a
phenomenon markedly associated also with adenoviral gene transfer. A privileged
exception are brain tumor cells expressing recombinant retrovirus which persist
without immunologic rejection (Culver et al, 1992).
Sodium butyrate treatment of murine retrovirus
packaging cells producing a CFTR vector increased the production of the
retrovirus vector between 40- and 1,000-fold (Olsen and Sechelski, 1995).
The Cre/LoxP recombinase strategy (see below) has
been used to generate retroviral vectors that have the ability to excise
themselves after inserting a gene into the genome, thereby avoiding problems
encountered with conventional retrovirus vectors, such as recombination with
helper viruses or transcriptional repression of transduced genes (Russ et al,
1996). Retroviral vectors with the Cre/LoxP technology have also been used to
deliver the GM-CSF gene to K562 cell culture (Fernex et al, 1997), for the
development of retroviral suicide vectors for gene therapy using the HSV-tk
gene (Bergemann et al, 1995), and for the production of a high-titer producer
cell line containing a single LoxP site flanked by the viral LTRs (Vanin et al,
1997).
Because retrovirus
vectors are integrated into the genome, transcriptional repression of
transduced genes will often take place from position effects exerted from
neighboring chromatin domains; two matrix-attached regions (MARs), one at
either flank of the transgene, are proposed here to insulating the gene in the
retrovirus vector from chromatin effects at the integration site by creating an
independent realm of chromatin structure harboring the transgene. MAR insulators have been used and can
enhance up to 2,000-fold the expression of genes in transgenic animals and
plants (McKnight et al, 1992; Breyne et al, 1992; Allen et al, 1993; Brooks et
al, 1994; Thompson et al, 1994; Forrester et al, 1994).
E. Targeting of retrovirus to specific cell types
A number of approaches have been directed to develop
retroviral vectors that are able to target particular cell types; also efforts
focus toward retroviral vectors that incorporate nonretroviral features and are
tailored to desired needs for specific uses (reviewed by Vile and Russell,
1995; Gunzburg and Salmons, 1996).
Ideally, therapeutic genes should be delivered only
to the relevant cell type and/or expressed in this cell type. Viral and
nonviral vectors can be targeted through ligand-receptor interactions.
Retroviral targeting through protease-substrate interactions has also been
described; epidermal growth factor (EGF) was fused to a retroviral envelope
glycoprotein via a cleavable linker comprising a factor Xa protease recognition
signal. Vector particles displaying the cleavable EGF domain could bind to EGF
receptors on human cells but did not transfer their genes until they were
cleaved by factor Xa protease (Nilson et al, 1996).
A retroviral vector that infects human cells
specifically through recognition of the low density lipoprotein receptor has
been described by adding onto the ecotropic envelope protein of M-MLV a
single-chain variable fragment derived from a monoclonal antibody recognizing
the human LDL-R; the chimeric envelope protein was used to construct a
packaging cell line producing a retroviral vector capable of transfer of the
lacZ gene to human cells expressing LDL-R (Somia et al, 1995).
F. Other retroviruses
Viruses that contain RNA as their genetic material
may be either negative- or positive-strand RNA viruses. The very large group of
negative-strand RNA viruses includes some of the most serious and notorious
pathogens subdivided into those with segmented RNA (influenza viruses,
comprising eight separate segments of RNA and bunyaviruses containing three
segments of single-stranded RNA, the large, L, the medium, M, and the small, S)
and those with nonsegmented RNA (VSV, rabies, measles, Sendai, respiratory
syncytial virus, Ebola viruses). Positive-strand RNA viruses include poliovirus.
Cloned positive-strand poliovirus cDNA is infectious
but neither isolated genome nor antigenome RNA of negative-strand viruses is
infectious; this is because the negative-strand viral RNA is assembled with
viral nucleoprotein into an RNP complex that becomes the template for the viral
RNA-dependent RNA polymerase. Helper influenza virus-dependent procedures have
been developed in which an influenza virus-like RNA molecule, containing a
reporter gene, was mixed with disrupted virion core proteins to reconstitute
RNP complexes in vitro which were then transfected into influenza
virus-transfected cells. Recombinant nucleocapsid and polymerase proteins for
the unsegmented RNA viruses have also been used to produce infectious virus
without help from an homologous virus using full-length cDNA clones of
intracellularly transcribed antigenomes (rabies, VSV, measles, Sendai) (see
Bridgen and Elliott, 1996 and the references cited therein).
Plasmids containing full-length cDNA copies of the
three RNA genome molecules of Bunyamwera bunyavirus and a negative-sense copy
of the GFP gene, flanked by T7 promoter and hepatitis delta virus ribozyme
sequences, were used to produce infectious virus particles without helper
virus; these plasmids were used to transfect HeLa cells which expressed T7 RNA
polymerase and recombinant Bunyamwera bunyavirus proteins by previous
transfection with the appropriate plasmids; 24 h after infection about 1 in
1,000 HeLa cells displayed fluorescence indicative of transcription and
replication of the reporter RNA (Bridgen and Elliott, 1996).
III. Adenoviral gene delivery
A. Adenovirus replication, transcription, and
attachment to the nuclear matrix
Before understanding the principle of adenoviral gene
transfer, it is essential to comprehend the molecular events which are involved
in the life cycle of the adenovirus. Adenoviruses posses a well-defined origin
of replication which is stimulated by transcription factors NFI and NFIII (Hay,
1985; Pruijn et al, 1986). The transcription factor NF-I (also called CTF,
CCAAT box-binding protein, or C/EBP) stimulates replication of adenovirus DNA
in vitro (Pruijn et al, 1986; Jones et al, 1987; Santoro et al, 1988;
Coenjaerts et al, 1991) by establishing cooperative interactions with Ad-DBP (Adenovirus DNA-binding protein)
(Cleat and Hay, 1989). The transcription factor NFIII (also called Oct-1 or
OTF-1), involved in the regulation of the histone H2B and immunoglobulin genes,
can stimulate initiation of adenovirus DNA replication in vitro (O'Neil et al., 1988; Mul et al, 1990; Verrijzer et al,
1990; Coenjaerts et al, 1991).
The adenovirus 5 protein Ad-DBP is a single-stranded
DNA binding protein product of the viral E2A absolutely required for chain
elongation during Ad5 DNA replication; other than facilitating unwinding of the
DNA, Ad-DBP might also protect single-stranded DNA at the replication fork from
nuclease attack, increase the rate of processivity of the viral DNA polymerase,
and increase binding of NFI of the core origin of Ad5 (Cleat and Hay 1989).
This protein has a size of 529 amino acids, is phosphorylated and apart from
its role in DNA replication is also involved in transcription, recombination,
transformation, and virus assembly (see Tucker et al 1994). Crystal structure
at 2.6 A resolution of Ad-DBP shows that a 17 aa C-terminal domain hooks onto a
second Ad-DBP molecule thus promoting its cooperativity during DNA binding; Ad
DBP was proposed to act by forming a core around which single-stranded DNA
winds (Tucker et al, 1994).
Adenoviruses replicate episomally; they need to
attach to the nuclear matrix of the host cell for their replication. Two
adenoviral proteins have been found attached to the nuclear matrix and
presumably mediating the anchorage of the adenovirus: (i) the E1a protein (11 kDa), a transcription and replication
factor sufficient to immortalize primary rodent cells, which was crosslinked to
matrix proteins with oxidation with o-phenanthroline/Cu2+ (Chatterjee and Flint, 1986) and (ii) the adenovirus terminal protein
(55 kDa) which is covalently attached to the 5' end of Ad DNA and initiates DNA
replication; the adenovirus terminal protein mediated adenovirus anchorage to
nuclear matrix was resistant to 1M guanidine extraction (Bodnar et al, 1989;
Schaack et al, 1990; Fredman and Engler, 1993).
Three types of internal matrix structures were
recognized in HeLa cells infected with adenovirus 2; an amorphously dense
region; granular regions representing virus capsid assembly structures; and
filaments connecting these regions to one another and to the peripheral lamina
(Zhonghe et al, 1987); the perinuclear matrix was also rearranged after
adenovirus infection.
Electron micrographs of thin sections through nuclei
of adenovirus-infected HeLa cells showed that the 3H-deoxyuridine grains
were located at the periphery as well as in the interior of nuclei.
Simultaneous visualization of adenovirus transcription and replication showed
that the two processes occurred in adjacent, yet distinct, foci throughout the
interior and periphery of nuclei presumably in association with the nuclear
matrix; DNA molecules were found to be displaced from the replication foci and
to become spread in the surrounding nucleoplasm serving as templates for
transcription (Pombo et al, 1994).
Adenovirus infection provokes dramatic rearrangements
to the nuclear matrix. A reorganization in both internal and peripheral NM was
also observed in HeLa cells after infection with adenovirus 2 giving structures
able to support the increased replication demands and capsid assembly of the
virus (Zhonghe et al, 1987). Splicing of adenoviral HnRNA takes place on the
nuclear matrix. All adenovirus 2 polyadenylated RNAs could be UV crosslinked to
two host HnRNP proteins that are involved in the association of HnRNA to the
matrix (Mariman et al, 1982).
Adenovirus establishes foci called replication
centers within the nucleus, where adenoviral replication and transcription
occur; although the rAAV genome was faintly detectable in a perinuclear
distribution after successfully entering the cell, AAV was mobilized to the
adenovirus replication centers when the cell was infected with adenovirus; thus
AAV colocalizes with the adenovirus replication centers (Weitzman et al, 1996).
B. Adenovirus E1A and E1B proteins in apoptosis and
control of the host cell cycle
Viruses have developed strategies to shut down
protein synthesis in the host and subdue its protein synthesizing machinery to
produce progeny virus when infecting cells. In response, many cell types commit
suicide after viral infection to protect the organism from further infection.
Striking back, viruses have evolved mechanisms to prevent infected cells from
perishing using mechanisms that inhibit apoptosis of the host cell;
adenoviruses synthesize the 19 kDa E1B protein which has a domain similar to
that of the cellular protein Bcl-2, the apoptosis inhibitor (Sarnow et al,
1982; van den Heuvel et al., 1990). p53 can be complexed with adenovirus E1B
(Sarnow et al, 1982; van den Heuvel et al., 1990).
Expression of the
adenovirus E1A protein stimulates host DNA synthesis and induces apoptosis; on
the contrary E1B 19 kDa associates with Bax protein and inhibits apoptosis (Figure 1). The E1A oncogene of
adenovirus exerts its effect via p53 protein (Debbas and White, 1993; White,
1993). Indeed, expression of E1A increases the half-life of p53 resulting in
accumulation of p53 molecules in adenovirus-infected cells leading to apoptosis.
Although induction of host DNA synthesis by E1A provides a suitable environment
for virus replication, the induction of apoptosis by the same protein impairs
virus production since virus-infected cells are eliminated (see Han et al, 1996
for references). p53-deficient cells are transformed by E1A because of absence
of the pathway for induction of apoptosis by p53 (Lowe et al, 1994).
E1A represses HER-2/neu transcription and functions
as a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. Transfer
the E1A gene into cancer cells that overexpress HER-2/neu is an interesting
aspect of gene therapy (see E1A in gene therapy; Yu et al, 1995; Chang et al, 1996; Ueno NT et al, 1997; Rodriguez
et al, 1997; Xing et al, 1997).
The E1B oncogene products inhibit apoptosis induced
by E1A expression thus preventing premature death of host cells during
adenovirus infection. This gives an advantage to virus for its proliferation
and E1B proteins (19 kDa and 55 kDa) are necessary for transformation of
primary rodent cells by E1A. E1A alone is unable to transform primary rodent
cells (White, 1993).
The E1B 19K protein of
adenovirus is the putative viral homolog of the cellular Bcl-2 protein; using
the yeast two-hybrid system for the identification of proteins interacting with
E1B, Han and coworkers (1996) have identified Bax as one of the seven
19k-interacting clones. The 50-78 amino acid domain of Bax contains a conserved
region homologous to Bcl-2 which is able to interact specifically with either
Bcl-2 or E1B. In p53 mutant cells expression of Bax induced apoptosis;
inhibition of apoptosis by Bcl-2 may proceed via its ability to bind the
death-promoting Bax protein (Han et al, 1996). The bax gene is upregulated by p53.
Expression of p53 and of adenovirus E1A induce
apoptosis (Debbas and White, 1993; Lowe and Rudley, 1993). A number of proteins
when expressed at sufficient amounts block apoptosis; these include Bcl-2 and
E1B 19 kDa protein of adenovirus (Debbas and White, 1993; Chiou et al, 1994).
All four protein molecules act upstream of Bax which is a potent inducer of
apoptosis: both the cellular Bcl-2 and the 19 kDa protein E1B of adenovirus are
able to interact with Bax inhibiting its involvement in induction of apoptosis
(Han et al, 1996; Figure 1). E1A
acts upstream of p53 by increasing the half-life of p53 resulting in an
accumulation of p53 molecules in the nucleus (Lowe and Ruley, 1993); increased
levels of p53 are then believed to upregulate the bax gene.
The transcription factor E2F was originally
identified as an activator of the adenovirus E2 gene and is implicated in the
regulation of DNA replication (Shirodkar et al., 1992). Following infection of
cells with adenovirus, the DNA binding activity of E2F increases and as a
consequence transcription of the E2 gene of adenovirus increases (Kovesdi et
al., 1987). These changes in E2F are mediated by E1A protein of adenovirus. RB
forms specific complexes with E2F keeping E2F in a form unable to upregulate
its target regulatory sequences. E2F can form specific complexes also with
cyclin A during S-phase in NIH 3T3 cells (Mudryj et al., 1991). Both types of
complexes, E2F-RB and E2F-cyclin A, can be dissociated by the adenovirus E1A
protein (Chellappan et al., 1991; Bagchi et al., 1990; reviewed by White, 1998
this volume) but also by phosphorylation of RB at G1/S causing release of E2F
and stimulation in transcription of genes required for DNA replication (myc, DHFR).
These events contribute to the uncontrolled proliferation of
adenovirus-transformed cells (Mudryj et al., 1990, 1991). Release of E2F from
RB induced by E1A is critical for transformation of cells by E1A (for references
see Hiebert et al, 1995).
C. Strategies of adenoviruses to enter the cell
In order to enter the host cell the adenovirus first
attaches with a high affinity to a cell surface receptor, whose nature still
remains elusive, using the head domains of the protruding viral fibers; the
fibronectin-binding integrin on the cell surface then associates with the
penton base protein on the adenovirus triggering endocytosis of the virus
particle via coated pits and coated vesicles (Svensson and Persson, 1984; Greber
et al, 1996). The third step in adenovirus entry into the host cell includes
Figure 1. Role of E1A and E1B19-kDa
proteins of adenovirus in apoptosis.
penetration
of the adenoviral particles by acid-catalyzed rupture of the endosomal membrane
involving the penton protein and the integrins and allowing escape to the
cytoplasmic compartment; a decrease in endosome pH during internalization
expose hydrophobic domains of these adenoviral capsid proteins which permits
these proteins to insert into the vesicle membrane in a fashion that ultimately
disrupts its integrity (Seth et al, 1984). At the final step the adenoviral
particle is attached to the cytoplasmic side of pore complexes and the DNA is
released to the interior of pore annuli entering the nucleoplasm.
These highly ordered processes are accompanied by
losses or protease degradation of specific proteins on the viral particles; the
fibers and some of the penton base complexes on the adenovirus surface are already
lost during the process of endocytosis; a viral protease, L3/p23, located
inside the capsid at 10 copies per virion, plays a key role in the stepwise
dismantling and in the weakening of the capsid structure culminating with the
release of the adenovirus DNA by degrading of the viral capsid protein VI
(Greber et al, 1996). The mechanism of disruption of endosomes by the
adenoviral particles has been exploited to augment efficiency of transfection
with transferrin-polylysine-DNA complexes (see fusogenic peptides and Curiel et
al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al, 1993;
Morishita et al, 1993; Harries et al, 1993; Curiel, 1994).
To overcome one of the major limitations to the
clinical utility of adenoviruses which is the low efficiency of gene transfer
achieved in vivo, Arcasoy et al (1997) found that the presence of the
polycations polybrene, protamine, DEAE-dextran, and poly-L-lysine significantly
increased the transfection efficiency in cell culture using the lacZ gene; because
the polyanion heparin did not significantly alter gene transfer efficiency, but
completely abrogated the effects of polycations it supports the idea that the
negative charges presented by membrane glycoproteins reduce the efficiency of
adenovirus-mediated gene transfer, an obstacle that can be overcome by
polycations.
D. Advantages and drawbacks of adenoviral vectors in
gene delivery
Adenoviruses possess a linear double-stranded genome
which can be manipulated to accommodate up to 7.5 kb of DNA. Adenoviruses have
the advantage of being able to infect nondividing cells. Other advantages are
the rarity of recombination events between adenoviral vectors and the host
chromosomes, the absence of induction of human malignancies by adenoviruses,
and the relative safety of their use as vaccines (e.g. Ballay et al, 1985;
Haj-Ahmad and Graham, 1986). For safety, replication-deficient, infectious
adenoviruses are being used in somatic gene transfer; for example deletion in a
portion of the E3 region of the virus permits encapsidation whereas deletion of
a portion of the E1A coding sequence
impairs viral replication (Gilardi et al, 1990; Rosenfeld et al, 1991).
E. Deletion of adenoviral DNA sequences for gene delivery
First generation recombinant adenoviruses were
rendered defective by deletion of sequences spanning the E1A and E1B genes;
these adenoviruses expressed low levels of early and late viral genes
responsible for activating destructive cellular immune responses. Further
deletion of other essential genes and growth in new packaging cell lines or
incorporation of temperature sensitive mutations which allow propagation of the
virus in available packaging cell lines at permissive temperatures are
strategies for improving the therapeutic efficacy of recombinant adenoviruses
and for minimizing the immune response elicited to the host (Fisher et al,
1996).
E1-defective, recombinant adenoviruses can be
replication-enabled by the codelivery of a plasmid encoding the deleted E1
functions, a strategy now designated as Òconditional replication-enablement
system for adenovirusÓ (CRESA); when the original replication-enabling plasmid
was replaced by two separate plasmids that encoded the necessary E1A and E1B
functions the E1-defective adenovirus could become conditionally
replication-enabled by an RNA transcript encoding the required E1 functions.
The RNA transcript of E1A enhanced the therapeutic efficacy of the E1-defective
adenovirus: subcutaneous human tumor nodules containing a fraction of cells
cotransduced with the replication-enabling RNA + DNA and an HSV-tk adenovirus
were reduced to a greater extent than control nodules generated from the same
fraction of cells cotransduced with the HSV-tk adenovirus and an irrelevant
plasmid (Dion et al, 1996).
A new type of recombinant adenovirus, (called
delta-rAd), deprived of all viral open reading frames and retaining only the
essential cis elements (i.e., ITRs and contiguous packaging sequence), was
propagated in 293 cells in the presence of E1-deleted helper virus (Fisher et
al, 1996). This adenovirus was packaged as concatamers into virions and was
used to deliver successfully the CFTR gene to human airway epithelial cells in
culture derived from a cystic fibrosis patient. The new delivery system needs
improvements in its production and purification to allow its evaluation and use
in vivo.
F. Immune response to adenoviruses eliminate
therapeutic cells
Adenoviruses can achieve high levels of gene transfer
(Haffe et al, 1992; Morsy et al, 1993; Herz and Gerard; Wilson, 1995; Kozarsky
et al, 1996). However, the duration of transgene expression is limited (i) by clearance of the infected cells
because of the cellular and humoral immune response (including those mediated
by cytotoxic T lymphocytes) to adenoviral antigens (Yang Y et al, 1994, 1995)
and (ii) by loss of adenoviral
episomes in progeny cells (Feng et al, 1997). To circumvent this problem
adenoviral/retroviral chimeric vectors were constructed where the
nonintegrative adenoviral vector was able to induce target cells to function as
transient retrovirus producer cells and the retroviral particles were able to
transduce neighboring cells; thus the recombinant adenovirus became integrative
via the intermediate generation of a retroviral producing cell (Feng et al,
1997). First generation adenovirus-mediated gene transfer of CFTR to the mouse
lung resulted in the expression of viral proteins leading to the elimination of
the therapeutic cells expressing CFTR by cellular immune responses and
repopulation of the lung with nontransgene containing cells; second generation
E1-deleted viruses, also crippled by a temperature sensitive mutation in the
E2A gene, displayed substantially longer recombinant gene expression and
induced a lower inflammatory response (Yang et al, 1994).
In order to circumvent the elimination of
adenovirus-transduced cells by immune responses and for achieving persistence
of transgene expression strategies to reduce the potential for viral gene
expression have been developed; for example, an E4 modified adenovirus which
was replication defective in cotton rats and displayed a reduced potential for
viral gene expression in vivo was engineered (Armentano et al, 1997). Vectors
containing a wild-type E4 region, E4 open reading frame 6, or a complete E4
deletion were compared in the lungs of BALB/c mice for persistence of CFTR or
lacZ expression; expression was transient from the E1a promoter with all
vectors but persisted from the CMV promoter only with a vector containing a
wild-type E4 region; thus, transient expression from adenoviral vectors may
result from the down-regulation of a promoter and not necessarily from immune
response-related factors (Armentano et al, 1997).
The elimination of therapeutically important cells
from the body after recombinant adenovirus-mediated delivery seems to be a
great limiting factor for the use of adenoviruses in long-term gene therapy
(Dai et al, 1995). This problem can be partially circumvented by daily
administration of the immunosupressant cyclosporin A prohibiting the elimination
of virally-transduced cell by activated T lymphocytes (Fang et al, 1995). A
different approach to suppress elimination of therapeutically-transduced cells
after intra-articular delivery of genes to treat RA is by pretreatment of the
joints with the anti-T cell receptor monoclonal antibody H57, a treatment which
resulted in a significant reduction in lymphocytic infiltration and a
persistence of transgene expression (Sawchuk et al, 1996).
The prokaryotic Cre-LoxP recombination system was
adapted to generate recombinant adenoviruses with extended deletions in the
viral genome in order to minimize expression of immunogenic and/or cytotoxic
viral proteins. An adenovirus was produced with a 25-kb deletion that lacked
E1, E2, E3, and late gene expression; this vector exhibited viral titers
similar to those achieved with first-generation (E1a-deleted) vectors which was
efficient for gene transfer to cell culture but gene expression declined to
undetectable levels much more rapidly than that sustained from first-generation
vectors. Vectors deleted only at E1a were sustaining a better reporter gene
expression because of their ability to replicate (Lieber et al, 1996).
A clinical protocol proposed recently for the therapy
of amyotrophic lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells
which is implanted intrathecally to provide human ciliary neurotrophic factor;
the membrane prevents immunologic rejection of the cells interposing a virus
impermeable barrier between the transduced cells and the host (Deglon et al,
1996; Pochon et al, 1996); the method has been applied before for cross-species
transplantation of a polymer-encapsulated dopamine-secreting cell line to treat
Parkinson's disease and for the delivery of nerve growth factor in rat and
primate models of the Alzheimer's disease (Kordower et al, 1994; see Pochon et
al, 1996 for more references). Evidently, similar approaches could be used to
protect adenovirus- and retrovirus-transduced syngeneic cells from immunologic
rejection provided that the therapeutic protein is secreted.
A new area of investigation is directed toward
surface modification of recombinant adenoviruses to render them safer and to
minimize the strong immune responses against the virus and virus-infected
cells; to this end Fender et al (1997) proposed a dodecahedron made of
adenovirus pentons or penton bases and having only one or two adenovirus
proteins instead of the 11 contained in an adenovirus virion; the penton is a
complex of two oligomeric proteins, a penton base and fiber, involved in the
cell attachment, internalization, and liberation of virus from endosomes.
It is certain that great improvements in adenoviral
gene delivery will solve many of the current problems and permit a higher
therapeutic efficacy in the near future.
G. Examples of adenoviral gene transfer
Recombinant adenovirus vectors have been used: for
the transfer of factor IX gene in hemophilia B dogs via vein injection (Kay et
al, 1994) and in mice (Smith et al, 1993); for the transfer of genes into
neurons and glia in the brain (le Gal la Salle, 1993); for the transfer of the
gene of ornithine transcarmylase in deficient mouse and human hepatocytes
(Morsy et al, 1993); for the transfer of the VLDL receptor gene for treatment
of familial hypercholesterolaemia in the mouse model (Kozarsky et al, 1996);
for the transfer of low density lipoprotein receptor gene in normal mice (Herz
and Gerard, 1993); and for the ex vivo transduction of T cells from
ADA-deficient patients (Blaese et al, 1995; Bordignon et al, 1995). The
adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia
of cotton rat respiratory pathway as a model for the treatment of a1-antitrypsin deficiency; both in vitro and in vivo
infections
Figure 2. Localization of a recombinant
adenoviral vector carrying 6.3 kb of dystrophin cDNA by in situ PCR following
intramuscular injection to immunosuppressed mdx mice. Shown are transverse
cryostat sections of mdx tibialis anterior muscle. Panel A shows a strong in situ hybridization signal (an E4 adenoviral
sequence was amplified and an E4 probe was used) in myonuclei of an
immunosuppressed animal injected with E1, E3-deleted adenovirus at 30 days
postinjection (magnification 650x). Panel B
was produced without Taq polymerase during PCR as a negative control. Panel C shows an uninjected muscle processed
as described in panel A showing no hybridization signal. From Zhao JE,
Lochumuller H, Nalbantoglu J, Allen C, Prescott S, Massie B, Karpati G (1997) Study of adenovirus-mediated
dystrophin minigene transfer to skeletal muscle by combined microscopic display
of adenoviral DNA and dystrophin. Hum
Gene Ther 8, 1565-1573. With kind permission of the authors (George
Karpati, Montreal Neurological Institute, Canada) and Mary Ann Liebert, Inc.
have
shown production and secretion of a1-antitrypsin by the
lung cells (Rosenfeld et al, 1991).
A transductional preference of
adenovirus-polylysine-DNA complexes and E1A/B-deleted replication-deficient
adenoviruses was demonstrated for the prostate carcinoma cell lines DU145,
LNCaP, and PC-3 over primary human bone marrow cells and the leukemia cell line
KG-1; this finding led to a strategy to purge bone marrow of a specific subset
of prostate carcinoma cells (Kim et al, 1997).
Figure 2 shows the localization of a recombinant adenoviral
vector carrying 6.3 kb of dystrophin cDNA, driven by the CMV promoter, by in
situ PCR following intramuscular injection to immunosuppressed mdx mice. Figure 3. shows a comparison of the
persistence of dystrophin expression and adenoviral genomes in immunosuppressed
versus immunocompetent mdx mice. The maximum number of fibers containing
recombinant adenovirus was maintained until 60 days in immunosuppressed mice
but for only 10 days in
immunocompetent animals. Thus, optimization of immunosuppression could assure
successful long term dystrophin gene transfer for gene therapy of Duchenne
muscular dystrophy (Zhao et al, 1997).
A number of RAC-approved protocols for gene transfer
to humans use recombinant adenoviruses (Appendix
1, protocols 118-157). Genes
transferred to patients with recombinant adenoviruses include p53 (#130, 131,
147, 148, 152-156), RB (#140), CFTR (#118-123, 125, 128, 129), HSV-tk (126,
127, 132, 136, 139, 141, 143, 145, 146), cytosine deaminase (#134, 151), VEGF
(#157), IL-2 (#135), GM-CSF (#149, 150), anti-erbB-2 single chain antibody
(#133), ornithine transcarbamylase (#137), and GP100 melanoma antigen (#142).
Figure 3. Comparison of the persistence of
dystrophin expression and adenoviral genomes in immunosuppressed versus
immunocompetent mdx mice. Shown are combined dystrophin immunostaining and in
situ PCR in tibialis anterior muscles of mdx mice at 10 days (A and C) and 60 days (B and D) postinjection. In A and B, FK506 was
used as an immunosuppressant, whereas in C and D no immunosuppression was
employed. At 10 days there was no significant difference in adenovirus positive
nuclei (arrows) fibers between the
immunosuppressed and the immunocompetent groups. At 60 days, however, there was
a dramatic decline in the number of positive nuclei in the immunocompetent
muscle. Magnification 650X. From Zhao JE, Lochumuller H, Nalbantoglu J, Allen
C, Prescott S, Massie B, Karpati G (1997)
Study of adenovirus-mediated dystrophin minigene transfer to skeletal muscle by
combined microscopic display of adenoviral DNA and dystrophin. Hum Gene Ther 8, 1565-1573. With kind
permission of the authors (George Karpati, Montreal Neurological Institute,
Canada) and Mary Ann Liebert, Inc.
IV. Gene delivery with Adeno-Associated Virus (AAV)
A. Replication of AAV and rAAV: the role of the
inverted terminal repeats
AAVs are replication-defective parvoviruses, not
associated with any human disease (nonpathogenic), requiring cotransfection
with a helper virus to produce infectious virus particles; they can replicate
in cell culture only in the presence of coinfection with adenovirus or herpes
virus. Five serotypes of distinct AAV isolates have been recovered from human
and other primates. AAV infections in humans are asymptomatic acquired with
other viral infections such as adenovirus or HSV infections; 80-90% of adults
are seropositive for antibodies against AAV (for references see Clark et al,
1995; Berns and Linden, 1995).
The replication of the AAV is dependent on two copies
of a 145-bp inverted terminal repeat (ITR) sequence that flanks the AAV genome
which is the primary cis-acting element required for productive infection and
the generation of recombinant AAV (rAAV) vectors.
In the absence of helper virus, the AAV particle can
penetrate cells and find its way to the cell nucleus where the linear genome is
uncoated and becomes integrated at a specific site on chromosome 19q13.3;
several copies of AAV may integrate in tandem arrays. Thus, the AAV establishes
a latent infection; the integrated viral genome can be activated and rescued by
superinfection with helper virus (either adenovirus or any type of herpes
virus). Inverted repeats at the ends of the viral DNA serve for the integration
appearing near the junctions with cellular DNA sequences (Bohenzky et al,
1988).
Adenovirus establishes foci called replication
centers within the nucleus, where adenoviral replication and transcription
occur; AAV was colocalized with the adenovirus replication centers using in
situ hybridization and immunocytochemistry; AAV may, thus, utilize adenovirus
and cellular proteins for its own replication; the rAAV genome was faintly
detectable in a perinuclear distribution after successfully entering the cell;
however, rAAV was mobilized to replication centers when the cell was
subsequently infected with adenovirus (Weitzman et al, 1996).
Xiao et al (1997) have engineered the pDD-2 plasmid
containing two copies of the D element, a unique sequence adjacent to the AAV
nicking site, flanking a single ITR (a total of only 165 bp of AAV sequence);
this modified hairpin was sufficient to sustain replication of the plasmid
vector when Rep and adenovirus helper functions were supplied in trans. This
plasmid has a significant prospect in gene transfer because is replicated more
efficiently than infectious AAV clones; as a prelude to its replication the
input circular plasmid was converted into a linear substrate by resolution of
the AAV terminal repeat through a Holliday-like structure, a process most
likely mediated by host factors. Linear monomer, dimer, and other
higher-molecular-weight replicative intermediates were generated during the
replication of pDD-2, a feature characteristic of AAV replication. The
replicative intermediates of this plasmid substrate were competent for AAV DNA
replication, encapsidation, infection, integration, and subsequent rescue from
the chromosome when superinfected with Ad and wild-type AAV (Xiao et al, 1997).
The elucidation of the important role of this 165-bp ITR sequence for AAV
replication and the entire life cycle invigorates the important role of
inverted repeats at the origin of replication not only of viruses but also of cellular
origins of replication (Boulikas, 1996e).
B. Packaging capabilities of AAVs
AAVs posses a 4.7 kb single-stranded DNA genome.
Hermonat et al (1997) have examined the maximum amount of DNA which can be
inserted into the wild-type AAV genome without compromising packaging into an
infectious virus particle; the maximum effective packaging capacity of AAV,
examined as increments of 100 bp ligated at map unit 96 of AAV, is
approximately 900 bp larger than wild type. Thus, wtAAV therapy vectors can be
generated carrying a foreign gene of 900 bp or less with the advantages of
wtAAV such as the ease in which high titers of infectious virus can be
generated and the ability to specifically integrate in chromosome 19.
On the contrary, the payload capacity of recombinant
AAV, which has been deprived of its viral genes and bears only the ITRs is in
the order of 4.5-4.7 kb; this means that a cDNA up to this size can be inserted
into a rAAV; for example the size of the CFTR cDNA is 4.5 kb and thus, the
combined length of the promoter that drives CFTR expression and ITRs needs to
be kept under 500 bp (Dong et al, 1996).
Similar results were reported by Dong et al (1996)
who have estimated that the optimal size of AAV vector is between 4.1 and 4.9
kb; the packaging efficiencies were sharply reduced above 5.2 kb and below 4.1
kb; two copies of the vector were packaged into each virion when vectors of
2.2-2.5 kb were provided.
C. Integration of wtAAV but not of rAAV is
site-specific
Wild-type AAV is able to undergo targeted integration
on chromosome 19 after infection in 15 out of 22 clones examined (Kotin et al,
1990, 1992). Of 51 integrations examined by fluorescence in situ hybridization
(FISH) 48 (94%) were to chromosome 19 after infection of IB3-1 bronchial epithelial
cells with wild-type AAV (Kearns et al, 1996). Site-specific integration has
been reported for other viruses including avian leukosis virus (ALV)
integrating adjacent to cellular oncogenes in tumors; however, the mechanism of
ALV integration involves a process of selection of cells able to form tumors by
overexpression of the oncogene due to virus integration rather than exclusive
integration of the ALV at unique sites of the genome (Hayward et al, 1981). RSV
also appears to be integrated at a limited number of sites (Shih et al, 1988).
Adenovirus integration, a more rare event compared to the majority of episomal
molecules, may also occur at a number of preferred sites (Jessberger et al,
1989). A larger number of recombinase molecules than those known today may be
present in mammalian cell nuclei and promote site-specific integration and
recombination events.
Although the human wild-type AAV (wtAAV) is unique in its ability to
target viral integration to a specific site on chromosome 19, the recombinant
AAV (rAAV) vectors have lost the
site-specific integration and targeting ability; furthermore, rAAVs have
incapacitated ability to integrate, and can be found as episomes. When wtAAV-2
was used to infect IB3-1 bronchial epithelial cells all metaphase spreads
examined by fluorescence in situ hybridization (FISH) had integrated copies and
94% of the integrations were to chromosome 19; furthermore, 36 of 56 metaphase
spreads had a single copy of wtAAV integrated and 20 of 56 showed two sites
within chromosome 19 (Kearns et al, 1996). On the contrary, when a recombinant
AAV containing the CFTR cDNA was used to infect the same cells, examination of
67 metaphase chromosome spreads identified four integrations (only 6% of total)
to different chromosomes. No integration was to chromosome 19. When these
studies were repeated on the A35 epithelial cell line selected for stable CFTR
expression, the episomal AAV-CFTR sequences were abundant in the low molecular
weight DNA fraction (Kearns et al, 1996).
Yang et al (1997) have cloned over 40 AAV and rAAV
integration junctions to determine the terminal-repeat sequences that mediate
integration. These studies have shown that in both immortalized and normal
diploid human cells, wt AAV targeted integration to chromosome 19 in head-to-tail
tandem arrays; the majority of the junction sequences were involving incomplete
copies of the AAV inverted terminal repeats (ITRs); inversions of genomic
and/or viral DNA sequences at the wt integration site took place. The viral
integration event was found to be mediated by terminal repeat hairpin
structures and cellular recombination pathways. In contrast, rAAV provirus
integrated on chromosome 2 and at the same locus in two independent cell lines,
in both the flip and flop orientations; genomic rearrangements took place at
the integration site of rAAV, mainly involving deletions and/or
rearrangement-translocations.
Similar data were reported by Rutledge and Russell
(1997): recombinant AAV vectors were found to be integrated by nonhomologous
recombination as single-copy proviruses in HeLa cells and at random chromosomal
locations; the recombination junctions were scattered throughout the vector
terminal repeats with no apparent site specificity; the flanking HeLa DNA at
integration sites was not homologous to AAV or to the site-specific integration
locus of wild-type AAV. Furthermore, vector proviruses with nearly intact
terminal repeats were excised from the genomic HeLa DNA and were amplified
after infection of cells with wild-type AAV and adenovirus.
The integration patterns of four recombinant AAV-2
genomes in individual clonal isolates of the human nasopharyngeal carcinoma
cell line (KB) were different; the difference between the recombinant AAV-2
genomes were in the combinations of the genes for resistance to tetracycline,
to neomycin, to ampicillin, with the genes for AAV replication, and the AAV
capsid genes. None of the KB cell clones examined had the proviral genome
covalently linked to the specific-site of integration of the wt AAV on chromosome
19 (Ponnazhagan et al, 1997a,b).
D. Drawbacks of AAV in gene therapy and their remedy
Gene transfer with AAV vectors has typically been
low. Difficulties in generating recombinant virions on a large scale sufficient
for preclinical and clinical trials and in obtaining high-titer virus stocks
after the initial transfection into producer cells is a limiting factor for the
widespread usage of AAV vectors; this obstacle is expected to be overcome in
the near future. The high viral titers required for preclinical and clinical
studies have been achieved by a new strategy developed by Tamayose et al
(1996); AAV vector particles in cell lysates could be concentrated by
sulfonated cellulose column chromatography to a titer higher than 108
cfu/ml or 5 x 1010 particles/ml. A method for transfecting cells at
extremely high efficiency with a rAAV vector and complementation plasmid while
simultaneously infecting those cells with replication competent adenovirus
using adenovirus-polylysine-DNA complexes has been developed by Mamounas et al
(1995).
The difficulties in developing packaging cell lines
for AAV relate to low levels of rep gene expression from the AAV-p5 promoter
and to the propensity of Rep proteins to suppress continued growth of
immortalized cell lines; expression of AAV rep under control of the LTR of the
human HIV together with the development of cell populations containing
rescuable AAV recombinant genomes increased 50-fold the packaging efficiency of
AAV vectors (Flotte et al, 1995).
After infection of cell cultures with recombinant AAV
there is a decline in the percentage of cells expressing the transferred gene
with time in culture. This decline was associated with ongoing losses of vector
genomes (Malik et al, 1997). For example, transfer to cultures of K562 human
erythroleukemia cells of a truncated rat nerve growth factor receptor (tNGFR)
cDNA as a cell surface reporter under control of the LTR of the Moloney murine
leukemia virus showed that about 30% of cells expressed tNGFR on the surface early
after transduction at a multiplicity of infection (MOI) of 13 infectious units
(IU), which declined to 3% over 1 month of culture. At an MOI of 130 IU, nearly
all cells expressed tNGFR immediately and the proportion of cells expressing
tNGFR declined to 62% over 2 months of culture (Malik et al, 1997).
Another obstacle of rAAV vectors is the low rate of
integration of rAAV into the host genome (which can be improved at high MOI).
The efficiency of integration was about 2% at low MOI (1.3 IU) and increased to
at about 49% at an MOI of 130 (Malik et al, 1997).
E. Advantages using AAV and improvements in AAV gene
delivery
AAV does not elicit an immune reaction and is a
nonpathogenic virus to humans. AAV contains normally a single-stranded copy of
its genome. Transduction with AAV can be enhanced in the presence of adenovirus
gene products through the formation of double stranded, non-integrated AAV
genomes.
AAV has been reported to have advantages over other
viruses for gene transfer to hematopoietic stem cells due to their high titers
and relative lack of dependence on cell cycle for target cell integration. A
robust CMV/LacZ reporter gene expression in primary human CD34+CD2- progenitor cells induced to undergo T-cell
differentiation was obtained without toxicity or alteration in the pattern of
T-cell differentiation. 70% to 80% of the cells isolated from either adult bone
marrow or umbilical cord blood were efficiently transduced with AAV; however,
the expression was transient without integration; this limits the potential use
of AAV in gene therapy strategies for diseases such as AIDS (Gardner et al,
1997).
Gene transduction by AAV vectors in cell culture can
be stimulated over 100-fold by treatment of the target cells with agents that
affect DNA metabolism, such as irradiation or topoisomerase inhibitors (Russell
et al, 1995); great improvements in transduction efficiency can also be
achieved in vivo: previous g-irradiation increased the transduction rate in mouse
liver by up to 900-fold, and the topoisomerase inhibitor etoposide increased
transduction by about 20-fold after direct liver injection or after systemic
delivery via tail vein injection; up to 3% of hepatocytes could be transduced
after a single systemic vector injection (Koeberl et al, 1997). This is a
significant advantage compared to stealth liposomes which , although
concentrating in the liver, spleen and tumors can transduce Kupffer cells but
not hepatocytes after systemic delivery (Martin and Boulikas, 1998, following
article).
A combination of the adenovirus-5 capsid protein or
the Fiber protein of adenovirus with liposomes, termed adenosomes (adenovirus
protein-cationic liposome complexes) improved the efficiency of gene transfer.
This complex was able to mediate efficient transfer of a AAV/CMV-LacZ construct
to endothelial cells (Zhou et al, 1995).
Clark et al (1996) have developed a sensitive assay
system to determine infectivity of AAV vectors based on the replication of
input rAAV genomes rather than transgene expression which depends on the type
of promoter which drives the foreign gene; this system uses a cell line that
expresses AAV helper functions (rep and cap) upon induction by adenovirus
infection.
F. Examples using AAV for gene transfer
AAV will infect a broad number of mammalian cell
lines and has been used as a cloning vector to transduce the NeoR gene
into mammalian tissue culture cells (Hermonat and Muzyczka 1984). Antisense AAV
vectors have been used to inhibit HIV replication (Chatterjee et al, 1992), and
to correct Fanconi's anemia in human hematopoietic cells (Walsh et al, 1994).
AAVs transduce preferentially cells in S phase; topoisomerase inhibitors
increase transduction efficiency (Russell et al, 1995).
Using AAV, the genomic copy of a normal human b-globin gene under control of the DNase
l-hypersensitive site 2 (HS-2) from the locus control region was expressed in
K562 human erythroleukemia cells, which normally lack the b-globin gene; following selection with G418 by virtue
of the neo-resistance function which was provided in the rAAV vector, stable
integration of the exogenous b-globin allele was determined (Zhou et al, 1996).
Similar data were reported by Einerhand et al (1995) transferring a recombinant
AAV-vector containing a human b-globin gene together
with the DNase1 hypersensitive sites 4, 3 and 2 of the human b-globin locus control region as an approach for the
gene therapy of b-thalassemia and sickle cell anemia. The vector
replicated to high titers and could efficiently transduce hematopoietic stem
cells isolated from patients. In order to treat sickle cell anemia Lubovy et al
(1996) have transferred lacZ with a recombinant AAV vector and stably
transduced hematopoietic stem cells purified from normal and homozygous sickle
cell anemia patients.
AAV was able to promote delivery of functional levels
of glial cell line-derived neurotrophic factor (GDNF), in a degenerative model
of Parkinson's disease (Mandel et al, 1997). AAV has also been used for the
transduction of the mouse liver in vivo with Factor IX cDNA as a prelude to
treatment of hemophiliacs (Snyder et al, 1997; Herzog et al, 1997) and for the
human intratracheal instillation of CFTR cDNA into neonatal New Zealand white
rabbits (Rubenstein et al, 1997), and to the lungs of rhesus macaques without
eliciting inflammation (Conrad et al, 1996).
AAV has also been used for the transfer of the human
multidrug resistance gene (hMDR1) cDNA to NIH-3T3 cells followed by selection
of successfully transfected cells based on the drug-resistant phenotype
conferred by the P-glycoprotein efflux pump (see below and Lee et al, 1997,
this volume); integration of MDR1 sequences into the host cell genome was
demonstrated by fluorescent in situ hybridization (FISH) but also the
persistence of nonintegrated AAV-MDR1 episomal plasmids (Baudard et al, 1996).
Introduction of a human globin gene into murine
hematopoietic bone marrow cells ex vivo with a recombinant AAV vector followed
by transplantation of these cells into lethally irradiated congenic mice
sustained a long-term repopulating ability: human globin gene sequences were
detected in the bone marrow and spleen in primary recipient mice for at least 6
months.
Kessler et al (1996) have shown that following a
single intramuscular administration of a recombinant adeno-associated virus
(rAAV) vector, carrying either the lacZ or the human erythropoietin gene into
adult BALB/c mice leads to the local production of the foreign protein in the
muscle for at least 32 weeks; furthermore, human erythropoietin was secreted
and stimulated red blood cell production in the mouse for up to 40 weeks. This
finding was extended by Fisher et al (1997) who arrived to the unexpected
finding that intramuscular injection of highly purified recombinant AAV can
sustain a high level of transgene expression in the absence of adenovirus after
direct injection to the muscle in mice (Figure
4); this expands the potential of AAV for the treatment of inherited and
acquired diseases. Using this approach no humoral or cellular immune responses
were elicited after transfer of lacZ against the neoantigenic E. coli b-galactosidase.
The rAAV genome was integrated at single sites as head-to-tail concatamers into
nuclei of differentiated muscle fibers. Transfer of the lacZ gene using a
highly purified preparation of AAV which was injected into the skeletal muscle
of adult mice in the presence of E2a-deleted adenovirus to enhance transduction
followed by direct visualization of the b-galactosidase by X-gal
histochemistry revealed high transduction of muscle fibers by day 17 associated
with inflammation (Fig 4a and b).
Animals that received the same AAVlacZ in the absence of adenovirus
demonstrated higher levels of transduction that persisted for 240 days (Fig 4c-h).
Figure 4. Purified recombinant AAV-mediated
lacZ gene transfer to the muscle in adult mice sustains a high level of
expression and is inflammation-free. Purified AAVlacZ (1x109 genomes
in 25 ml) was injected into the tibialis
anterior of 5-week-old C57BL/6 mice and tissue was harvested at days 3 (c), 17 (d), 30 (e), 64 (f), and 180 (g, h) post-injection and analyzed by X-gal histochemistry. Samples
of AAVlacZ (1x109 genomes in 25 ml) were
also supplemented with an E2a mutant adenovirus dl802 (5x1010 A260
particles) just prior to injection and tissue was harvested at days 3 (a) and 17 (b) post-injection. Magnification: a-g, X10; h, X5.
Purified
AAVlacZ (175 ml , 1x1012
genomes/ml) was injected into the tibialis anterior of a male rhesus monkey.
Biopsies were taken 14 days post-injection and frozen sections were cut and
stained for b-galactosidase activity (i and j); magnification: I, X5; j, X10.
k and l:
rAAV vector expressing human b-glucoronidase
was injected into the tibialis anterior of 5-week-old C57BL/6 mice (1x109
genomes in 25 ml). 30 days post-injection
the muscle was harvested and frozen sections were cut and stained for b-glucoronidase.
From Fisher KJ, Jooss K, Alston J, Yang Y, Haecker SE, High K, Pathak R, Raper
SE, Wilson JM (1997) Recombinant
adeno-associated virus for muscle directed gene therapy. Nat Med 3, 306-312. Reproduced with the kind permission of the
authors and Nature America, Inc.
AAV-mediated delivery of the lacZ gene by direct
injection to brain tumors which were induced from human glioma cells in nude
mice showed that 30-40% of the cells along the needle track expressed b-galactosidase; subsequent delivery of the
HSV-tk/IL-2 genes to these tumors with AAV and administration of GCV to the
animals for 6 days resulted in a 35-fold reduction in the mean volume of tumors
compared with controls by a significant contribution from the bystander effect
(Okada et al, 1996).
A phase I clinical trial for CF is being conducted at
Johns Hopkins Hospital using AAV (see Kearns et al, 1996, and protocols #165,
166 in Appendix 1).
V. Herpes Simplex Virus-1 (HSV-1) and miniviral
vectors
HSV-1 has a capacity of inserting up to 30 kb of
exogenous DNA which is a clear advantage over the adenovirus (up to 7.5 kb of
exogenous DNA). High titer viral stocks can be prepared from HSV-1. HSV-1 also
displays a wide range of host cells and can infect nonreplicating cells such as
neuron cells in which the vectors can be maintained indefinitely in a latent
state. However, infection with HSV-1 is cytotoxic to cells because of residual
viral proteins produced by the virus. Strategies to circumvent this drawback
led to the development of viral vectors with a very large capacity for
insertion (almost as large as the size of the virus) which depend on defective
helper virus for replication and packaging into infectious virions (see below).
A miniviral vector can combine the advantage of cloning the gene in bacterial
plasmids, the high efficiency of virus-mediated gene transfer, and the
possibility to transfer large genomic DNA fragments including far upstream,
downstream and intronic regulatory elements.
The HSV-1 genome is a 152 kb double-stranded DNA
containing three origins of replication and encoding at least 72 unique
proteins; it consists of a unique long segment replicated from oriL and two
repeats flanking the unique segment each replicated from oriS. Spaete and
Frenkel (1982) have constructed plasmids containing the lytic viral origin of
replication, foreign DNA inserts, and the terminal packaging signal sequences;
in the presence of a wild-type helper virus such an amplicon was amplified into
multimeric tandemly-repeated forms of the original vector by rolling-circle
replication and was packaged into infectious HSV virions (Spaete and Frenkel,
1982). However, the helper virus caused death of the infected cells due to
lytic replication and this system is not amenable to gene therapy.
To circumvent this bottleneck two strategies have
been developed leading to replication-defective helper HSV: (i) a temperature-sensitive system permitted production of virion
stocks at 31o C whereas infection of cells at 37o C
caused inactivation of the helper virus which was incapable of entering the
lytic cycle and allowed delivery of the miniviral vector to the target cell
without causing its death. (ii) In a
different system, the immediately early gene IE3 was deleted from the helper virus; IE3 encodes for a protein (ICP4) essential for early and late viral
gene expression and replication; the helper cell line used for packaging had a
genomic insertion of the IE3 gene of
HSV which was functionally expressed allowing for complementation and for lytic
infection using the IE3-defective HSV
virus (DeLuca and Schaffer, 1987; Geller and Freese, 1990).
Two types of viral vectors have been used for gene
transfer to cancer cells: replication-incompetent vectors expressing a gene
product that leads to the destruction of the tumor or replication-competent
vectors that are inherently cytotoxic to the tumor cells. In order to combine
the two modes of action Miyatake et al (1997) used a defective HSV vector that
consisted of a defective particle, containing tandem repeats of the HSV-tk
gene, and a replication-competent, non-neurovirulent HSV mutant as a helper
virus. When glioma GL261 cells were infected with the tk-defective vector/helper
virus the HSV-TK activity was significantly higher than that in helper
virus-infected cells which contained a single copy of HSV-tk; subcutaneous
injection of these cells to C57BL/6 mice inducing gliomas led to a significant
decrease in tumor size after GCV treatment.
An HSV-1 vector containing a 6.8-kb fragment of the
rat tyrosine hydroxylase promoter (pTHlac) supported a seven- to 20-fold
increase in reporter gene expression in catecholaminergic cell lines compared
to noncatecho-laminergic cell lines. Furthermore, 4 days after stereotactic
injection into the midbrain of adult rats and for a duration of 6 weeks, pTHlac
supported a 10-fold targeting of b-galactosidase
expression to tyrosine hydroxylase-expressing neurons in the substantia nigra
pars compacta compared with pHSVlac; this long term expression was significant
compared to that from pHSVlac which decreased approximately 30-fold between 4
days and 6 weeks after gene transfer (Song et al, 1997); this study also shows
the importance of large control regions in the order of 7 kb in sustaining cell
type-correct gene expression, something feasible with HSV and liposomes but nor
with recombinant retrovirus, adenovirus, or AAV.
VI. HIV vectors for gene transfer
Recent studies have succeeded in exploiting the
deadly HIV-1 virus, after crippling some functions, as a gene delivery vehicle.
An advantage of HIV vectors has been the broad range of tissues and cell types
they can transduce, a property granted because lentiviral vectors are
pseudotyped with vesicular stomatitis virus G glycoprotein. Human lentiviral
(HIV)-based vectors can transduce non-dividing cells in vitro and deliver genes
in vivo; expression of transgenes in the brain has been detected for more than
six months. HIV vectors have been also used to introduce genes directly into
liver and muscle; 3-4% of the total liver tissue was transduced by a single
injection of 1-3 x 107 infectious units (I.U.) of recombinant HIV
with no inflammation or recruitment of lymphocytes at the site of injection.
Whereas expression of green fluorescent protein (GFP), used as a surrogate for
therapeutic protein, was observed for more than 22 weeks in the liver and for
over 8 weeks in the muscle using lentiviral vectors, little or no GFP could be
detected in liver or muscle transduced with the Moloney murine leukemia virus
(Mo-MLV), a prototypic retroviral vector (Kafri et al, 1997).
The development of a stable noninfectious HIV-1
packaging cell line capable of generating high-titer HIV-1 vectors is another
important step towards use of HIV vectors in gene therapy (Corbeau et al,
1996). A hybrid murine leukemia virus-based vector containing U3 and R
sequences from HIV-1 in place of the MLV U3 and R regions gave single
transcriptional unit retroviral vectors under the control of Tat; this vector
has advantages for anti-HIV gene therapy (Cannon et al, 1996).
Although replication-incompetent HIV vectors
displayed a strict CD4+ T cell tropism for gene transfer, a feature
important for AIDS therapy, it was thought to preclude HIV-based vectors for
other gene transfer applications; a two-step gene transfer system, however, was
developed to expand the host range of the HIV vector: in the first step, the
CD4 gene was introduced into target cells using a replication-defective adenoviral
vector; in the second step the CD4-transfected cells were incubated with HIV
vectors which resulted in stable integration and HIV-mediated gene transfer
(Miyake et al, 1996).
An HIV multiply attenuated vector in which the
virulence genes env, vif, vpr, vpu, and nef were deleted was able to deliver
genes in vivo into adult neurons (Zufferey et al, 1997).
HIV-mediated gene transfer was used to transfer the
GFP gene under control of CMV to retinal cells by injection into the subretinal
space of eyes in rats; the GFP gene was efficiently expressed in both
photoreceptor cells and retinal pigment epithelium; predominant expression in
photoreceptor cells was achieved using the rhodopsin promoter. The transduction
efficiency was high and photoreceptor cells in >80% of the area of whole
retina were expressing GFP (Miyoshi et al, 1997).
VII. Epstein-Barr virus (EBV) and baculovirus vectors
EBV is an episomaly-replicating virus in synchrony
with the cell cycle. EBV infects human cells causing mononucleosis; the
presence of the unique latent origin of replication (oriP) in EBV allows for
episomal replication of the virus in human cells without entering the lytic
cycle. The presence of oriP and of the replication initiator protein EBNA1 cDNA
on a vector allows episomal replication in human cells; in addition, plasmids
containing only oriP can replicate episomally into cell lines expressing EBNA-1
(Sun et al, 1994; Banerjee et al, 1995).
A hybrid HSV-1/EBV vector has been developed by Wang
and Vos (1996), which combines (i) the
HSV-1 lytic oriS; (ii) an HSV-1
packaging sequence which allows replication and packaging in the presence of
defective helper virus carrying a deletion in the IE3 gene in the E5 cell line expressing the IE3 gene; (iii) the
latent oriP of EBV and (iv) the EBNA-1 cDNA allow episomal replication
of the infectious vector in the E5 cell line so that viral stocks of high titer
can be made. Infection of tumor-derived fibroblast and epithelial cell lines in
culture and local injection of human liver tumors in nude mice was used to
demonstrate 95-99% efficiency of infection and transfer of the reporter b-galactosidase gene.
Genetically modified baculoviruses (Autographa
californica nuclear polyhedrosis virus) were used to efficiently deliver genes
into cultured hepatocytes of different origin; delivery into human hepatocytes
with baculovirus vectors approached 100% efficiency in cell culture and
expression levels were high when mammalian promoters were chosen. A number of
drawbacks preclude their direct application in vivo; nevertheless gene transfer
was feasible in ex vivo perfused human liver tissue (Sandig et al, 1996;
Hofmann et al, 1998 this volume).
VIII. Liposomal gene delivery
Abbreviations:
DC-CHOL: 3b
[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol
DDAB: dimethyldioctadecyl ammonium
bromide
DMRIE:
N-[1-(2,3-dimyristyloxy)propyl]-N,N-dimethyl-N-(2-hydroxyethyl) ammonium
bromide
DMTAP:
1,2-dimyristoyl-3-trimethylammonium propane
DOGS: Dioctadecylamidoglycylspermine
(Transfectam, Promega)
DOPE: dioleyl phosphatidylethanolamine
DOSPA:
2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl -1-propanaminium
trifluoroacetate
DOTAP:
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
DOTMA: N-[1-(2,3-dioleyloxy)
propyl]-n,n,n-trimethylammonium chloride
DPTAP: 1,2-
dipalmitoyl-3-trimethylammonium propane
DSTAP:
1,2-disteroyl-3-trimethylammonium propane
Lipofectin: DOTMA:DOPE 1:1 (GIBCO BRL)
A. Immune responses and toxicity of cationic
lipid-DNA complexes
Cationic lipids have been widely used for gene
transfer; a number of clinical trials (34 out of 220 total RAC-approved
protocols as of December 1997) use cationic lipids (see Table 4 in Martin and
Boulikas, 1998, this volume, pages 203-206). Although many cell culture studies
have been documented, systemic delivery of genes with cationic lipids in vivo
has been very limited. All clinical protocols use subcutaneous, intradermal,
intratumoral, and intracranial injection as well as intranasal, intrapleural,
or aerosol administration but not i.v. delivery because of the toxicity of the
cationic lipids and DOPE (see Table 4 in Martin and Boulikas, 1998, this
volume, pages 203-206).
Liposomes formulated from DOPE and cationic lipids
based on diacyltrimethylammonium propane (dioleoyl-, dimyristoyl-,
dipalmitoyl-, disteroyl-trimethylammonium propane or DOTAP, DMTAP, DPTAP,
DSTAP, respectively) or DDAB were highly toxic when incubated in vitro with
phagocytic cells (macrophages and U937 cells), but not towards non-phagocytic T
lymphocytes; the rank order of toxicity was DOPE/DDAB > DOPE/DOTAP >
DOPE/DMTAP > DOPE/DPTAP > DOPE/DSTAP; the toxicity was determined from
the effect of the cationic liposomes on the synthesis of nitric oxide (NO) and
TNF-a produced by activated macrophages (Filion and
Phillips, 1997).
Another factor to be considered before i.v.
injections are undertaken is that negatively charged serum proteins can
interact and cause inactivation of cationic liposomes (Yang and Huang, 1997).
Condensing agents used for plasmid delivery including polylysine,
transferrin-polylysine, a fifth-generation poly(amidoamine) (PAMAM) dendrimer,
poly(ethyleneimine), and several cationic lipids (DOTAP, DC-Chol/DOPE,
DOGS/DOPE, and DOTMA/DOPE) were found to activate the complement system to
varying extents. Strong complement activation was seen with long-chain
polylysines, the dendrimer, poly(ethyleneimine), and DOGS; complement
activation was considerably reduced by modifying the surface of preformed DNA
complexes with polyethyleneglycol (Plank et al, 1996).
B. Mechanism of liposome entry to cells
Cationic lipids increase the transfection efficiency
by destabilizing the biological membranes including plasma, endosomal, and
lysosomal membranes; indeed, incubation of isolated lysosomes with low
concentrations of DOTAP caused a striking increase in free activity of b-galactosidase, and even a release of the enzyme into
the medium demonstrating that lysosomal membrane is deeply destabilized by the
lipid; the mechanism of destabilization was thought to involve an interaction
between cationic liposomes and anionic lipids of the lysosomal membrane,
allowing a fusion between the lipid bilayers; the process was less pronounced
at pH 5 than at pH 7.4 and anionic amphipathic lipids were able to prevent
partially this membrane destabilization (Wattiaux et al, 1997).
In contrast to DOTAP and DMRIE which were 100%
charged at pH 7.4, DC-CHOL was only about 50% charged as monitored by a
pH-sensitive fluorophore; this difference decreases the charge on the external
surfaces of the liposomes and was proposed to promote an easier dissociation of
bilayers containing DC-CHOL from the plasmid DNA and an increase in release of
the DNA-lipid complex into the cytosol from the endosomes (Zuidam and
Barenholz, 1997).
C. Tissue targets using cationic liposomes in vivo
Although cationic lipids have been used widely for
the delivery of genes very few studies have used systemic i.v. injection of
cationic liposome-plasmid complexes because of the toxicity of the lipid
component and certainly in animal models, not humans. Administration by i.v.
injection of two types of cationic lipids of similar structure, DOTMA and
DOTAP, has shown that the transfection efficiency was determined mainly by the
structure of the cationic lipid and the ratio of cationic lipid to DNA; the
luciferase and GFP gene expression in different organs was transient, with a
peak level between 4 and 24 hr, dropping to less than 1% of the peak level by
day 4 (Song et al, 1997).
Figure 5 shows the effect of cationic lipid:DNA ratio on
transfection efficiency after i.v. tail injection. Luciferase activity was
detected in all organs examined with the highest level in lung. In the absence
of neutral lipid both DOTMA and DOTAP promoted a linear increase in luciferase
activity in the lung with increasing lipid:DNA from 12:1 to 36:1 nmol lipid: mg of DNA. DOTMA was 10 times more efficient than
DOTAP (106 versus 107 relative luciferase units (RLU) per
mg protein. Cholesterol (Chol) mixed with DOTMA (1:1 molar ratio) decreased the
level of gene expression in the lung whereas cholesterol did not affect the
transfection efficiency of DOTAP liposomes. Inclusion of DOPE into either DOTAP
or DOTMA liposomes significantly decreased the transfection efficiency by
100-fold in the lung.
When a group of four cationic lipids with identical
head group but of different fatty acyl chains were tested for their
transfection efficiencies (Figure 6);
these included DOTAP, DMTAP, DPTAP, and DSTAP. The C14 acyl
chain-lipid DMTAP had a similar transfection efficiency as DOTAP which has 18
carbon atoms in the acyl chain and one double bond (C18D9); on
the contrary, the transfection efficiencies of DPTAP (C16) was
10-100 fold lower and that of DSTAP (C18) was 100 to 1000 fold
lower.
Confocal microscopy of lung tissue after injection of
25 mg pCMV-GFP plasmid DNA complexed with DOTMA liposomes
to mice (Figure 7) has shown that
the type of cells that express the transgene are the endothelial cells that
have typical characteristics of neighboring multiple air-sac structures (Figure 7D).
A number of different organs in vivo can be targeted
after liposomal delivery of genes or oligonucleotides. Intravenous injection of
cationic liposome-plasmid complexes by tail vein in mice targeted mainly the
lung and to a smaller extend the liver, spleen, heart, kidney and other organs
(Zhu et al, 1993). Intraperitoneal injection of a plasmid-liposome complex
expressing antisense K-ras RNA in nude mice inoculated i.p. with AsPC-1
pancreatic cancer cells harboring K-ras point mutations and PCR analysis
indicated that the injected DNA was delivered to various organs except brain
(Aoki et al, 1995).
A number of factors for DOTAP:cholesterol/DNA complex
preparation including the DNA:liposome ratio, mild sonication, heating, and
extrusion were found to be crucial for improved systemic delivery; maximal gene
expression was obtained when a homogeneous population of DNA:liposome complexes
between 200 to 450 nm in size were used. Cryo-electron microscopy showed that
the DNA was condensed on the interior of invaginated liposomes between two
lipid bilayers in these formulations, a factor that was thought to be
responsible for the high transfection efficiency in vivo and for the broad
tissue distribution (Templeton et al, 1997).
Steps to improve for successful liposome-mediated
gene delivery to somatic cells include persistence of the plasmid in blood
circulation, port of entry and transport across the cell membrane, release from
endosomal compartments into the cytoplasm, nuclear import by docking through
the pore complexes of the nuclear envelope, expression driven by the
appropriate promoter/enhancer control elements, and persistence of the plasmid
in the nucleus for long periods. A number of strategies for liposomal delivery
and for enhancing the efficiency of uptake by the cells and release from
endosomal compartments of plasmid or oligonucleotide DNA are reviewed in the
following article (Martin and Boulikas, 1998).
Figure 5. Effect of cationic lipid:DNA
ratio on transfection efficiency after i.v. tail injection. Each mouse received
25 mg of pCMV-Luciferase plasmid DNA
complexed with various amounts of liposomes indicated on the charts (at 1:1
ratio when two lipids were used). Luciferase activity was assayed 20 h after
i.v. injection in up to 5 different tissues represented with different bar
forms: the empty bar is lung, the large stripe bar is spleen, the small stripe
is heart, gray bar is liver, and black bar is kidney. Four time points (12h,
24h, 36h, and 48h from i.v. injection) of luciferase activity are shown.
Numbers +02 to +08 to the left of the figure indicates 102 to 108
relative luciferase units (RLU) per mg protein in the tissue. From Song YK, Liu
F, Chu S, Liu D (1997)
Characterization of cationic liposome-mediated gene transfer in vivo by
intravenous administration. Hum Gene
Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu,
University of Pittsburgh) and Mary Ann Liebert, Inc.
Figure 6. Effect of fatty acyl chain
composition on transfection efficiency. Luciferase activity was assayed 20 h
post-injection in the lung, spleen, heart, liver, and kidney (in the order
shown, see legend to previous figure for bar symbols). From Song YK, Liu F, Chu
S, Liu D (1997) Characterization of
cationic liposome-mediated gene transfer in vivo by intravenous administration.
Hum Gene Ther 8, 1585-1594 with the
kind permission of the authors (Dexi Liu, University of Pittsburgh) and Mary
Ann Liebert, Inc.
Figure 7. Analysis of green fluorescence
protein (GFP) expression in the lung using confocal microscopy. 25 mg pCMV-GFP
plasmid DNA complexed with DOTMA liposomes were injected to mice and GFP
expression in the lung was examined 14 h post-injection . (A): transmitted light image and (B): fluorescence image (green) were observed at low magnification
(Bar 100 mm). C and D are the images
obtained at higher magnification showing the localization of GFP in endothelial
cells (Bar 25 mm). E and F are the images
from control animals injected with pCMV-Luc plasmid rather than GFP plasmid.
From Song YK, Liu F, Chu S, Liu D (1997)
Characterization of cationic liposome-mediated gene transfer in vivo by
intravenous administration. Hum Gene
Ther 8, 1585-1594 with the kind permission of the authors (Dexi Liu,
University of Pittsburgh) and Mary Ann Liebert, Inc.
D. Cationic lipids in oligonucleotide transfer
Encapsulation of oligonucleotides into liposomes
increased their therapeutic index, prevented degradation in cultured cells and
in human serum and reduced toxicity to cells (Thierry and Dritschilo, 1992;
Capaccioli et al, 1993; Morishita et al, 1993; Williams et al, 1996; Lewis et
al, 1996); conjugation to a fusogenic peptide enhanced the biological activity
of antisense oligonucleotides (Bongartz et al, 1994). However, most studies
have been performed in cell culture, and very few in animals in vivo; there is
still an important number of improvements needed before these approaches can
move to the clinic.
Zelphati and Szoka (1997) have found that complexes
of fluorescently labeled oligonucleotides with DOTAP liposomes entered the cell
using an endocytic pathway mainly involving uncoated vesicles; oligonucleotides
redistributed from punctate cytoplasmic regions into the nucleus; this process
was independent of acidification of the endosomal vesicles. The nuclear uptake
of oligonucleotides depended on several factors such as charge of the particle
where positively charged complexes were required for enhanced nuclear uptake;
DOTAP increased over 100 fold the antisense activity of a specific
anti-luciferase oligonucleotide. Physicochemical studies of
oligonucleotide-liposome complexes of different cationic lipid compositions
indicated that either phosphatidylethanolamine or negative charges on other
lipids in the cell membrane are required for efficient fusion with cationic
liposome-oligonucleotide complexes to promote entry to the cell (Jaaskelainen
et al, 1994).
Similar results were reported by Lappalainen et al (1997); digoxigenin-labeled
oligodeoxynucleotides (ODNs) complexed with the polycationic DOSPA and the
monocationic DDAB (with DOPE as a helper lipid) were uptaken by CaSki cells in
culture by endocytosis. The nuclear membrane was found to pose a barrier
against nuclear import of ODNs which accumulated in the perinuclear area.
Although DOSPA/DOPE liposomes could deliver ODNs into the cytosol, they were
unable to mediate nuclear import of ODNs; on the contrary
oligonucleotide-DDAB/DOPE complexes with a net positive charge were released
from vesicles into the cytoplasm; it was determined that DDAB/DOPE mediated
nuclear import of the oligonucleotides.
DOPE-heme (ferric protoporphyrin IX) conjugates,
inserted in cationic lipid particles with DOTAP, protected oligoribonucleotides
from degradation in human serum and increased oligoribonucleotide uptake into
2.2.15 human hepatoma cells; the enhancing effect of heme was evident only at a
net negative charge in the particles (Takle et al, 1997). Uptake of liposomes
labeled with 111In and composed of DC-Chol and DOPE was primarily by
liver, with some accumulation in spleen and skin and very little in the lung
after i.v. tail injection; preincubation of cationic liposomes with
phosphorothioate oligonucleotide induced a dramatic, yet transient,
accumulation of the lipid in lung which gradually redistributed to liver. The
mechanism of lung uptake involved entrapment of large aggregates of
oligonucleotides within pulmonary capillaries at 15 min post-injection via
embolism; labeled oligonucleotide was localized primarily to phagocytic
vacuoles of Kupffer cells at 24 h post-injection; nuclear uptake of
oligonucleotide in vivo was not observed (Litzinger et al, 1996).
Phosphorothioate oligonucleotides were found in most
tissues 48 h after i.p. administration with highest concentrations in kidney
and liver; complexation of the oligonucleotide with DOTMA did not affect
neither the oligonucleotide uptake nor its tissue distribution in normal mice
but increased the oligonucleotide cellular uptake (4-10 times) in LOX ascites
tumors (Saijo et al, 1994).
Triplex-forming ODNs were delivered to cells in
culture using adenovirus-polylysine-ODN complexes designed to take advantage of
the receptor mediated endocytosis of adenoviruses to transfer the ODNs to the
cell nucleus; nuclear uptake peaked at 4 h and intact ODN persisted in the
nucleus with a half-life of 12 h (Ebbinghaus et al, 1996).
E. Fusogenic peptides enhance gene transfer
efficiency
Enveloped viruses have evolved efficient mechanisms
to release their genomes from the endosomes into the cytoplasm of the host
cells; specific envelope proteins of the nucleocapsid are capable of
destabilizing the endosomal membrane. Therefore, inactivated viruses have been
used to enhance the transfer of plasmids. Addition of adenoviral particles
capable of inducing endosome lysis (Blumenthal et al, 1986), mediated by a
conformational change in the adenovirus penton protein induced at the lower pH
of endosomes (Seth, 1994) can increase transfection efficiency 100-1000 fold
using 109 adenoviral particles/ml and the transferrin receptor
(Curiel et al, 1991; Cotten et al, 1992; Wagner et al, 1992b; Cristiano et al,
1993; Morishita et al, 1993; Harries et al, 1993; Curiel, 1994; reviewed by
Ledley, 1995).
Use of fusogenic peptides from influenza virus
hemagglutinin HA-2 enhanced greatly the efficiency of
transferrin-polylysine-DNA complex uptake by cells; in this case the peptide
was linked to polylysine and the complex was delivered by the transferrin receptor-mediated
endocytosis (Wagner et al, 1992a; Plank et al, 1994). This peptide had the
sequence: GLFEAIAGFIENGWEGMID GGGYC and was able to induce the release of the
fluorescent dye calcein from liposomes prepared with egg yolk
phosphatidylcholine which was higher at acidic pH; this peptide was also able
to increase up to 10-fold the anti-HIV potency of antisense oligonucleotides,
at a concentration of 0.1-1 mM, using CEM-SS lymphocytes in culture (Bongartz
et al, 1994). This peptide changes conformation at the slightly more acidic
environment of the endosome destabilizing and breaking the endosomal membrane
(Murata et al, 1992; Bullough et al, 1994). Fusogenic peptides have been used
by other investigators (Midoux et al, 1993; Kamata et al, 1994). It is thought
that several fusogenic peptides self-assemble following their conformational
change forming a transmembrane channel (Bongartz et al, 1994).
Sendai virosomes were effective for delivering AAV
neuropeptide Y (NPY) cDNA constructs in vivo. Injections into brain neocortex of
Sendai-virosome encapsulated rAAV construct expressing NPY increased NPY-like
immunoreactivity in neurons but not glia; injections into the rat hypothalamic
para-ventricular nucleus increased body weight and food intake for 21 days (Wu
et al, 1996). Tomita et al (1996) have found that newborn mice can sustain
expression of the insulin gene delivered by Sendai virus-liposome complexes for
at least 8 weeks as assayed by reverse transcriptase PCR and radioimmunoassay,
compared to 2 weeks in adult animals.
A 27 residue peptide vector, containing the fusion
sequence of HIV gp41 and the nuclear localization sequence of SV40 T antigen
was used to deliver oligonucleotides to cell nuclei very rapidly in cell
culture (1h). The complexes formed strongly increased the stability of the
oligonucleotide to nucleases, enhanced passage through the plasma membrane, and
led to endosomal internalization (Morris et at, 1997).
Certain cationic lipids are endowed with a better
ability to disrupt the endosomal membrane and promote release of the plasmid to
the cytoplasm, a prelude for its nuclear import. Presentation of plasmid DNA to
COS cell cultures using three different lipid formulations: (i) vectamidine
(3-tetradecylamino-N-tert-butyl-N'-tetradecylpropionamidi ne), (ii) DOTMA:DOPE (Lipofectin), and (iii) DMRIE-Chol (1:1) resulted in
complex entry via endocytosis for all three cationic lipids as revealed using
transmission electron microscopy. However, the endosomal membrane in contact
with complexes containing vectamidine or DMRIE-Chol, but not Lipofectin, often
exhibited a disrupted morphology (El Ouahabi et al, 1997).
F. Plasmid condensation with spermine, polylysine,
protamine, histones enhances the transfection efficiency
DNA can be presented to cells in culture as a complex
with polycations such as polylysine, or basic proteins such as protamine, total
histones or specific histone fractions (Fritz et al, 1996), cationized albumin,
and others (Smull and Ludwig, 1962). These molecules increase the transfection
efficiency. In addition to HMG1, also histone H1 and HMG17 were identified as
transfection-enhancing proteins in cell culture (Zaitsev et al, 1997). Histone
H2A significantly enhanced in vitro DNA transfection whereas other histones and
anionic liposomes did not (Balicki and Beutler, 1997). Gene transfer through
the asialo-glycoprotein receptor-mediated endocytosis pathway was enhanced with
the histones H1, H2a, H2b, H3, and H4 which were galactosylated with the
crosslinker agent, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, conjugated to
DNA and then used to transfect HepG2 cells, which display the
asialoglycoprotein receptor (Chen et al, 1994). Plasmid DNA and HMG1 were
efficiently co-encapsulated in liposomes by agitation and sonication, and were
co-introduced into cells by hemagglutinating virus of Japan (HVJ)-mediated
membrane fusion; the presence of HMG1 enhanced 3-fold the transfection
efficiency (Kato et al, 1991).
The interaction of plasmid DNA with protamine sulfate
followed by the addition of DOTAP cationic liposomes offered a better
protection of plasmid DNA against enzymatic digestion and gave consistently
higher gene expression in mice via tail vein injection compared with DOTAP/DNA
complexes; 50 mg of luciferase-plasmid per mouse gave 20 ng
luciferase protein per mg extracted tissue protein in the lung which was
detected as early as 1 h after injection, peaked at 6 h and declined
thereafter. Intraportal injection of protamine/DOTAP/DNA led to about a
100-fold decrease in gene expression in the lung as compared with i.v.
injection; endothelial cells were the primary locus of lacZ transgene
expression (Li and Huang, 1997). Protamine sulfate enhanced plasmid delivery
into several different types of cells in vitro using the monovalent cationic
liposomal formulations (DC-Chol and lipofectin); this effect was less
pronounced with the multivalent cationic liposome formulation, lipofectamine
(Sorgi et al, 1997).
Spermine has been found to enhance the transfection
efficiency of DNA-cationic liposome complexes in cell culture and in animal
studies; this biogenic polyamine at high concentrations caused liposome fusion
most likely promoted by the simultaneous interaction of one molecule of
spermine (four positively charged amino groups) with the polar head groups of
two or more molecules of lipids. At low concentrations (0.03-0.1 mM) it
promoted anchorage of the liposome-DNA complex to the surface of cells and
enhanced significantly transfection efficiency (Boulikas et al, in
preparation).
Because the receptor for ecotropic viruses is a
transporter for basic amino acids, use of a histone as a facilitator increased
the efficiency of retroviral infection (Singh and Rigby, 1996). Polybrene is
the usual agent employed during retroviral infection. For supernate infections,
concentrations of 5-10 mg/ml of protamine provided essentially the same
infection efficiency as polybrene; protamine displayed low toxicity on a range
of cell types and increased 7-fold the efficiency of retroviral infection
(Cornetta and Anderson, 1989).
The polycations polybrene, protamine, DEAE-dextran,
and poly-L-lysine significantly increased the efficiency of adenovirus-mediated
gene transfer in cell culture; this was thought to act by neutralizing the
negative charges presented by membrane glycoproteins which reduce the
efficiency of adenovirus-mediated gene transfer (Arcasoy et al, 1997).
G. Targeted gene delivery
Targeting a specific cell type or animal tissue is an
important goal of gene therapy. Many different approaches have been undertaken
to achieve targeting. A recombinant adenovirus encoding an anti-erbB-2
intracellular single-chain antibody (sFv) displayed a genetic selectivity for
the erbB-2-positive prostate carcinoma cell lines DU145 and LNCaP; delivery of
this recombinant adenovirus resulted in cytotoxicity to the DU145 and LNCaP,
but not PC-3, cell lines and reduced the clonogenic capacity of DU145 cells
cultured alone or mixed with various ratios of irradiated human bone marrow.
This finding led to a strategy for effectively reducing DU145 and
erbB-2-positive primary prostate tumor contamination in bone marrow cultures
(Kim et al, 1997). Delivery of an anti-erbB-2 single chain (sFv) antibody gene
for previously treated ovarian and extraovarian cancer patients is in clinical
trials using adenoviral gene delivery (protocol #133).
A luciferase expression vector (pRSVLuc)
non-covalently linked to a humanized HER2 antibody (rhuMAbHER2) covalently
modified with poly-L-lysine bridges was able to direct gene transfer to HER2
expressing cells in vitro (Foster and Kern, 1997).
A targeting gene therapy approach for hematopoietic
stem/progenitor cells has been directed to cell lines expressing the c-kit
receptor; plasmid DNA containing a luciferase reporter gene was condensed with
polylysine covalently linked to streptavidin (which binds biotinylated ligand)
and with polylysine covalently linked to adenovirus (to achieve endosomal
lysis) with the final addition of biotinylated steel factor; omission of the
adenovirus endosomalytic agent from the vector resulted in the loss of gene
expression (Schwarzenberger et al, 1996).
Systemic administration of a c-fos antisense,
regulated by mouse mammary tumor virus (MMTV) control elements in a retroviral
vector, showed expression only in breast epithelium although the vector could
be detected in several tissues thus supporting targeting to MMTV-regulated
tissues (Arteaga and Holt, 1996).
Liposomes coated with polyethyleneglycol (PEG) can be
efficiently targeted to tumor cells that express folate receptors (KB cells) via
conjugation of folate to a PEG spacer of 25 nm in length; shorter PEG spacers
were not efficient in mediating binding of the liposomes to KB cells (Lee and
Low, 1995).
Neri and coworkers (1997) were able to target an
angiogenesis-associated oncofetal fibronectin (B-FN) isoform by
affinity-matured recombinant antibody fragments. B-FN is present in vessels of
neoplastic tissues during angiogenesis but is absent from mature vessels and
could provide a target for diagnostic imaging and therapy of cancer. Phage
display libraries were screened to isolate human antibody fragments able to
recognize this isoform across species; imaging of F9 murine teratocarcinomas
grafted in nude mice is shown on Figures
8 and 9.
H. Targeted gene delivery with peptide-displaying
phages
Development of methods to display and select
collections of peptides specific for binding a target provide valuable tools to
identification of peptide drugs; peptides could be selected for binding
biological targets including cell surface receptor molecules, DNA, antibodies,
or whole cells. The technique of peptide-displaying phages has been developed
for targeted gene delivery. Selection of cell surface-binding peptides, ideally
specific for each type of cell in the human body, will be used for
incorporation into gene delivery vehicles to achieve the long-searched tissue
specificity of the vector (reviewed by Russell, 1996).
Development of the random peptide library as a source
of specific protein binding molecules (Devlin et al, 1990) and exposure of
random peptides on the surface of phages (Cwirla et al, 1990) has been the
catalyst for progress in this promising field. Libraries of random 8 to 12
amino acid peptides expressed on the N-terminus of the pIII protein of the fd
phage or on the N-terminus of the pVIII major coat protein of the same phage
have been selected that bind the extracellular domain of human IL-1 receptor;
screening was against immobilized IL-1 receptor extracellular domain. Two
families of peptides could act as antagonists blocking triggering of the IL-1
signaling pathway; because IL-1 levels become elevated in autoimmune and
inflammatory disorders, these peptide antagonists of IL-1 receptor could
provide novel drugs for these diseases (Yanofsky et al, 1996).
Phages displaying known integrin-binding peptides
have been shown to bind and enter mammalian cells (Hart et al, 1994). A peptide
antagonist to thrombin receptor has been identified using phage display
(Doorbar and Winter, 1994). Production of cell-targeting ligands has been
achieved by cell-binding peptides specific for different cell types in culture;
these peptides are selected through six rounds of binding (and amplification of
phage clones) to a particular cell type from random peptide-presenting phage
libraries; the selected peptides are apparently recognizing specific surface
receptor molecules. For example, the 20mer peptide KTLTLEAALRNAWLREVGLK has
been selected for its high affinity for PEA10 mouse fibroblast cells binding
1000 more efficiently to the cells than random peptides (Barry et al, 1996).
IX. Gene delivery with polymers, peptides and other
means
A. Delivery of transferrin-polylysine-DNA complexes
A number of polymers have been tested and shown to
enhance significantly the transfection efficiency of plasmids but also of
viruses; the enhancement in transfection results from a facilitation in the
interaction of plasmids with the cell surface, transport to endosomes, release
to the cytoplasm, and in some cases nuclear import (reviewed by Behr, 1994).
Figure 8. Role of antibody valence. ¨ Targeting
of fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma
grafted in nude mice using the monomeric scFv(CGS-1) and dimeric scFv(CGS-1)2
directed to oncofetal fibronectin; the dimeric scFv(D1.3)2 with a
binding specificity to lysozyme was used as a negative control. t: tumor; b:
bladder. From Neri D, Carnemolla B, Nissim A, Leprini A, Querze G, Balza E,
Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G (1997) Targeting by affinity-matured recombinant antibody fragments
of an angiogenesis associated fibronectin isoform. Nat Biotechnol 15, 1271-1275. Reproduced with the kind permission
of the authors (Dario Neri, Inst for Mol Biology and Biophysics, ZŸrich) and
Nature America, Inc.
 Figure 9. Role of antibody affinity. Targeting of
fluorescently-labeled antibody fragments to the F9 murine teratocarcinoma
grafted in nude mice using the affinity-matured scFv(CGS-2) and the lower
affinity scFv(28SI) directed to the same epitope of oncofetal fibronectin; Tte
dimeric scFv(D1.3)2 with a binding specificity to lysozyme was used
as a negative control. t: tumor; b: bladder. From Neri D, Carnemolla B, Nissim
A, Leprini A, Querze G, Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L,
Winter G (1997) Targeting by
affinity-matured recombinant antibody fragments of an angiogenesis associated
fibronectin isoform. Nat Biotechnol
15, 1271-1275. Reproduced with the kind permission of the authors (Dario Neri,
Inst for Mol Biology and Biophysics, ZŸrich) and Nature America, Inc.
Curriel and coworkers (1991) have used the
transferrin receptor on the surface of mammalian cells to deliver
plasmid-polylysine-transferrin complexes to cells. These complexes are taken up
by endosomes following receptor binding, a method which suffers from that the
endocytosed DNA is trapped in the intracellular vesicle and is later largely
destroyed by lysosomes; use of the capacity of the adenoviruses to disrupt
endosomes as part of their entry mechanism to the cells have augmented over
1000-fold the efficiency of gene transfer. This method has been further
developed in collaboration with Max Birnstiel; true chemical coupling rather
than simple addition of replication-defective adenovirus particles has shown a
further increase in transfection efficiency (Cotten et al, 1992; Wagner et al,
1992a,b).
A monoclonal antibody against the CE7 antigen (chCE7)
covalently linked to polylysine in the presence of chloroquine was able to
transfect NB cells as efficiently as DOTAP, transfectam, TF-X50, or
lipofectamine; furthermore, transfection was not observed in cell lines
negative for the CE7 antigen (Coll et al, 1997).
B. Polyethylenimine (PEI, ExGen500)
Polyethylenimine, H2N-(CH2-CH2-NH)n-H,
is an organic polymer with a potential for high cationic charge. PEI enhanced
transfection efficiency in cell culture (Boussif et al, 1996). ExGen500 is a
linear 22 kDa form of PEI, which was found to be more efficient than
lipofectin, DOTAP and DOGS in delivering the luciferase reporter gene in both
newborn and adult rabbit lungs (Ferrari et al, 1997). The PEI 800 kDa and PEI
25 kDa branched polymers have also been used to transfer marker genes to the
newborn and adult mouse brain (Boussif et al, 1995; Abdallah et al, 1996).
Another advantage of PEI is that it yields high transfection efficiencies with
a charge ratio of DNA:PEI close to neutral; this is an advantage as particles
with a net positive charge (cationic lipid-DNA complexes) interact with
circulating serum proteins or anionic components of the extracellular matrix in
the various tissues hindering their bio-availability (Schwartz et al, 1995).
The high transfection efficiency of ExGen 500 was
suggested to arise from the Òproton spongeÓ effect which leads to osmotic
swelling of endosomes which have uptaken the DNA complexes (Ferrari et al,
1997).
Different cationic compositions may result in
different targeting and transfection abilities to specific organs; the
branched, 25-kD polyethylenimine polymer (PEI 25k) was superior over DOTAP and
DOGS (Transfectam) in the efficiency
of transfection of the kidney when complexes of these cations with luciferase
plasmid were injected into the left renal artery of rats; luciferase activity
peaked at 2 days, was still significantly higher than controls at 7 days, but
was undetectable at 14 days post-injection (Boletta et al, 1997).
Scanning force microscopy allowed plasmid DNA strands
to be visualized without drying in incomplete condensates prepared with varying
stoichiometries of lipospermine or polyethylenimine in physiological solution;
discrete nucleation centers of condensation were observed often surrounded by
folded loops of DNA using either condensing agent; increasing the amount of
lipospermine or polyethylenimine led to further aggregation through folding
rather than winding of the DNA (Dunlap et al, 1997).
C. APL PolyCat57 and other polymers
APL PolyCat57 is a synthetic polyamino derivative
(nonpeptide, nonlipid polymer) with a glucose backbone which was used by
Goldman and coworkers (1997) for gene transfer in vivo and in vitro. A variety
of human carcinoma cell lines were transfected with an efficiency superior to
that of Lipofectamine. The polymer-plasmid complex was resistant to inhibition
by serum allowing for efficient gene transfer in vivo. The level of the
luciferase and b-galactosidase reporter gene expression after
intrathecal injection, evaluated in animal models bearing stereotactically
implanted D54-MG human glioma cell xenografts, was comparable to that obtained
with an adenoviral vector.
Liposomes composed of the cationic peptide amphiphile
N,N-dihexadecyl-N a-[6-(trimethyl ammonio)- hexanoyl]-L-alaninamide bromide comprising an
L-alanine residue interposed between a charged head group and a double-chain
segment were more effective and less toxic than lipofectin, and DOTAP for the
transfection of COS-7 cells (Kato et al, 1996).
D. Adenovirus-polymer complexes
An adenovirus/DNA complex was constructed by
chemically linking poly-L-lysine to the capsid of the replication-defective
adenovirus dl312; this complex was then coupled with plasmid DNA via ionic
interaction. This system was used to deliver the tumor suppressor protein p53
to the p53- human lung cancer cell line H1299, both in vitro and in
vivo, leading to induction of apoptosis; injection of the complex carrying the
p53 gene to subcutaneous tumor sites 5 days after tumor cell implantation
resulted in a significant inhibition of tumorigenicity as measured by the
number and size of tumors that developed 21 days after treatment (Nguyen et al,
1997a,b).
Complexes of cationic polymers and cationic lipids
with adenovirus increased adenovirus uptake and transgene expression in cells
that were inefficiently infected by adenovirus alone; infection by both
complexes was independent of adenovirus fiber and its receptor, occurred via a
different cellular pathway than adenovirus alone, and enhanced gene transfer to
the nasal epithelium of cystic fibrosis mice in vivo (Fasbender et al, 1997).
E. Peptides in transfer of oligonucleotides
Peptide/oligonucleotide complexes containing a
peptide vector and single or double stranded oligonucleotides were delivered
into cultured mammalian cells in less than 1 h with relatively high efficiency
(90%) at a peptide/oligonucleotide ratio of 20/1. The peptide vector, termed
MPG (27 residues), contained a hydrophobic domain derived from the fusion
peptide of HIV gp41 and a hydrophilic domain derived from the nuclear
localization sequence of SV40 T-antigen. The complexes involved electrostatic
interactions between basic peptide residues and phosphate groups from the
oligos, as well as additional peptide-peptide interactions yielding
oligonucleotides most likely coated with several molecules of MPG; these
complexes, which strongly increased the stability of the oligonucleotide to
nucleases, enhanced passage through the plasma membrane, and did lead to
endosomal internalization; such complexes are promising delivery systems for
oligos (Morris et at, 1997).
The cationic amphipathic peptide WEAKLAKALA
KALAKHLAKALAKALKACEA was synthesized by Wyman et al (1997) to display hydrophobic leucine residues on one
side and hydrophilic lysine residues on the other after coiling to an
amphipathic a-helix at pH 7.5; this peptide was suited for oligonucleotide nuclear
delivery when complexes were prepared at a 10/1 (+/-) charge ratio and was
endowed with the additional property of destabilizing membranes in cell
culture.
F. Plasmoviruses
Plasmoviruses are plasmids capable of expressing all
the viral genes required for generating infectious particles and packaging a
defective genome; transfected as plasmids, plasmoviruses transform the
transduced cells into packaging cells; the cells then release infectious
replication-defective retrovirus particles of typical type C as revealed by
electron microscopy, with the gag proteins correctly processed in the released
particles and containing the transgene to be transferred. Released particles
are capable of infecting nearby cells and to propagate the transgene in the
culture, resulting in stable integration of plasmovirus proviral DNA into the
host genome of infected cells. Nonintegrated plasmovirus DNA was not toxic for
the cells. Plasmoviruses have been used for the propagation of the HSV-tk gene
in cell culture resulting in a major improvement in therapeutic efficacy after
ganciclovir treatment, when compared to that of plasmovirus constructs that
cannot propagate (Morozov et al, 1997).
G. Particle-mediated gene transfer (PMGT) or gene gun
The particle-mediated gene transfer (PMGT) technique, unlike retroviral
transfection, does not require tumor cell proliferation in vitro for gene
transfer; instead, tumor tissue can be dissociated into small tissue clumps or
cell aggregates and then immediately transfected using the gene gun; plasmid-coated
gold particles are delivered to tumor cells using helium pressure with a
hand-held gene delivery device overcoming the cumbersome exposure of the
patient to viral antigens. PMGT with gold particles coated with human GM-CSF
plasmid DNA is being used to transfect melanoma or renal carcinoma tissue from
patients; tumor cells are then lethally-irradiated and patients are
intradermally vaccinated to elicit anti-tumor immune responses (Mahvi et al,
1997).
Gene gun-mediated DNA delivery into the epidermis
overlying an established intradermal murine tumor was used to compare the
antitumor effect of several transgene expression plasmids encoding the
cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF; IL-12 was superior (see IL-12)
(Rakhmilevich et al, 1997).
X. Direct injection of naked plasmid DNA
Naked plasmid has been injected to various tissues
and has shown transfection efficiency. Muscle has been the classical tissue in
a number of studies. Intramuscular (i.m.) administration of expression plasmids
may directly deliver the plasmid to the cytoplasm by damaging the myofibril
along the injected area. Direct i.m. injection of naked VEGF plasmid DNA was
used in rabbits to optimize treatment of acute limb ischemia; after ligation of
distal external iliac artery in New Zealand White rabbits, direct injection of
500 mg of a VEGF165 expression vector into the
ischemic thigh muscles resulted in more angiographically recognizable
collateral vessels at 30 days posttransfection (Tsurumi et al, 1996,
1997). Injection, guided by
intense illumination along the longitudinal axis of the mouse quadriceps muscle
and parallel to the myofibers, yielded 200-fold higher levels of luciferase
expression than perpendicular injection (Levy et al, 1996).
Other tissues including skin, liver, brain and the
gastric submucosa have been successfully transduced with reporter gene cDNA
using naked plasmid delivery. Skin from transglutaminase 1 (TGase1)-deficient
patients suffering with lamellar ichthyosis was regenerated on nude mice;
repeated in vivo direct injections of naked DNA using a TGase1 expression
plasmid showed restoration of TGase1 expression in the correct tissue location
(Choate and Khavari, 1997).
A naked luciferase expression vector injected
intracerebrally in mice provided expression of the luciferase transgene, in
both neurons and glia cells (Schwartz et al, 1996). Naked plasmid DNA in
hypertonic solutions, injected intraportally in mice whose hepatic veins were
transiently occluded, resulted in high levels of luciferase and b-galactosidase expression in 1% of the hepatocytes
throughout the entire liver using 100 mg DNA (Budker et al,
1996).
A single injection through the tail vein of a naked
endothelium-derived nitric oxide cDNA plasmid caused a significant reduction of
systemic blood pressure for 5 to 6 weeks in spontaneously hypertensive rats
(Lin et al, 1997). In vivo delivery
of a luciferase gene under control of the human cytomegalovirus immediate early
gene promoter after intravenous injection (50 mg
DNA) via the tail vein into ICR mice has shown that the DNA was degraded with a
half-life of less than 5 min from the blood; plasmid DNA was differentially
retained in the lung, spleen, liver, heart, kidney, bone morrow, and muscle up
to 24 h postinjection; femtogram levels of plasmid were detected only in muscle
at 6 months post infection (Lew et al, 1995). pCAT was rapidly degraded after
incubation with mouse whole blood in vitro with a half-life of approximately 10
min and much faster after intravenous injection; i.v. injection of
radioactively-labeled pCAT showed rapid elimination from the plasma due to
extensive uptake by non-parenchymal cells in the liver, a process thought to be
mediated via scavenger receptors on these cells (Kawabata et al, 1995).
Direct injection of plasmids carrying reporter genes
into
the gastric submucosa of adult rats resulted in transient expression (1-3 days
and in exceptional cases for up to 21 days) in smooth muscle cells of the
muscularis mucosae and the muscular layer and mesenchymal cells in the lamina
propria. These studies indicate that the gastrointestinal nonepithelial tissue,
a useful target for in vivo gene transfer, can be transfected with naked DNA
(Takehara et al, 1996).
Clinical protocols #158-161 use naked plasmid DNA.
Protocol #158 proposes transferring the carcinoembryonic antigen to autologous
tumor cells in patients with metastatic colorectal cancer for cancer
immunotherapy (Appendix 1, page
170). Protocols 159 and 160 use an intraarterial angioplasty catheter to
deliver VEGF cDNA plasmid to patients with peripheral artery disease or
restenosis. Plasmid DNA coding for
tumor idiotype is being used for intramuscular injection for immumotherapy of
non-HodgkinÕs B-cell lymphoma (protocol #161).
Table 1 summarizes the advantages and disadvantages of the
principal gene delivery methods.
Table 1. Advantages and drawbacks of delivery systems
|
Gene deliv. system |
Advantages |
Drawbacks |
|
Murine retroviral vectors |
Very safe; may achieve high
efficiency of transduction; infects only dividing cells; integrates into host
DNA. |
Loss in expression soon after
infection; low efficiency in vivo; up to 8 kb of DNA; high titers required
for in vivo gene delivery; immunogenicity. |
|
Recombinant adenoviruses |
Infect nondividing cells; rarity
of recombination events between adenoviral vectors and the host chromosomes;
high efficiency of transduction; adenovirus vectors efficiently escape from
the endosome and enter the nucleus; episomaly-replicating virus. |
Induction of immune responses
that eliminates therapeutic cells; may induce unwanted infections to humans;
only up to 7.5 kb of exogenous DNA can be inserted; loss of adenoviral
episomes in progeny cells. |
|
AAV |
Does not stimulate inflammation
or immune reaction; enters nondividing cells and does not replicate;
nonpathogenic virus. |
Low efficiency of gene transfer;
only up to 4.1 and 4.9 kb can be incorporated; wt AAV integrates on
chromosome 19 but recombinant AAV integrates at different sites (e.g.
chromosome 2); integration may cause inactivation of the transgene by
chromatin effects. |
|
HSV-1 |
Can take up to 30 kb of
exogenous DNA; high titer viral stocks; wide range; can infect nonreplicating
cells |
Infection with HSV-1 is
cytotoxic. |
|
Baculovirus |
Specificity for hepatocytes;
high efficiency of infection |
Not applicable in vivo at
present. |
|
EBV |
Episomaly-replicating virus |
wt EBV infects human cells
causing mononucleosis. |
|
HIV-1 |
Transduces non-dividing cells;
broad range of tissues and cell types; no inflammation; sustains expression
of GFP for 8-22 weeks in muscle and liver after injection to animals |
Start up technology, not broadly
tested. |
|
Hybrid HSV/EBV |
High efficiency of infection
(95-99% after intratumoral liver injection) |
Not broadly tested. |
|
Cationic lipids |
High efficiency of transfection
via membrane destabilization (cell membrane and endosomal); destabilize
lysosomal membranes and promote release of plasmid in the cytoplasm. |
Toxic, not suited for i.v.
injection; can interact with negatively charged serum proteins in vivo
causing transgene inactivation; gene expression is transient; i.v. injection
targets mainly the lung |
|
Stealth liposomes |
Non toxic, escape immune
surveillance and concentrate into solid tumors by extravasation. |
Not taken up by tumor cells but
remain in the extracellular space. |
|
Naked plasmid DNA |
Suited for intramuscular
injection and DNA vaccination; easy to use; no viral antigens. |
Low transfection; not widely
applicable method; naked plasmid is cleared from blood rapidly. |
|
Gene gun |
Easy to use (plasmid-coated gold
particles are delivered to tumor cells using helium pressure); rapid, suited
for gene transfer to tumor specimens from patients for immunotherapy. |
Not broadly tested. |
XI. Promoters and enhancers for transgene expression
A. Viral promoters
After escaping serum components and immune cells,
crossing the cell membrane, released from endosomes to the cytoplasm and
transported through the nuclear pores to the nucleus the transgene has to
accomplish two additional tasks: (i) to be efficiently transcribed and (ii) its
expression to last for long periods. These two very important factors depend on
the DNA regulatory elements that drive the expression of the therapeutic gene.
The use of mammalian gene expression vectors has revolutionized the field of
direct gene delivery. The proper choice of promoter and enhancer elements
linked to the gene of interest is decisive for the successful expression of the
gene in the desired tissue or cell type in gene therapy.
The majority of mammalian expression vectors make use
of promoter/enhancer elements from pathogenic viruses including the immediately
early promoter of the human cytomegalovirus (CMV), the Rous sarcoma virus (RSV)
promoter, the enhancer/origin of replication of SV40, the adenovirus type 2
major late promoter (Ad-MLP), as well as promoters from the mouse mammary tumor
virus (MMTV), human immunodeficiency virus (HIV), herpes simplex virus (HSV),
Epstein-Barr virus (EBV), and others.
Many studies have compared the strength of different
promoters in driving a therapeutic gene both in cell culture and in vivo. I
will mention a few sample studies here. Recombinant adenoviruses carrying the
HSV-tk gene under control of the human cytomegalovirus (CMV) immediate early
gene promoter or the adenovirus type 2 major late promoter (Ad-MLP) were compared
for their killing efficiency in combination with GCV treatment; the rat 9L
model for brain tumor and leptomeningeal metastases was used; the adenovirus
containing the CMV promoter showed greater cell killing efficiency compared to
the Ad-MLP promoter; animals with brain tumors showed significantly longer
survival time and animals with leptomeningeal metastases had symptom-free
periods (Vincent et al, 1997).
Doll et al (1996) have compared the efficiency of
expression of the b-galactosidase gene flanked by the AAV ITRs in brain
tumors and primary brain cell cultures driven by four different promoters. The
human CMV immediate-early enhancer/promoter was always the strongest, generally
by at least one order of magnitude, compared with the SV40 early enhancer/promoter,
the JC polymovirus promoter, and the chicken b-actin
promoter coupled to the CMV enhancer. High level of expression was usually seen
within 24 h of transgene delivery by either transfection or infection, but
dropped dramatically within days; all four promoters showed the same decline in
sustaining gene expression of b-galactosidase with time
(Doll et al, 1996).
The type of regulatory elements on plasmid vectors,
including promoter, enhancer, intron, and polyadenylation signals, were
systematically evaluated by Yew et al (1997) by constructing a series of
plasmids. Figure 10 shows the effect
of different introns (panel A) and different poly(A) signals (panel B) on CAT
expression. A hybrid intron (HI) appeared to be the most effective. There was a
4-fold increase in CAT expression from the bovine growth hormone (BGH) poly(A)
signal vector compared to the SV40 poly(A) signal vector.
Figure 10. Effect of different introns (A) and polyadenylation signals (B) on CAT expression. ELM cells were
co-transfected with equimolar amounts of each plasmid using DMRIE:DOPE and CAT
protein levels in cell lysates were assayed 48 h after transfection; pCMVb was used
as an internal control. SVI is the SV40 19S/16S intron; HI, hybrid intron, SV40
pA, SV40 late polyadenylation signal; BGH, bovine growth hormone
polyadenylation signal; b-Glo,
rabbit b-globin polyadenylation
signal. The data are expressed as mean ±SD (n=3). From Yew NS, Wysokenski DM,
Wang KX, Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors
for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the
authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Figure 11. Comparison of CAT expression
from different promoters in vitro. ELM cells (solid bars) or CFT1 cells
(stippled bars), a human airway epithelial cell line derived from a CF patient,
were transfected as described in Figure 10. CAT ELISA assays were carried out
48 h after transfection (an average of 6 assays). CAT protein levels were
normalized to pCF1-CAT (in A) or pCMVHICAT (in B). A. Expression from plasmids containing the BGH poly(A) signal. SPC,
Surfactant protein C promoter; NOS, nitric oxide synthase promoter; UbB,
ubiquitin B promoter; MUC1, mucin 1 promoter; IL8, interleukin 1 promoter; CE,
CMV enhancer; pCAT control is a promoterless CAT plasmid. B. Expression from plasmids containing the SV40 poly(A) signal.
CC10, Clara cell 10 kDa protein promoter; E1a, adenovirus E1a promoter. The
data are expressed as mean ±SD (n=3-12). From Yew NS, Wysokenski DM, Wang KX,
Ziegler RJ, Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors
for high-level expression in lung epithelial cells. Hum Gene Ther 8, 575-584. Reproduced with kind permission of the
authors (Nelson Yew, Genzyme Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Figure 11 compares the strength of different promoters from
CAT constructs containing the bovine growth hormone (BGH) poly(A) signal (panel
A) or the SV40 poly(A) signal (panel B) and the hybrid intron. The promoters
were chosen for lung targeting. CMV yielded the highest expression in vitro. To
determine whether or not incorporating two CMV enhancers could produce higher
levels of CAT expression than one, a second CMV enhancer (from -118 to -522
relative to the transcription start site) was inserted 186 bp upstream of the
CMV promoter and its associated enhancer; in the context of the SV40 poly(A) signal
the second CMV enhancer (CE in Figure 11) increased expression 3-fold; however,
when the BGH poly(A) signal was present, the second copy of CMV did not
increase CAT expression (Figure 12).
B. Transcription factor binding sites within the CMV
promoter
Because of its wide use and the more potent effect,
the CMV IE enhancer/promoter deserves some special attention. In order to
understand the potent effect of the CMV promoter in the expression of foreign
genes we need to understand the transcription factors (TFs) that activate this
regulatory region; TFs in the transfected cell will be responsible for binding
to the CMV promoter leading to the activation of the transgene. At present not
all TF regulatory circuits leading to activation of CMV have been deciphered. Figure 13 shows two CMV promoters
retrieved from Genbank which are being used in expression vectors.
The CMV IE promoter includes the 10-bp palindromic
sequence CCATATATGG (Figure
13) which resembles the core motif of serum response elements and proved to
bind specifically to the cellular nuclear protein serum response factor (SRF).
Reporter gene constructs containing four tandem copies of these elements
displayed up to 13-fold increased basal enhancer activity and 18-fold
tetradecanoyl phorbol acetate responsiveness in U937 cells (Chang et al, 1993).
Figure 12. Effect of a second CMV enhancer region on CAT
expression from the CMV promoter. Plasmids were transfected into ELM cells and
the cells were harvested 48 h after transfection. Expression was normalized to
pCMVHICAT (in B). A. CAT protein
levels in cell lysates. RE, RSV LTR enhancer. B. Levels of CAT RNA. Total RNA was isolated from the transfected
cells and a quantitative RNA protection assay was performed. The data are
expressed as mean ±SD (n=3-9). From Yew NS, Wysokenski DM, Wang KX, Ziegler RJ,
Marshall J, McNeilly D, Cherry M, Osburn W, Cheng SH (1997) Optimization of plasmid vectors for high-level expression in
lung epithelial cells. Hum Gene Ther
8, 575-584. Reproduced with kind permission of the authors (Nelson Yew, Genzyme
Corp., Framingham, MA) and Mary Ann Liebert, Inc.
Two multicopy basal enhancer motifs within the simian
CMV IE enhancer, namely, 11 copies of the 16-bp cyclic AMP response element
(CRE) and 3 copies of novel 17-bp serum response factor (SRF) binding sites
referred to as the SNE (SRF/NF-kB-like element), as well as four classical NF-kB sites within the human CMV promoter, contributed to
TPA responsiveness; the SNE sites of the simian CMV promoter contain potential
overlapping core recognition binding motifs for SRF, Rel/ NF-kB, ETS, and YY1 class transcription factors but fail
to respond to either serum or tumor necrosis factor a; the TPA responsiveness of both human and simian CMV
elements proved to involve synergistic interactions between the core SRF
binding site (CCATATATGG) and the adjacent inverted ETS binding motifs
(TTCC),
which correlated directly with formation of a bound tripartite complex
containing both the cellular SRF and ELK-1 proteins. This protein complex was
more abundant in U-937, K-562, and HeLa cell extracts than in Raji, HF, BALB/c
3T3, or HL-60 cells. A 40-fold stimulation of chloramphenicol acetyltransferase
activity mediated by four tandem repeats of the SNE could be induced within 2 h
(and up to 250-fold within 6 h) after addition of TPA in DNA-transfected U-937
cells, indicating that the stimulation appeared likely to be a true protein
kinase C-mediated signal transduction event rather than a differentiation
response (Chan et al, 1996). These studies demonstrate that different cell
types are expected to sustain different levels of expression from CMV and that,
for cell culture transfections, PKC transduction pathways are likely to
stimulate transgene expression from CMV promoters. These findings have
important implications for promoter choice in gene therapy.
7TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTAttgacgtcaaTGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTG803
Figure 13A. The CMV promoter sequence from
plasmid pRL-CMV, 4079 bp (nucleotides 7-803, Promega) (LOCUS AF025843)
37TCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTAATGTTGGACATGAGCCAATATAAATGTACATATTATGATATGGATACAACGTATGCAATGGGCCAA695
Figure 13B. The CMV IE promoter (nucleotides
37-695, 658 bp) from the expression vector pCMVtkLUC+ (ACCESSION
AF027129). ttgacgtcaa is the binding
site of HB16; GGGACTTTCC is the binding site for HIVEN 86A (two sites); CCATATATGG is the SRF binding
site; TTCC
is the ETS core motif; three CATTGACG motifs in each sequence are in bold-face
(see Boulikas, 1994 for more references).
A closely related family of ubiquitous DNA binding
proteins, called MDBP, binds with high affinity to two 14 base pair (bp) sites
within the human cytomegalovirus immediate early gene 1 (CMV IE1) enhancer;
these MDBP sites did not require cytosine methylation for optimal binding;
mutation of one of the enhancer MDBP sites to prevent MDBP recognition modestly
increased the function of a neighboring CREB binding site in a transient
transfection assay (Zhang et al, 1995). Furthermore, the CMV promoter competed
with the Egr1 promoter for transcription factors or co-factors which might be
required for activation by WT1; WT1 was converted from an activator to a
repressor by co-transfection of an excess of the parental CMV-based vector
(Reddy et al, 1995).
C. Tissue-specific promoters in gene therapy
A number of studies have used tissue-specific
promoters and enhancers from mammalian genes in order to attain a cell
type-specific expression of the transgene. The discovery of genes which are
expressed at high levels in specific tumor cell types has prompted the idea of
the use of their promoter or enhancer DNA sequences to express in this
particular cancer cell type therapeutically important genes (Venkatesh et al,
1990; Brady et al, 1994; Dimaio et al, 1994; Osaki et al, 1994; Pang et al,
1995).
Examples include the expression of the suicidal CD gene under control of the regulatory
regions of the tumor marker gene carcinoembryonic antigen (Richards et al,
1995), the expression of HSV-tk gene,
under control of a-fetoprotein enhancer and albumin promoter, into adult liver cells in
transgenic animals (Su et al, 1996), the expression of b-galactosidase in tyrosine hydroxylase-expressing
neurons in the substantia nigra midbrain of adult rats using the tyrosine
hydroxylase promoter (Song et al, 1997), and the expression of the lacZ marker
gene under control of the murine pancreatic amylase promoter in the pancreas in
neonatal and adult mice (Dematteo et al, 1997). Transduction of the human LDL-R
cDNA under the transcriptional control of the liver-type pyruvate kinase
promoter allowed high and tissue specific expression of the gene in primary
hepatocytes (Pages et al, 1996b).
Fibroblasts, infected with recombinant retroviruses
and selected with G418 for the expression of the vector carrying the
therapeutic gene, have been used for the ex vivo treatment in animal models;
when the therapeutic gene was either under control of the viral LTR or an
heterologous internal promoter, expression of the transgene from the integrated
retrovirus was shut off (Scharfmann et al, 1991). The use of the dihydrofolate
reductase housekeeping gene promoter which is expressed in all cell types, led
to sustained expression, albeit at very low levels (Scharfmann et al, 1991); it
appears that the combination of a suitable enhancer and promoter for a
particular cell type and the method of introduction of the transgene is crucial
for sustained expression.
Combination of the mouse muscle creatine kinase
enhancer with the human cytomegalovirus promoter to drive the expression of the
canine factor IX gene in ex vivo infected mouse primary myoblasts
led to the expression of factor IX and its secretion in the blood of mice
transplanted with these myoblasts for over 6 months; however, the levels of
factor IX protein secreted into the plasma (10 ng/ml for 107
injected cells) were not sufficient to be of therapeutic value (Dai et al,
1992).
Joki and coworkers (1995) have used the promoter of
the early growth response gene 1 (EGR-1, also known as Zif/268, TIS-8, NFGI-A,
or Krox-24) to confer selective expression of the luciferase gene in glioma
cell lines exposed to ionizing radiation; a 10-fold higher activity in
luciferase activity was found after irradiation of the cells which was
detectable at 1-3 h after stimulation with 20 Gy (stereotactic radiosurgery
during treatment of isolated brain metastases, arteriovenous malformations,
meningiomas, craniopharyngiomas, and glioblastomas uses a single dose of 20-30
Gy). Transfection of the HSV-tk gene
under control of the EGF-1 promoter
rendered irradiated, but not nonirradiated, cells sensitive to GCV. Irradiation
induces DNA repair, cell cycle arrest, and reinitiation of DNA synthesis in
surviving cells; g-radiation also induces higher levels of a number of
proteins including p53, AP-1, NF-kB, TNF, IL-1, and EGF-1.
Therefore, use of the EGF-1 promoter
can activate gene expression selectively in radiation fields and could be used
to drive the expression of cytotoxic genes (HSV-tk) for the killing of cancer
cells.
Peptides containing the three zinc fingers of Zif268
could efficiently repress activated transcription from promoter constructs
prepared with Zif268 binding sites inserted at various positions with respect
to the TATA box (Kim and Pabo, 1997); such strategies could find important
applications in gene therapy leading to construction of artificial promoters
able to activate or repress transcription of transferred genes. A potent hybrid
CAG promoter was used to drive the HSV-tk gene and showed effective eradication
of pancreatic tumors in animal xenografts (Aoki et al, 1997).
D. Molecular switch systems
The ability to regulate gene expression via exogenous
stimuli will facilitate the study of gene functions in mammalian cells.
Molecular switch systems have been devised (Wang et al, 1994) allowing the
researcher to turn on or off individual genes; the switch used by Delort and
Capecchi (1996) is composed of three elements: (i) the inducible UAS promoter, a synthetic promoter containing
five GAL4 response elements, normally absent from mammalian genomes; (ii) the synthetic hybrid steroid
receptor (TAXI), composed of the GAL4 DNA -binding domain, a truncated human
progesterone receptor, and the acidic region from VP16 protein of HSV; the
hybrid molecule activates transcription from the UAS promoter when bound to an
inducer drug, and (iii) the
synthetic nontoxic drug inducer RU486 which is permeable to blood-brain and
placental barriers; this model allows up to 100-fold induction of a gene linked
to this system and can be finely tuned to lower levels of induction (Delort and
Capecchi, 1996).
Transient cotransfection of HeLa cells with the
UAS-CAT and the hybrid receptor expression vector showed that the hybrid TAXI
protein bound to the UAS promoter only after treatment with RU486 but not
progesterone; the TAXI/UAS system was successfully used in transgenic mice to
regulate the expression of a human growth hormone gene; the ex vivo approach,
however, did not sustain long-term expression of the transgene. This system might
allow physicians to alter the level of expression of foreign genes during
somatic cell transfer in response to the clinical state of the patient (Delort
and Capecchi, 1996).
Iida et al (1996) have modified the
tetracycline-controlled inducible system by the addition of the ligand-binding
domain of the estrogen receptor to the carboxy terminus of the tTA
transactivator; a single retroviral vector could transduce both the transactivator
gene and the gene of interest controlled by the tTA-inducible promoter into
mammalian cells; cell lines expressing the transactivator were established
where the expression of a gene (the toxic G protein of vesicular stomatitis
virus) depended on the removal of tetracycline and the addition of estrogen.
A different genetic switch used consisted of the
cytochrome P450 1A1 promoter driving the expression of the human apolipoprotein
E (apoE) gene in transgenic mice; this switch system was induced by b-naphthoflavone; the inducer could pass
transplacentally and via breast milk from an injected mother to her suckling
neonatal pups, giving rise to the induction of human apoE in neonate plasma and
lowering the cholesterol levels in hypercholesterolemic pups (Smith et al,
1995).
XII. DNA recombination in gene therapy
A. Mechanisms of DNA recombination
Genetic recombination, i.e., exchange of segments of
DNA between two molecules of DNA, is a very frequent event. It often occurs during meiosis and also between homologous
chromosomes in mitosis. Homologous
recombination involving double-strand DNA breaks (DSBs), has similarities to
mechanisms of repair of DSB lesions by cells. Specific recombinases have played
and continue to play an important role in molecular evolution and genome
shuffling; deregulation in recombination procecess is connected to chromosomal
aberrations (inversions, translocations) in cancer. The double-strand-break
repair model was put forward by Szostak and collaborators (1983) to explain
genetic recombination in yeast. Recent studies (reviewed by Stahl, 1996) have
isolated the recombination intermediate molecules predicted by the DSB repair
model; in this model, a 5Õ-3Õ exonuclease is responsible for the removal of
segments of single strands starting bidirectionally from the DSB followed by
invasion, repair synthesis and ligation to give the joint molecule which is
then reduced to a pair of duplexes by a Holliday junction resolvase.
The development of mature lymphocytes in mammals
results from a complex combination of genetically preprogrammed events and
interactions with antigens. Shared
in its general mechanisms by both B (bone marrow) and T (thymus) lymphocytes
this developmental program involves a series of cell migration gene
rearrangements, cell-to-cell contacts, as well as positive and negative
selection processes; recombination mechanisms take place at the immunoglobulin
and the T cell receptor genes to generate a large number of immunoglobulin
genes in different lymphocyte clones. One site-specific recombination event
brings together the V and the J segments of the light chain immunoglobulin
genes. In the case of the heavy
chain genes, one recombination event joins a V to a D segment, sequentially
followed in a time frame by the joining of the recombined V-D segment to a J
segment. Recent studies have shown that the mechanism of V(D)J recombination is
a two-step process involving: (i) site-specific
DNA cleavage at the 7mer sequence and at the first nucleotide of the coding
sequence, implicating the RAG-1 and RAG-2 proteins which are necessary and
sufficient for this step (van Gent et al, 1996); (ii) joining of broken ends in a mechanism similar to the repair
of double strand breaks. The murine SCID locus has provided crucial information
in the elucidation of the second step in V(D)J recombination: thymocytes in
SCID mice are able to catalyze joining of signal ends but display an
accumulation of hairpin coding ends (Zhu et al, 1996). The murine SCID locus
has been mapped to the gene encoding the catalytic subunit of DNA-dependent
protein kinase (DNA-PK) (Kirchgessner et al, 1995).
Group I introns from a variety of organisms contain
long open reading frames (ORFs) that encode site-specific DNA endonucleases
which promote integration of their DNA into cognate sites via homologous
recombination. These endonucleases typically cleave intron-lacking DNA near the
site of intron insertion (exon-exon junction) creating a staggered DSB which
facilitates intron invasion (intron homing). This mechanism has been
demonstrated in mitochondria, chloroplasts and nuclei of eukaryotic cells.
I-CreI is a member of this class of molecules that promotes homing of the
chloroplast 23S rRNA intron in Chlamydomonas
reinhardtii ; I-CreI contains once the LAGLI-DADG motif (whereas other
members of the family contain two copies of this motif separated by 90-120
amino acids); this motif is important for the endonuclease activity of the
molecule. DNA cleavage by I-CreI requires Mg2+ or Mn2+ and is inhibited by monovalent
cations, has an optimum for catalytic activity of 50-55oC, is
stabilized by DNA and binds to 12 nt on each target strand (Wang et al, 1997).
B. Aberrant recombinations can result in human
disease
Mammals carry about 1,000,000 copies of Alu sequences
and 10,000 to 100,000 copies of complete and truncated versions of the L1 class
of LINEs. Such sequences promote homologous recombination causing
translocations of genes and have been hold responsible for a number of human
disorders. Alu sequences are found in introns. One type of mutation in the LDL
receptor gene responsible for familial hypercholesterolemia has incurred by
Alu-Alu recombination deleting several exons and thus producing a truncated
receptor molecule with loss of function (Lehrman et al, 1987). De novo insertions of an L1 element into
the factor VIII gene can cause hemophilia A in humans (Kazazian et al, 1988).
Foreign DNA transferred to host cells may be rejected
(degraded), integrated at random sites by illegitimate recombination,
integrated at homologous sites by legitimate recombination, or remain
extrachromosomal and replicate autonomously. The homologous recombination between chromosomal DNA and
transfected DNA sequences, an event termed "gene targeting," can be
used to correct mutated genes in cultured cells.
It has been known for a long time that the
translocation of an active gene to the neighborhood of heterochromatin
(transcriptionally inert part of the genome) results in silencing of the
translocated gene, a process known as "position effect variegation",
first described in Drosophila (Lewis, 1950; Wilson et al, 1990).
Chromosomal translocations seem to contribute to
tumorigenesis either by activating proto-oncogenes to oncogenes or by
inactivating tumor suppressor genes. Mammalian chromosomes contain a number of
break-susceptible or fragile sites where breakage can be induced reproducibly
by experimental manipulations. Such fragile sites might lie in the neighborhood
of transposable elements, hypervariable minisatellites or other DNA structural
peculiarities such as Z-DNA, and other hotspots of recombination (reviewed by
Haluska et al., 1987).
Nonrandom chromosome rearrangements, observed in a
variety of human and animal tumors are associated with the enhanced expression
or deregulation of cellular oncogenes. For
example, the human c-myc oncogene
becomes active following its translocation close to the enhancer sequence
within the immunoglobulin heavy chain gene locus (Hayday et al., 1984). The
chromosomal translocation (17;19) in acute lymphoblastic leukemia produces a
chimeric transcription factor consisting of the amino-terminal portion of the
helix-loop-helix proteins E12/E47 fused to the DNA binding and leucine zipper
dimerization motifs of the liver-specific protein factor Hlf (Hepatic leukemia
factor), normally not expressed in lymphoid cells (Hunger et al., 1992). In
pre-B cell acute lymphoblastic leukemia (ALL) the t(1;19) translocation brings
together two gene fragments encoding for transcription factors and results in
the synthesis of a chimeric transcription factor composed of truncated E2A and
Pbx1 (Kamps et al., 1991).
C. Exploitation of recombinases in gene therapy: the
Cre/LoxP system
A strategy has recently been developed which
facilitates culturing of human cells derived from primary tumors. This method
is based on the transient expression of T antigen of SV40 which has been shown
to immortalize primary cells of human and murine origin and on the use of
bacteriophage recombinase Cre which catalyzes sequence-specific recombination
at the LoxP sequence inducing permanent deletion of T antigen cDNA; indeed, if
two LoxP sequences were provided as direct repeats the intervening sequence
could be deleted during Cre recombination and lost from cells. This is an
advantage for primary cell cultures because the continuous expression of SV40
large T antigen may alter the antigenicity of the cells and induce other type
of mutations not associated with the original tumor; according to this strategy
large T antigen can be expressed in a time-dependent way (Li et al, 1997).
Figure 14 shows the structure of the two retroviral vectors
used by Li et al (1997) to facilitate culturing of primary tumor cells and Figure 15 the change in morphology as a
result of Cre-Puro retrovirus-induced loss of expression of T antigen in T
antigen-immortalized primary cell cultures of mouse breast cancer cells.
Figure 14. Structure of retroviral vectors
LoxP-HyTK-large T and Cre-puro allowing expression of T antigen and
Cre/LoxP-catalyzed deletion of T antigen cDNA. The 4 small arrows indicate the
primers used for PCR analysis; the large arrow above the NLS-CRE box indicates
the Cre recombinase mediating LoxP specific deletion. LTR are the long terminal
repeats of Moloney Murine Leukemia virus; LOX is the 34 bp sequence identical
to the recognition site of Cre recombinase; HyTK is the hygromycin/thymidine
kinase fusion gene; NLS-CRE is the Cre recombinase gene targeted to the nucleus
by a nuclear localization signal (NLS); SV40 is the SV40 promoter; Puro is a
puromycin selection marker. From Li LP, Schlag PM, Blankenstein T (1997) Transient expression of SV 40
large T antigen by Cre/LoxP-mediated site-specific deletion in primary human
tumor cells. Hum Gene Ther 8,
1695-1700. Reproduced with the kind permission of the authors and Mary Ann
Liebert, Inc.
Figure 15. Large T antigen-immortalized
breast cancer cells change morphology and lose expression of T antigen after
infection with Cre-Puro retrovirus: after prolonged culture the cells were
infected with Cre-Puro retrovirus (B, D)
or mock-infected (A, C), selected
for Puromycin resistance (A, B, C, D) and resistance to ganciclovir (B, D) and
analyzed by light microscopy (A, B) and staining with a large T-antibody (C,
D). From Li LP, Schlag PM, Blankenstein T (1997)
Transient expression of SV 40 large T antigen by Cre/LoxP-mediated
site-specific deletion in primary human tumor cells. Hum Gene Ther 8, 1695-1700. Reproduced with the kind permission of
the authors and Mary Ann Liebert, Inc.
Reversible immortalization of primary cells was
achieved by Westerman and Leboulch (1996) using retrovirus-mediated transfer of
an oncogene that could be subsequently excised by site-specific Cre/LoxP
recombination; the FLP/FRT recombination was not efficient in primary cells.
Pure populations of cells in which the oncogene was permanently excised were
obtained which reverted to their preimmortalized state. Using the Cre/LoxP
recombination strategy primary cells could be cultured and expanded; the method
was proposed to be applicable for facilitating gene transfer to cells
unresponsive to exogenous growth factors.
A retroviral vector, containing both a neomycin
resistance expression unit flanked by loxP sites and GM-CSF cDNA, was used to
transduce the human hematopoietic K-562 cell line. Superinfection of K562 cell
clones with a retrovirus containing a Cre recombinase expression unit and
molecular analyses of 30 doubly transduced subclones showed a strict
correlation between Cre expression and LoxP-flanked selectable cassette
excision; excision of the selectable cassette resulted in a significant
increase of GM-CSF transcription driven by the retroviral promoter (Fernex et
al, 1997).
Novel retroviral vectors for gene transfer were
developed by Bergemann et al (1995) by inserting two LoxP sites into a
retroviral vector also containing the HSV-tk gene; Cre expression in cells
infected with this vector was followed by BrdU selection for cells in which
site-specific recombination took place. Furthermore, replacement of the
enhancer/promoter elements in both LTRs by Lox sequences led to the development
of retroviral suicide vectors for gene therapy. Vanin et al (1997) have used
the Cre/LoxP recombinase system to generate high-titer retroviral producer cell
lines; incorporation of LoxP sites at the flanks of a NeoR-HSV-tk
cassette in the proviral DNA allowed excision of these selectable markers
through expression of Cre recombinase and the production of a high-titer
producer cell line containing a single LoxP site flanked by the viral LTRs.
Retransfection of this cell line with a plasmid containing a gene of interest
flanked by LoxP sites and the Cre expression vector allowed insertional
LoxP/LoxP recombination of the gene into the favorable preexisting site in the
genome and the generation of a new line with a titer equivalent to that of the
parental producer cell line. The Cre/LoxP recombinase strategy has been used to
generate retroviral vectors with the ability to excise themselves after
inserting a gene into the genome (Russ et al, 1996).
Bushman and Miller (1997) fused retroviral integrase
enzymes to sequence-specific DNA-binding domains and investigated target site
selection by the resulting proteins. A fusion protein composed of HIV integrase
linked to the DNA-binding domain of l repressor was able to
direct selective integration of retroviral cDNA in vitro into target DNA
containing l repressor binding sites. A fusion of HIV integrase
to the DNA binding domain of the zinc finger protein Zif268 also directed
increased integration near Zif268 recognition sites.
Introduction of foreign DNA into cell nuclei with
recombinase cDNA and appropriate sequences to promote recombination may promote
nor only insertion of a therapeutic gene into a specific chromosomal site but
also chromosomal rearrangements that could convert therapeutically transduced
cells into malignant. There is a great deal of knowledge to be derived from
these very promising strategies of gene therapy before they can be successfully
applied to humans.
XIII. Fate of the transgene in the nucleus
A. How to sustain transgene expression?
A major drawback in gene therapy applications is loss
in gene activity within a few days from gene transfer although all previous
steps were successful. In other words, the transferred gene is transiently
expressed for 1-4 days and its expression thereafter declines dramatically.
This is due (i) to the degradation
of the gene in the nucleus; (ii) the
dilution of the plasmid during replication of the cells from its inability to
replicate; (iii) its inactivation by
position effects from chromatin surroundings after its integration into the
chromosomal DNA; (iv) the
elimination of the therapeutic cells expressing the transgene by the immune
system of the organism either because of the antigenicity of the expressed
protein or because of the antigenicity of viral proteins, an effect often
associated with adenoviral and retroviral gene delivery.
A number of strategies are being pursued to solve
these problems. Sustaining the expression of a transgene into somatic cells
for, lets say, 6 months would mean than a gene therapy treatment would need to
be repeated twice a year, for example to a hemophilia patient or to a patient
who has undergone balloon treatment after coronary heart disease and is being
treated via arterial gene transfer.
An approach to sustain expression of the transgene is
via episomal replication of the plasmid carrying the transgene for long periods
of time, maintaining the plasmid in high copy numbers, and in a form
replicating in synchrony with the cell cycle; even better a plasmid can be
replicated continuously independently of the cell cycle, an approach to find
application in the transfection of nondividing cells by plasmids (which to date
is a virtue of adenoviruses, AAV, and HIV-1 vectors; see Table 1).
A way to sustain expression of the transgene could be
achieved via targeted integration into one or several different chromosomal
locations and the insulation of the transgene from neighboring chromatin
domains using special classes of DNA sequences able to act as insulators and
maintain independent realms of gene activity (such as matrix-attached regions,
MARs). In this case flanking of the foreign gene by two MAR sequences is
expected to insulate it against position effect variegation and prevent
inactivation of the gene at the chromatin level by chromatin condensation or
other mechanisms propagated from the neighboring domains at the integration
site (Boulikas, 1995b).
Several studies have shown that linearization of
plasmids with restriction enzymes favor highly their integration into the
host's genome compared with supercoiled, covalently-closed plasmid DNA. Free
ends of DNA are known to promote recombination and a number of nuclear proteins
including p53, poly(ADP-ribose) polymerase, ligases I and II, Ku antigen,
DNA-dependent protein kinase are known to bind to free ends of DNA, whereas
other molecules such as helicases and endonucleases are known to function
during repair of lesions in DNA inducing the appearance of strand breaks;
especially important in this aspect are members of the RAD50-57 family of
proteins involved in recombination and in repair of double-strand breaks.
B. Episomal plasmids for gene transfer
Integration or replication of a foreign gene
introduced as a plasmid into mammalian cells is a very rare event; plasmid DNA
resides transiently in the nucleus as an episomal, extrachromosomal element for
short periods of time after transfection of cells in culture (usually up to one
or very few days) during which transcription can take place; after that the
episomal DNA is degraded and lost permanently from the cells.
Viral origins of replication have been introduced
into the same plasmid as the reporter gene and found to increase the
persistence of expression. A polyoma virus-based plasmid containing the polyoma
virus origin of replication and the T antigen gene, as well as the neoR gene was
maintained extrachromosomally in mouse embryonic stem (ES) cells at 10-30
copies per cell for at least 74 cell generations in the presence of G418
(Gassmann et al, 1995).
Prolonged episomal persistence may be an advantage
for gene therapy of nondividing cells. A limited number of studies in gene
transfer have used plasmids able to replicate episomally. Most of the plasmids
used contain viral origins of replication but also the gene of the replication
initiator protein that after its expression in the host will interact with the
origin of the plasmid to maintain a relatively high copy number of plasmids
which will persist for some time. The advantage using episomal replication of
plasmids is enormous in somatic human gene therapy as it can sustain expression
of a transgene for a few months after a single injection of the plasmid as
compared to the loss of expression after about 1-10 days (maximum at day 2)
following injection of nonepisomal plasmids (Zhu et al, 1993). Thierry and
coworkers (1995) have succeeded in sustaining the expression of the luciferase
reporter gene in mice for up to 3 months after a single intravenous injection
of a plasmid including the human papovavirus BKV early region and origin of
replication, the large tumor antigen (T antigen) as the replication initiator
protein, and the late viral capsid proteins in the same construct harboring the
luciferase gene; this plasmid was shown to be replicated extrachromosomally for
2 weeks in the lung.
Episomal replication of a hybrid HSV-1/EBV vector was
achieved when the latent oriP of EBV and the EBNA-1 cDNA, which encodes for the replication initiator protein of
EBV, were included in the vector (Wang and Vos, 1996).
Expression of viral replication initiator proteins
(e.g. T antigen) is oncogenic. Of special interest in human gene therapy is to
determine human DNA sequences able to sustain the extrachromosomal replication
of plasmids into permissive human cells for longer periods. Such DNA sequences
known to act as origins of replication, although poorly understood, have been
found in human, monkey, and other mammalian genomes and could be used to
sustain the replication of the plasmid thus increasing its copy number in the
cell and the time of its persistence (see page 122-123).
To this end, a technology has been developed in our
laboratory that permits us to isolate human origins of replication (ORIs) and
to include selected ORIs together with the cDNA of the replication initiator
protein responsible for activating this particular ORI, in plasmids with
therapeutic genes (Boulikas et al, in preparation).
C. Considerations of chromatin structure of plasmids
during gene delivery
Almost all supercoiled plasmids used in gene
transfer, as produced in bacteria, are under negative supercoiling. Immediately
after their import into nuclei plasmids are packaged into nucleosomes that
absorb and constrain part or most likely all of the negative supercoils. This
is true assuming that no cuts on the DNA are introduced during its passage
through the cell membrane barrier to cytoplasmic lysosomes before entering
nuclei; if DNA is cut the supercoils on the plasmid will be relaxed. Nicked DNA
might be repaired and ligated in nuclei by DNA ligases and be subject to the
same constrains as chromosomal DNA. Use of linear plasmids is expected to
stimulate recombination during repair of double strand breaks (also would
increase degradation of the plasmid in the nucleus and loss of the transgene)
ultimately resulting in plasmid integration at variable chromosomal loci,
determined to some extend by the nature of the free ends of DNA and the short
terminal sequence of the DNA at the ends as well as the type of recombinase
molecules in the cell type used.
Treatment of cell cultures with sodium butyrate
inducing hyperacetylation of core histones would reverse in part the relieving
of the negative torsional strain by the wrapping of the plasmid around histone
octamers and will provide DNA in a negatively superhelical of underwound form
able to sustain transcription of the template (Schlake et al, 1994).
D. Overcoming the influences of chromosomal
surroundings at plasmid integration sites
Use of two MARs each flanking the reporter gene on
either side is expected to form a minidomain after integration of the foreign
gene into a chromosomal site. MARs potentiate the effect of promoters and
enhancers when two MAR elements are placed one upstream and the other
downstream from control elements but not between them. MARs will (i) shield reporter genes from the
influences of chromosomal surroundings that most often cause inactivation of
foreign genes. This effect of chromatin structure on neighboring sequences is
known as position effect variegation. Indeed about 85% of the chromosomal sites
are transcriptionally inactive assuming that 15% of the genomic DNA is
transcribed; however, even integration of a foreign gene into an active
chromatin locus may not warrantee its transcriptional activation as other
parameters, such as proximity of the integration site to the natural promoter
and enhancer elements of the active chromatin domain, or orientation of the
integrated gene with respect to the active gene in the chromosomal DNA may
determine its level of expression. (ii) MARs
will maintain a supercoiled DNA topology within the domain thus increasing the
negative supercoiling at local promoter and enhancer sites, a prerequisite for
efficient transcription (see Boulikas, 1995b).
XIV. Transfer of reporter genes
A. Transfer of the b-galactosidase (lacZ) reporter gene
Before a gene therapy preclinical study or even gene
transfer to cells in culture begins it is essential to test the variables and
pinpoint the conditions leading to the success of the operation using reporter
gene transfer. LacZ, encoding the b-galactosidase (b-Gal) from E. coli is one of the most commonly used
reporter genes. A staining procedure for this enzymatic activity can result in
the generation of blue color using X-Gal as a substrate leading to the direct
visualization of its activity, for example, in thin sections through animal
tissues.
Transfer of the reporter b-galactosidase gene to human liver tumors in nude
mice was performed by Wang and Vos (1996) using a hybrid HSV-1/EBV vector which
replicates episomally when the latent oriP of EBV and the EBNA-1 cDNA were included.
Many mammalian tissues, especially intestine, kidney,
epididymis,
and lung contain endogenous b-Gal, a lysosomal enzyme participating biochemically
in glycolipid digestion. Weiss et al (1997) were able to detect mammalian b-Gal activity on histochemical preparations of mouse,
rat and baboon lung tissue (Figure 16)
and also to distinguish between the endogenous and bacterial b-Gal activity in airway epithelial cells in the
transgenic Rosa-26 mouse in based upon the differences in pH optima between the
mammalian and bacterial enzymes (Figure
17). Time and temperature of exposure to X-Gal could not be used to
distinguish between endogenous and exogenous b-Gal
activity; thus, exposure of tissue preparation to pH 8.0-8.5, which minimized
detection of the endogenous activity allowed unambiguous discrimination and was
the method of choice to detect reporter b-Gal activity.
Figure 16. Endogenous mammalian b-Gal activity
was detected in minced lung preparations from a variety of species following
incubation with X-Gal in PBS. Representative fields from paraffin-embedded
sections are shown. Original magnification 400X. Airway epithelium, alveolar
macrophages and several unidentified cell types are stained blue and are,
therefore, positive for b-Gal
activity. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection of b-galactosidase
activity in lung: assessment of X-Gal reagent in distinguishing lacZ gene
expression and endogenous b-galactosidase
activity. Hum Gene Ther 8,
1545-1554. With the kind permission of the authors (Daniel Weiss, Fred
Hutchinson Cancer Research Center) and Mary Ann Liebert, Inc.
Figure 17. Endogenous mammalian b-Gal
activity was not detected following incubation with X-Gal at pH>7.5 whereas
bacterial b-Gal activity was detected
at pH 8.0-8.5 in airway epithelial cells in the transgenic Rosa-26 mouse.
Original magnification 250X. From Weiss DJ, Liggitt D, Clark JG (1997) In situ histochemical detection
of b-galactosidase activity in lung:
assessment of X-Gal reagent in distinguishing lacZ gene expression and
endogenous b-galactosidase activity. Hum Gene Ther 8, 1545-1554. With the
kind permission of the authors (Daniel Weiss, Fred Hutchinson Cancer Research
Center) and Mary Ann Liebert, Inc.
Table 2. Reporter gene transfer in vivo
|
Gene delivered |
Human disease |
Vector |
Method/Goal |
Results |
Reference |
|
CAT and
luciferase |
none |
DOTMA:
DOPE |
Expression
of reporter genes in mouse tissues after a single intravenous injection. |
CMV
promoter was most effective; expression in vascular endothelia, extravascular
and parenchymal cells present in lung, spleen, and heart; lower expression in
all other tissues; persisted for 9 weeks. |
Zhu et
al, 1993 |
|
Luciferase/CMV
construct and lacZ |
none |
Transfectam
(DOGS:DOPE) |
To show
effectiveness in gene transfer after intracranial injection of
liposome-plasmid complexes into the newborn mouse. |
Transient
expression of luciferase in striatal parenchymal cells; lipospermine:DNA
charge ratio of 2 or smaller was most effective in vivo. |
Schwartz
et al, 1995 |
|
Luciferase/CMV |
none |
Cationic
liposomes |
Distribution
of luciferase gene expression among tissues and persistence of expression
after systemic injection. |
Use of
viral origins of replication and T antigen cDNA in vector sustained
expression up to 3 months primarily in the lung in mice. |
Thierry
et al, 1995 |
|
lacZ and
HSV-tk/IL-2 |
glioma |
AAV |
Direct
injection of tumors induced from human glioma cells into the brains of nude
mice. |
30-40% of
the cells along the needle track expressed b-galactosidase;
administration of GCV to the HSV-tk/IL-2 treated animals for 6 days, resulted
in a 35-fold reduction in the mean volume of tumors compared with controls. |
Okada et
al,. 1996 |
|
lacZ and
human erythropoietin |
none |
AAV |
Single
intramuscular injection into adult BALB/c mice. |
Protein
expression was detected in myofibers for at least 32 weeks; dose-dependent
secretion of erythropoietin and corresponding increases in red blood cell
production in mice persisted for up to 40 weeks. |
Kessler
et al, 1996 |
|
lacZ |
Retinal
degeneration; retinitis pigmentosa |
AAV |
Subretinal
injection of recombinant AAV particles encoding lacZ. |
Successful
transduction of all layers of the neuroretina as well as the retinal pigment
epithelium; the efficiency of transduction of photoreceptors was
significantly higher than that achieved with an equivalent adenoviral vector. |
Ali et
al, 1996 |
|
lacZ |
Inherited
hearing disorders |
AAV |
To assess
the feasibility of introducing genetic material directly into the peripheral
auditory system; infusion into the cochlea of guinea pigs. |
Thin
sections of cochleae showed intense immunohistochemical reactivity in the
spiral limbus, spiral ligament, spiral ganglion cells and the organ of Corti
but much weaker staining in the contralateral ear. |
Lalwani
et al, 1996 |
|
lacZ |
ParkinsonÕs
disease |
HSV-1 |
Stereotactic
injection into the midbrain of adult rats. |
A 6.8-kb
fragment of the rat tyrosine hydroxylase promoter supported a 7- to 20-fold
increase in reporter gene expression in catecholaminergic tyrosine
hydroxylase-expressing neurons in the substantia nigra. |
Song et
al, 1997 |
|
lacZ |
Leptomeningeal
cancer |
AAV |
To test
the feasibility of AAV-mediated gene therapy. |
Successful
transduction of medulloblastoma (DAOY) cells in a nude rat model of
leptomeningeal disease. |
Rosenfeld
et al, 1997 |
|
lacZ |
vascular
disorders |
AAV |
To
develop gene therapies for vascular disorders by gene transfer into isolated
segments of normal and balloon-injured rat carotid arteries. |
Comparable
gene transfer into medial and adventitial cells, with significantly higher
efficiency of transduction in injured compared with normal vessels. |
Rolling
et al, 1997 |
|
human
placental alkaline phosphatase (AP) |
lung
disease |
AAV |
To assess
the ability of AAV vectors to transduce airway cells; AP gene was delivered
to one lobe of the rabbit lung using a balloon catheter. |
AP
staining was almost exclusively in the epithelial and smooth muscle cells in
the bronchus at the region of balloon placement; staining was in ciliated
cells but was also in basal cells and airway smooth muscle cells. |
Halbert
et al, 1997 |
A phase I study involving six patients with
inoperable lung cancer and an endobronchial lesion accessible by bronchoscopy
was initiated to evaluate the feasibility, tolerance, and clinical effects
using adenoviral delivery of the Escherichia
coli lacZ marker gene driven by the RSV promoter; biopsy specimens of the
tumor and surrounding mucosa in 5 patients were tested positive for b-galactosidase expression (Tursz et al, 1996).
B. Transfer of the luciferase and green fluorescent
protein (GFP) reporter genes
A synthetic polyamino derivative was used by Goldman
and coworkers (1997) to transfer the luciferase and b-galactosidase reporter genes in animal models
bearing stereotactically implanted human glioma cell xenografts. The luciferase
reporter gene was transferred in both newborn and adult rabbit lungs using
polyethylenimine (Ferrari et al, 1997).
Thierry and coworkers (1995) have succeeded in
sustaining the expression of the luciferase reporter gene in mice for up to
three months using episomal vectors (Table
2).
GFP has been used as a reporter molecule for gene
expression because it fluoresces green after blue-light excitation. However,
many attempts by Hanazono et al (1997) to isolate stable retroviral producer
cell clones secreting vectors containing GFP (after transfer of the neoR gene
and selection in G418) have failed because stable GFP-clones were undergoing
major rearrangements or other mutations which abrogated GFP expression and
prevented vector production.
Additional studies using reporter gene transfer are
summarized on Table 2.
DIVISION TWO: GENE THERAPY OF CANCER
XV. Cancer immunotherapy and tumor vaccines
A. The molecular basis of cancer immunotherapy
Many human tumors are nonimmunogenic or weakly
immunogenic. The immune system, evolved to rid the body of unwanted intruders,
could be instructed and reinforced to eliminate cancer cells. Increasing the
immunogenicity of tumors by causing local cytokine production or by increase in
the expression in MHC antigen can lead to local antitumor effect (Tepper et al,
1989; Fearon et al, 1990). Indeed, immune surveillance is of the major defense
mechanisms against cancer; immunosuppressed individuals are more prone to
cancer and nude mice, lacking immune response, are exploited in the lab to
elicit tumors after injection of tumorigenic cells, a response that, in many
cases, cannot be elicited in normal mice.
Cells undergoing malignant transformation are
believed to be eliminated from the body by white blood cells including natural
killer cells (NK), lymphokine-activated killer cells (LAK), cytotoxic T
lymphocytes (CTL), tumor-infiltrating lymphocytes (TIL), and activated
macrophages; since established cancers in the human body may escape this
potential defense mechanism of immunologic surveillance, cancer patients have
been treated with IL-2 to stimulate their cellular immune mechanisms to kill
cancer cells; lengthy and complete remissions, however, were at a low rate and
complications were encountered by the toxicity caused by the systemic
administration of IL-2 (Rosenberg, 1992).
Transfection of the IL-2 gene into human melanoma cells increased cellular immune
response (Uchiyama et al, 1993). This and similar approaches have established
the foundation of the ex vivo cancer immunotherapy by transfer of autologous
(cancer patientÕs) cells after transduction in vitro with cytokine genes (see
below). The ultimate goal is the activation of tumour-specific T lymphocytes
capable of rejecting tumour cells from patients.
B. Cancer immunotherapy with tumor infiltrating
lymphocytes (TILs)
Ex vivo approaches in immunotherapy have been aimed at
isolating T cells directly from tumors (known as tumor infiltrating lymphocytes
or TILs), stimulate TILs to proliferate in cell culture with IL-2 followed by
their reintroduction into the blood stream of advanced cancer patients
(Rosenberg et al, 1988). The adoptive transfer of TILs was 50-100 times more
potent than that of lymphokine-activated killer (LAK) cells isolated from the
patient's tumors. Treatment of 20 patients with TILs after their expansion in
vitro, plus IL-2, resulted in objective regression of metastatic melanomas in
lungs, liver, bone, skin, and subcutaneous sites which lasted for several
months (Rosenberg et al, 1988).
TILs were also transfected in vitro with the
bacterial neomycin-resistance gene and were reintroduced into patients with
advanced cancer in order to follow their persistence in blood circulation with
PCR methods (Aebersold et al, 1990). Such Ògene markingÓ clinical protocols
using TILs are numbers 1, 3, 9. 13, 57, and 169 in Appendix 1, pages 159-172.
Having shown safety in the NeoR-modified TIL protocol, the gene for tumor
necrosis factor (TNF) was added to
the vector for therapy of malignant melanoma in advanced cancer patients; the
first patient began treatment in January 1991. TNF, however, is effective as an
anticancer agent in mice at 400 mg/kg body weight, but in humans, TNF is toxic
at 8 mg/Kg and so far of no proven therapeutic value at this low concentration
(reviewed by Anderson, 1992). In a similar approach, the TNF gene was replaced by the gene of interleukin-2 (IL-2) in order to develop locally high
doses of IL-2 at the tumor site by immunization with TIL cells from the patient
producing systemic antitumor immunity (Rosenberg et al, 1992).
TNF-a, (also IL-1b, IFN-g, and vitamin D3) after
binding to their transmembrane receptors stimulate the production of the second
messager ceramide from sphingomyelin in the plasma membrane by activating
sphingomyelinase; this results in a cascade of signal transduction events that
result in down regulation of c-myc and induction of apoptosis, to terminal
differentiation, or to RB-mediated cell cycle arrest (see apoptosis further
below).
IL-2 stimulates the differentiation of precursor
lymphocytes into LAK cells and further stimulates LAK cell proliferation; LAK
cells are probably produced by activation of NK cells or from activated T cells
by IL-2. Administration of IL-2 plus amplified LAK cells into mice models led
to marked regression of disseminated cancers and leukemia. LAK cells are able
to destroy tumor cells that express only weakly histocompatibility antigens.
IL-2, however, has several pleiotropic effects: stimulation of B cell
proliferation; activation of HLA class II antigen expression on endothelial
cells, TILs, and melanoma cells; and enhanced production and release of TNF-a, and IFN-g (see Cassileth et al,
1995 and the references cited therein).
However, the use of large numbers of adoptively
transferred, broadly cytotoxic LAK cells in combination with IL-2 has been
effective for only small subsets of cancer patients (reviewed by Wiltrout et
al, 1995).
TILs, which could potentially kill tumor cells, are
found in many tumors but remain suppressed or anergic; this anergy may arise
from the absence of lymphokines which provide signals for TIL cell activation
and stimulation to proliferation although ligands may be bound to the variable
region of the T cell receptor; indeed, nonimmunogenic tumors are rejected by
syngeneic mice upon transfection by IL-2
or IL-4 genes; IL-2 lymphokine
production by the tumor cells bypasses T helper function in the generation of
an antitumor response rendering the tumor cells immunogenic; nontransfected
tumors are not rejected by the animal and grow causing its death (Tepper et al,
1989; Fearon et al, 1990).
Ex vivo gene therapy trials using cytokine gene
transfer (see below) circumvent the problem of toxicity of IL-2 administration;
for non-gene transfer therapies, white blood cells drawn from patients are
fractionated, cultured, stimulated with IL-2 or other cytokines, and
reintroduced in much higher numbers into the blood of the patient.
C. Cancer immunotherapy with cytokine genes
The combination of immunotherapy with conventional
treatments such as radio- and chemotherapy may be necessary to eradicate
minimal residual disease. Advanced therapies involve the transfection of
lymphocytes in culture with cytokine genes followed by selection of the
successfully transfected cells with a selectable marker such as the bacterial
neomycin-resistance gene (Cassileth et al, 1995). Numerous phase I clinical
trials employing either syngeneic genetically modified or allogenic tumor
vaccines are in progress (see immunotherapy in Appendix 1, page 159-172). The development of tumor cells
transduced with cytokine genes and their exploitation as tumor vaccines in
patients with cancer is a very promising field (reviewed by Jaffee and Pardoll,
1997).
Cytokine genes used for cancer immunotherapy include
those of IL-2, IL-4, IL-7, IL-12, IFNs, GM-CSF, TNF-a in combination with genes encoding co-stimulatory
molecules, such as B7-I. The major goal of the use of immunostimulatory
cytokines is the activation of tumour-specific T lymphocytes capable of
rejecting tumour cells from patients with low tumour burden or to protect
patients from a recurrence of the disease. As distant metastasis is the major
cause for therapeutic failures in clinical oncology, treatment of patients
having a low tumor volume with immunotherapy could protect the patient from
recurrence of disease. Treatment of rodent tumor models with little or no
intrinsic immunogenicity with this approach resulted in regression of
preexisting tumors and cure of the animals from their disease; furthermore, in
some instances cured animals had retained immunological memory and resisted a
second challenge with the parental tumor cells (reviewed by Gilboa, 1996;
Mackensen et al, 1997).
The transduction of the tumor cells of the patient
with cytokine genes ex vivo and the development of tumor vaccines depends on
the establishment of primary cell culture from the solid tumor. Although
malignant melanomas are easy to culture, it is difficult to establish cell
lines from most other primary human tumors using convenient methods; primary
tumor cultures are being used (i) for
the transduction of autologous cells from the cancer patient with cytokine
genes to develop cancer vaccines after intradermal implantation to the patient; (ii) for characterization of
tumor-specific cytotoxic T lymphocytes in order to identify specific antigens
on the human primary culture; (iii) for
extensive phenotypic characterization of the tumor in cell culture. The
Cre/LoxP system (see recombinases in gene therapy) has been used to facilitate
the establishment of primary cell lines from human tumors (Li et al, 1997).
Human gene therapy protocols 3 and 10 (Appendix 1) use immunization of cancer
patients with autologous cancer cells transduced with the gene for tumor necrosis factor (TNF).
D. Cancer immunotherapy with the IL-2 gene
Active immunization with pancreatic tumor cells
genetically engineered to secrete IL-2 were shown to inhibit pancreatic tumor
growth in vivo; this was shown using a poorly immunogenic subcutaneous model of
murine ductal pancreatic cancer by implanting tumor Panc02 cells in C57BL/6
mice; whereas 90% of animals vaccinated with irradiated parental Panc02 and
subsequently challenged with parental Panc02 cells developed tumors by 48 days
only 40% of animals vaccinated with irradiated Panc02 cells engineered to
secrete IL-2 and challenged with parental Panc02 cells developed tumors by 48
days (Clary et al, 1997).
According to a RAC-approved clinical protocol the
gene for human interleukin-2 (IL-2) was transduced into a cell line established
from the neoplastic cells of a patient with malignant melanoma; this procedure
established an IL-2-secreting cell line with integration of the IL-2 gene into
genomic DNA. The IL-2-secreting cells were irradiated, in a manner sufficient
to inactivate 100% of the cells but insufficient to completely inhibit IL-2
synthesis, and administered to 12 patients with metastatic malignant melanoma in
a Phase I toxicity study. These cells have the capacity to induce an
antimelanoma response as shown in animal studies (Das Gupta et al, 1997).
A significant number of RAC-approved clinical
protocols use IL-2 cDNA transfer. These include protocols 11, 16, 19, 20, 46,
48, 50, 61, 71, 102, and 135, in Appendix
1 and protocols 190, 197, 198, 200, 204, 211, 213, 215, and 219 using
cationic lipids for gene transfer (Table
4 in Martin and Boulikas, 1998, this
volume, pages 203-206).
E. Cancer immunotherapy with the IL-3 gene
IL-3 was found to enhance the development of
cytotoxic T lymphocytes; during antitumor response, macrophages could ingest
whole tumor cells, cell fragments, or heat shock proteins complexed to
antigenic peptides and then process the tumor antigens for presentation; IL-3
stimulated antigen-presenting cells (APCs), which are macrophage-like, within
the tumor leading to generation of cytotoxic T lymphocytes (CTLs). This
constitutes a plausible pathway for enhancement in tumor rejection by IL-3 stimulation
(Pulaski et al, 1996).
IL-3 signaling proceeding either via the JAK-STAT or
the Ras-Raf pathways, stimulates a number of genes such as the DUB-1 encoding a deubiquitinating enzyme
the overexpression of which leads to G1 arrest (Zhu et al, 1996); deubiquitination
might be an additional mechanism to couple extracellular signaling to cell
growth. IL-3 signaling leads to stimulation in myeloid cell proliferation.
F. Cancer immunotherapy with the IL-7 gene
Primary cell cultures from 45 patients with malignant
melanoma were transfected via electroporation with the gene encoding for human
interleukin-7 (IL-7) resulting in the production of biologically active IL-7
without altering the expression of HLA class I and II, ICAM-1, and of a
melanoma-associated antigen. Irradiation of the transfected cells with 10,000
cGy, which arrested tumor cell growth in vitro, did not affect the ability of
the cells to secrete IL-7 in the culture medium; this approach, which does not
use retroviruses, could be applicable in vaccination protocols for melanoma
patients (Finke et al, 1997).
Transfer of the IL-7 cDNA for cancer immunotherapy is
being used in a human clinical trial (protocol 70, Appendix 1).
G. Cancer immunotherapy with the IL-12 gene
IL-12 gene therapy is one of the more novel and
promising approaches in cancer therapy. IL-12 is a heterodimeric cytokine
composed of two subunits, p40 and p35, that requires the simultaneous
expression of both the p35 and p40 chain genes from the same cell for
production of biologically active IL-12. Coordinate expression of the IL-12 p40
and p35 genes in several solid tumor models has been found to induce strong and
specific antitumor immune responses. A variety of biological functions have
been attributed to IL-12 including the induction of IFN-g and the promotion of predominantly Th1-type immune
responses to antigens (Tahara et al, 1996).
The local secretion of IL-12 achieved by gene
transduction suppressed tumor growth and promoted the acquisition of specific
antitumor immunity in mice. This was shown by intradermal inoculation of mice
with NIH3T3 cells transduced with expression plasmids or a retroviral vector
expressing the murine IL-12 gene admixed with murine melanoma BL-6 cells; CD4+
and CD8+ T cells, as well as NK cells, were responsible for the
observed antitumor effects resulting from IL-12 paracrine secretion.
Transduction of tumor cells with B7.1 gene enhanced the antitumor immune
response (Tahara et al, 1996).
The antitumor effect of several transgene expression
plasmids encoding the cytokines IL-2, IL-4, IL-6, IL-12, IFN-g, TNF-a, and GM-CSF was tested
using the gene gun-mediated DNA delivery into the epidermis overlying an
established intradermal murine tumor; this study showed that IL-12 gene therapy
was much more effective than treatment with any other tested cytokine gene for
induction of tumor regression as determined from the increased CD8+
T cell-mediated cytolytic activity in the draining lymph nodes of tumor-bearing
mice; treated animals were able to eradicate not only the treated but also the
untreated solid tumors at distant sites; elevated systemic levels of IFN-g, were found after IL-12 gene therapy. This approach
is providing a safer alternative to IL-12 protein therapy for clinical
treatment of cancers (Rakhmilevich et al, 1997).
Lieu et al (1997) have evaluated three IL-12
retroviral vector designs for their level of IL-12 expression in
leukemia/lymphoma cells; these retroviral vectors were based on the murine stem
cell virus (MSCV) which efficiently transduces functional genes into normal
hematopoietic cells. MSCVpac-mlL-12 and MIPV-mIL-12 contained an
encephalomyocarditis virus internal ribosome entry site for internal
translation of bicistronic mRNA transcripts, while MDCVpac-mIL-12 carried an
expression cassette in the U3 region of the 3' LTR. The MSCVpac-mIL-12 vector
was more efficient and directed robust expression of both p40 and p35 IL-12
genes in several murine tumor cell lines of hematopoietic origin, including a
T-cell lymphoma, a B-cell lymphoma, and a plasmacytoma/myeloma.
Adenoviral delivery of the IL-12 gene was effective
against breast tumors (Bramson et al, 1996) or metastatic colon carcinoma
(Caruso et al, 1996) in animal models: mice bearing breast tumors, injected
intratumorally with a single dose of an adenovirus expressing IL-12 showed
regressions in greater than 75% of the treated tumors; this effect was
accompanied with a maximum expression of IL-12 within the tumor between 24 and
72 hr post-injection which lasted for 9 days and an elevation in IFN-g within the tumor; local production of IL-12 also
stimulated IFN-g production in tumor-draining lymph node cells
(Bramson et al, 1996). Whereas intratumoral adenoviral transfer of the HSV-tk
and the murine IL-2 genes resulted in substantial hepatic tumor regression,
induced an effective systemic antitumoral immunity in the host and prolonged
the median survival time of the treated animals from 22 to 35 days a
recombinant adenovirus expressing the murine IL-12 gene was much more
effective: intratumoral administration of the IL-12 vector alone increased
significantly survival time of the animals; 25% of the treated animals lived
over 70 days (Caruso et al, 1996).
The immunological host response to syngeneic murine
mammary carcinoma cell line variants, genetically modified to express B7-1 or
secrete GM-CSF and IL-12, was examined by Aruga et al (1997). The mammary
adenocarcinoma MT-901 subline was weakly immunogenic by immunization/challenge
experiments and induced tumor-specific T-cell responses in lymph nodes draining
progressive subcutaneous tumors; however, tumor clones from this cell line
expressing B7-1 or secreting GM-CSF exhibited reduced tumorigenicity and
resulted in significantly enhanced T-cell reactivity to tumor-draining lymph
node (TDLN) cells as compared to wild-type TDLN cells. In contrast,
transduction with the IL-12 gene led to complete tumor growth inhibition.
An adenovirus vector, AdIL12-B7-1, encoding the two
IL-12 subunits in early region 1 (E1) and the B7-1 gene in E3 of adenovirus
under control of the murine CMV promoter was used to treat mice tumors derived
from a transgenic mouse mammary adenocarcinoma. A single intratumoral injection
with a low dose (2.5 x107 pfu/mouse) mediated complete regression in
70% of treated animals whereas a similar dose of recombinant virus encoding
IL-12 or B7-1 alone resulted in only a delay in tumor growth. Coinjection of
two different viruses expressing either IL-12 or B7-1 induced complete tumor
regression in only 30% of animals treated (Putzer et al, 1997).
Human peripheral blood lymphocytes (HuPBLs), injected
s.c. in mixture with human lung tumor cells into severe combined
immunodeficient (SCID) mice, engrafted and displayed antitumor cytotoxic
activity; this antitumor activity was dependent upon both CD8+ T cells and CD56+ natural killer cells in the donor
HuPBLs. IL-12 enhanced the human peripheral blood lymphocyte-mediated tumor
suppression; this implies that transfer of the IL-12 gene has a prospect in
this type of immunotherapy. This could be significant under the light of
studies showing that PBLs isolated from a lung cancer patient also suppressed
the growth of the patient's (autologous) tumor when coinjected s.c. with the
tumor cells into SCID mice (Iwanuma et al, 1997).
Tumor cell vaccines were transduced with IL-12 or
IL-2 genes and the antitumor response induced in mice bearing lung metastases
of the BALB/c colon carcinoma C51 were compared by Rodolfo et al (1996). The
cells used for transduction with the IL-12 or IL-2 genes were the
histologically related, and antigenically cross-reacting C26 tumor cells which
were irradiated and injected s.c. Vaccination with C26/IL12 cells cured 40% of
mice, while vaccination with C26/IL2 cells reduced the number of metastatic
nodules without affecting survival; both cell vaccination regimens showed
similar antitumor CTL activation in mice. Both treatments induced antibodies
directed against tumor-associated antigens, but only sera from mice treated
with C26/IL12 contained antibodies that lysed tumor cells. The better
therapeutic efficacy of vaccination with C26/IL12 was found to be associated,
among other factors, with an early infiltration of the metastatic lungs by
activated T lymphocytes (Rodolfo et al, 1996).
Transfer of the IL-12 cDNA for cancer immunotherapy
is being used in human clinical trials (protocols 62, 111, 180, and 183,
Appendix 1).
H. Adoptive immunotherapy with GM-CSF
1. Cell
culture experiments
The human hematopoietic growth factor,
granulocyte-macrophage colony-stimulating factor (GM-CSF), is important in the
management and gene therapy of a variety of malignant disorders of the human
hematopoietic system. Infection of COS-1 monkey kidney cells with a recombinant
AAV vector containing the GM-CSF gene resulted in the release of recombinant
GM-CSF protein into the supernatant; the released GM-CSF was able to sustain
the active proliferation of the GM-CSF-dependent human megakaryocytic leukemia
cell line, M07e, (Luo et al, 1995).
2. Animal
studies
The Dunning rat R3327-MatLyLu prostate tumor model
(an anaplastic androgen-dependent, nonimmunogenic tumor that metastasizes to
the lymph nodes and the lung) has been used for GM-CSF therapy; IL-2- or
GM-CSF-secreting human tumor cell preparations (tumor vaccines) were used for
the treatment of advanced human prostate cancer in rats. All animals with
subcutaneously established tumors were cured; the cancer vaccine induced
immunological memory that protected the animals from subsequent tumor
challenge; GM-CSF was less effective than IL-2 (Vieweg et al, 1994). Using the
Dunning rat prostate carcinoma model, animals with hormone refractory prostate
cancer treated with irradiated prostate cancer cells genetically engineered to
secrete human GM-CSF showed longer disease-free survival compared to untreated
control rats.
To further test the clinical feasibility of the
prostate cancer cell vaccine, cancer cells from patients with stage T2 prostate
cancer undergoing radical prostatectomy were successfully transduced with
MFG-GM-CSF, achieving a significant human GM-CSF secretion in each of 10
consecutive cases (Sanda et al, 1994).
Continuous secretion of GM-CSF and activation of
macrophages may contribute to the antitumor effects of a recombinant vaccinia
virus expressing the gene for murine GM-CSF injected to solid melanoma tumors
twice weekly for 3 weeks; this injection regimen resulted in growth inhibition
of the subcutaneous tumor and enhanced the survival of the animals (Ju et al,
1997).
A recent effort has been toward potentiation of
T-lymphocyte-mediated antitumor effects. T-lymphocyte response incapacitation
in the murine renal cancer model could arise from an impairment of critical
nuclear transcription factors. A vaccine-oriented gene therapy approach used T
cells and antigen-presenting dendritic cells which were recruited through the
use of antigen, chemokines and GM-CSF and further potentiated by fibroblasts
expressing IL-2, IL-4, IL-7, or IL-12; the goal of this approach was to
optimize MHC class I- and class II-dependent pathways for induction of
T-lymphocyte-mediated responses to cancer in animal models (Wiltrout et al,
1995).
Chen et al (1996) found that adenoviral delivery of a
combination of HSV-tk, mouse IL-2, and mouse GM-CSF is much more effective for
the treatment of metastatic colon carcinoma in the mouse liver than HSV-tk
alone or HSV-tk combined only with IL-2; a fraction of the animals developed
long-term antitumor immunity and survived for more than 4 months without tumor
recurrence in the three gene combination regimen; thus, local expression of
GM-CSF in the hepatic tumors and prolonged IL-2 expression were necessary to
generate persistent antitumor immunity.
A gene gun device was used to accelerate and
introduce gold particles coated with GM-CSF cDNA plasmids into mouse and human
tumor cells. Transfected and irradiated murine B16 melanoma cells produced
about 100 ng/ml murine GM-CSF/million cells per 24 hr in vitro for at least 10
days. Toward development of a tumor vaccine, irradiated B16 tumor cells
expressing murine GM-CSF cDNA were then injected into mice. Subsequent
challenge of these mice with nonirradiated, nontransfected B16 tumor cells
showed that 58% of the animals were protected from the tumor by the prior
vaccine treatment compared to only 2% of control animals inoculated with
irradiated B16 cells transfected with the luciferase gene (Mahvi et al, 1996).
Human tumor tissue transfected within 4 hr of surgery
produced significant levels of transgenic human GM-CSF protein in vitro. Human
GM-CSF was readily detectable in serum and at the injection site following
subcutaneous implantation of these transfected tumor cells into nude mice
(Mahvi et al, 1996).
The autocrine secretion of GM-CSF by transduced tumor
cells was found to serve as an effective immune adjuvant in the host response
to a weakly immunogenic murine mammary carcinoma tumor: transfer of activated
lymph node cells derived from mice inoculated with GM-CSF-secreting (240
ng/million cells/24 hours) murine mammary carcinoma cells resulted in the
prolonged survival of animals with macroscopic metastatic disease; this was not
evident utilizing lymph node cells from mice inoculated with wild-type tumor
(Aruga et al, 1997).
3. Clinical
trials
Autologous cells (sensitized T cells)
genetically-modified to secrete GM-CSF have been used for adoptive
immunotherapy on humans. GM-CSF has been used for the treatment of advanced
melanoma or renal cell cancers (Chang et al, 1996). The steps included
retrieval of tumor from the patient for use as a vaccine; the tumor cell line was
transduced with a retroviral/GM-CSF vector; cells were reintroduced into the
patient (tumor vaccination). Removal of draining lymph nodes after 7-10 days
and activation of lymph node cells with a monoclonal antibody directed against
CD3 and expansion of the cell population with IL-2 gave anti-CD3+/IL2-activated
cells which were exquisitely tumor-specific and mediated the regression of
established tumors in animal models (Figure
18).
According to a phase I clinical trial cancer patients
are intradermally vaccinated with lethally-irradiated tumor cells that have
been transfected by particle-mediated gene transfer with gold particles coated
with human GM-CSF plasmid DNA; this is based on preclinical studies showing
that vaccination of mice with irradiated, GM-CSF-transfected melanoma cells
provided protection from subsequent challenges with non-irradiated,
non-transfected tumor cells. Human tumor immunotherapy studies in course use
patients' fresh specimens of melanoma or renal carcinoma; cells are dissociated,
lethally-irradiated and transfected with GM-CSF plasmid DNA-coated gold
particles resulting in the subsequent production of biologically active GM-CSF
protein by the patientÕs cells. PatientÕs cells are used intradermally as a
vaccine to elicit anti-tumor immune responses. Surgical excision of the
vaccination sites will assess GM-CSF production and infiltration of immune
effector cells; patients are being subjected to an intradermal injection in
their opposite extremity of 5 million irradiated cryopreserved tumor cells
taken from the patient at the time of vaccine preparation to asses immune
reactions (DTH testing); if a positive reaction is noted on day 28 the DTH site
will be surgically removed (Mahvi et al, 1997).
Figure 18. A clinical protocol for adoptive
immunotherapy of advanced melanoma patients. Adapted from Chang et al (1996).
A number of RAC-approved human gene therapy protocols
use GM-CSF cDNA transfer. These are protocols 35, 53, 63, 113, 149, 150, 162,
and 181 in Appendix 1.
I. Cancer immunotherapy with the IFN-g gene
Solid tumors in nude mice have been successfully
eradicated with treatment with tumor cell lines stably transfected with an IFN
gene. A number of human tumor cell lines including 293, HeLa, K562, and Eskol (a
malignant immunoblastic lymphoma) were infected with a rAAV carrying a
synthetic type I interferon gene and the bacterial neomycin-resistant gene and
geneticin-resistant cells were selected; when injected into nude mice, 293,
K562, and Eskol cells failed to form tumors for a duration of up to 3 months;
on the contrary, mice receiving nontransduced cells developed tumors within 7
to 10 days; in addition, treatment of an established Eskol tumor with
transduced 293 cells resulted in tumor regression (Zhang et al, 1996).
Three RAC-approved human gene therapy protocols use
IFN-g cDNA transfer. These are protocols 36, 54, and
71
in Appendix 1.
J. Immunotherapy with synthetic tumor peptide
vaccines
Progress in the identification of tumor-specific
antigens, that is proteins expressed at high levels by a specific tumor cell
type such as prostate or breast cancer, most of which are surface glycoproteins
easily recognizable by the immune system, as well as the deciphering of the
mechanisms for enhancing the response of cytotoxic T cell lymphocytes have
advanced the potential for developing cancer vaccines.
Cancer immunotherapies based on synthetic tumor
peptide vaccines have been developed. Tumor-specific CD8+ cytotoxic T lymphocytes (CTLs) recognize
short peptide epitopes presented by MHC class I molecules that are expressed on
the surface of cancer cells. Bone marrow-derived dendritic cells, grown in
vitro in media containing combinations of GM-CSF + IL-4, when pulsed with
synthetic tumor peptides (which are loaded on the surface of the dendritic
cells) became potent antigen-presenting cells (APCs) capable of generating a
protective antitumor immune response. Injection of these cells into naive mice
protected the mice against a subsequent lethal tumor challenge; in addition,
treatment of mice bearing C3 sarcoma or 3LL lung carcinoma tumors with the same
type of cells resulted in sustained tumor regression in over 80% of the animals
(Mayordomo et al, 1995).
One of the obstacles of this method has been the
difficulty in obtaining sufficient numbers of APCs; dendritic APCs have been
isolated from CD34+ hematopoietic
progenitor cells drawn from cord blood and expanded in cell culture in the
presence of GM-CSF and TNF-a; TNF-a inhibits the
differentiation of dendritic cells into granulocytes. Human peripheral blood
mononuclear cells or mouse bone marrow cells depleted of lymphocytes could also
yield dendritic cells when cultured in the presence of GM-CSF + IL-4 (Mayordomo
et al, 1995).
K. DNA vaccines
Vaccines may be one of the first successful
applications of foreign genes into mammalian cells under control of
heterologous promoters and enhancers (Felgner and Rhodes, 1991; Thompson, 1992;
Gilboa and Smith, 1994). Vaccination with DNA has been shown to be a promising
approach for immunization against a variety of infectious diseases (Wang et al,
1993; Michel et al, 1995; Huygen et al, 1996; Kuhober et al, 1996). The method
consists in introducing the gene of a viral or bacterial antigen which is
uptaken and expressed by the hostÕs cells to elicit an antigen-specific immune
response. DNA coding for an antigen can be directly injected into muscle or
skin and stimulate an immune response against the expressed antigen; the gene
can either code for surface molecules, which are often used for conventional
peptide vaccines, or from internal microbial proteins.
During this approach the antigens are produced
intracellularly where they are correctly folded and can be presented to the
immune system to stimulate cytotoxic T cells; the method is safe and simple and
has shown promising results on animals (reviewed by Moelling, 1997). For
example, mice injected intramuscularly with an HIV-1 envelope DNA construct
developed anti-HIV envelope immune responses (Wang et al, 1993); intramuscular
injection of plasmid DNA expression vectors encoding the three envelope
proteins of the hepatitis B virus (HBV) induced humoral responses in C57BL/6
mice specific to several antigenic determinants of the viral envelope (Michel
et al, 1995). Immunization of mice with plasmid DNA constructs encoding one of
the secreted components of Mycobacterium
tuberculosis, antigen 85 gene induced substantial humoral and cell-mediated
immune responses (Huygen et al, 1996).
Because immunization of cancer patients with tumor
antigen proteins is a very promising approach used extensively in cancer
therapy (e.g. Karanikas et al, 1997) many of these approaches could be
transferred to the DNA level using the gene encoding the tumor antigen.
As an extension, this method could find application
using human tumor antigen genes rather than bacterial/viral antigen genes, that
is genes encoding for proteins expressed in tumor but not in normal cells
leading to development of tumor vaccines (Graham et al, 1996; Okamoto et al,
1997); this method mimics the infection of the cell in the host by a pathogenic
virus resulting in the intracellular processing of the viral proteins and their
presentation on the cell surface. Human tumor antigens are, however, weakly
immunogenic compared to microbial antigens a problem connected with
polymorphism in the major histocompatibility complex proteins of the host and
in antigen presentation.
Development of a fusigenic viral liposome vector was
made possible using the HVJ (hemagglutinating virus of Japan, a Sendai virus)
renowned for its cell fusion ability; plasmid DNA containing the human tumor
antigen genes MAGE-1 and MAGE-3 was mixed with HMG-1 nonhistone protein (to
increase nuclear import and expression of the plasmid after transfection) and
was encapsulated into anionic liposomes (phosphatidylserine,
phosphatidylcholine, cholesterol) followed by the addition of inactivated HVJ;
intramuscular injection into mice resulted in production of MAGE-1 and -3 IgG
antibodies (Okamoto et al, 1997).
XVI. Gene therapy of cancer and candidate genes
A. Mechanisms of carcinogenesis
Whereas for inborn errors of metabolism transfer of a
single gene can correct the disorder, cancer is a complex disease involving
mutations in a number of proto-oncogenes and tumor suppressor genes as well as
an imbalance and disarray in phosphorylation events and regulatory circuits of
the cell cycle. As a result of transformation, tumor cells acquire a
proliferation advantage compared with normal cells, most of which are quiescent
in the adult organism; cancer cells acquire partial independence from
regulatory signals from neighboring cells for restricted cell growth. A crucial
step in cancer development is the nonelimination of pre-cancer cells by
apoptosis (usually a subsequence of a mutation in the p53 gene); such cells
acquire a number of unrepaired damage in their DNA, such as strand breaks,
which induce chromosomal translocations and result in clonal expansion of this
cell population.
Tumor cells are able to survive after DNA damage, and
display an increase in mutation rate; cancer cell populations are heterogenous
with respect to translocations, loss of heterozygosity, point mutations and
transpositions in various genes. Whenever the mutated cell acquires an
advantage for rapid growth over other cells in the tumor mass, escaping cell
cycle checkpoints, it may replace the original population, a phenomenon known
as tumor progression; this may lead to appearance of a more malignant
phenotype. As a result, tumor cells are of different genotypes and clones
obtained from the same solid tumor may differ in the level of malignancy.
A number of candidate genes, when become mutated or
overexpressed, may lead to tumor phenotype: p53, RB, and p21 appear to be the
most important. The deregulation of other genes is connected to tumor
progression whereas different groups of genes are associated with tumor cell
metastasis. These facts make a single gene transfer approach to tumor cell mass
to inhibit its growth or change its phenotype from malignant to normal very
challenging.
B. Human clinical trials
The genes used for cancer gene therapy in human
clinical trials include a number of tumor suppressor genes (p53, RB, BRCA1,
E1A), antisense oncogenes (antisense c-fos,
c-myc, K-ras), suicide genes (HSV-tk, in combination with ganciclovir,
cytosine deaminase in combination with 5-fluorocytosine) which have been very
effective in eradicating solid tumors in animals. Also the cytokine genes
(IL-2, IL-7, IFN-g, GM-CSF) are being used for the ex vivo treatment of
cancer cells isolated from human patients and are able to elicit an immunologic
regression especially on immunoresponsive malignancies (melanomas, colorectal
carcinomas, renal cell carcinomas) (Culver, 1996). Future directions might be
toward use of genes involved in the control of tumor progression and
metastasis. Discovery of new genes which are over- or under-expressed during
transformation and metastasis is a promising approach for the identification of
novel gene targets in cancer gene therapy (Georgiev et al, 1998, this volume).
Diseases amenable to therapy with gene transfer in
clinical trials (Appendix 1 and Table 4 in Martin and Boulikas, this volume) include cancer (melanoma,
breast, lymphoma, head and neck, ovarian, colon, prostate, brain, chronic
myelogenous leukemia, non-small cell lung, lung adenocarcinoma, colorectal,
neuroblastoma, glioma, glioblastoma, astrocytoma, and others), AIDS, cystic
fibrosis, adenosine deaminase deficiency, cardiovascular diseases (restenosis,
familial hypercholesterolemia, peripheral artery disease), Gaucher disease,
Hunter syndrome, chronic granulomatous disease, PNP deficiency, a1-antitrypsin deficiency, leukocyte adherence
deficiency, partial ornithine transcarbamylase deficiency, Cubital Tunnel
syndrome, Canavan disease and rheumatoid arthritis. Several RAC-approved
protocols use gene marking rather than gene therapy . An important number of
protocols in cancer use ex vivo immunotherapy (Appendix 1, pages 159-172 & 203-206).
XVII. Gene therapy strategies based on p53
A. p53 as
a tumor suppressor protein
The p53 has been a
fascinating subject in cancer biology since its discovery (Lane and Crawford,
1979; Linzer and Levine, 1979). Originally assigned in the constellation of
oncogenes was later shown to exert suppressive effects on cell growth (Finlay
et al, 1989); indeed, the mutated p53 has many characteristics of an oncogene
(Will and Deppert, 1998, this volume). Mutations in the p53 gene contribute to
the emergence of the malignant phenotype (Diller et al., 1990; Baker et al.,
1990). Alterations in the p53 tumor suppressor gene appear to be involved,
directly or indirectly, in the majority of human malignancies (Vogelstein,
1990). For example, human lung cancer cell lines and specimens showed allelic
loss for chromosome regions 3p and 17p (p53 is assigned to 17p13); these
specimens displayed homozygous deletions of p53,
DNA rearrangements involving the p53
gene, or expression of truncated p53 transcripts suggesting abnormal splicing,
initiation, and termination arising from point or other mutations (Takahashi et
al, 1989; Nigro et al, 1989).
An interesting approach to
unravel the molecular mechanism of action of p53 in restricting cell growth and
in inducing apoptosis was the cloning of genes induced by p53 before the onset
of apoptosis; this led to the identification of a group of 14 genes (out of
7,202 transcripts examined) which were markedly increased in p53-expressing
cells compared with control cells many of which were predicted to encode
proteins that could generate oxidative stress or respond to oxidative stress
(Polyak et al, 1997). Additional studies in this line have suggested that the
induction of the apoptotic pathway by p53 involves (i) transcriptional induction of redox-related genes; (ii) formation of reactive oxygen
species; and (iii) the oxidative
degradation of mitochondrial components (Polyak et al, 1997).
p53 can inhibit
transformation of rat embryo fibroblasts mediated by adenovirus E1A plus activated ras and can also suppress focus formation mediated by myc plus activated ras (Finlay et al, 1989; Eliyahu et al, 1989). Both alleles of p53
need to be mutated or altered for transformation. Introduction of a null
mutation by homologous recombination in murine embryonic stem cells gave mice
which appeared normal but were susceptible to a variety of neoplasms by 6
months of age (Donehower et al, 1992).
The tumor suppressive
activity of p53 seems to involve at least six independent pathways: (i) induction by p53 of the p21/Waf-1/Cip-1 gene which causes growth
arrest both via inhibition of cyclin-dependent kinases and via inactivation of
PCNA; PCNA is the accessory molecule to DNA polymerases a and d and its absence causes
arrest of DNA synthesis at the replication fork; (ii) induction of the death-promoting bax gene by p53 as a mechanism which eliminates oncogenic
virus-infected and transformed cells;
(iii) by a direct interaction of p53 with origins or replication preventing
firing and initiation of DNA replication;
(iv) via binding of p53 to a number of important molecules involved in
transcription (TATA box-binding protein or TBP, TFIIH); (v) by the role of p53 in DNA repair via its patrolling the genome
for small insertion deletion mismatches or free ends of DNA; (vi) p53 is able to attract RPA, an
accessory to DNA polymerases a and d as well as TFIIH and
RAD51 at the damaged DNA sites; TFIIH, RAD51, and RPA have a demonstrated role
in DNA repair (Figure 19).
Additional properties of p53 include the induction of Gadd45 involved in the
arrest of the cell cycle and induction of Mdm2 which, after exceeding a
threshold value in the cell associates with p53 to restrict its regulatory
functions; thus, Mdm2 acts as a feedback loop for p53 to moderate its apoptotic
and cell cycle restrictive functions (Figure
20).
B. Genes
regulated by wild-type p53
Protein p53 appears to be a
transcription factor able to recognize specific regulatory regions in a number
of genes via its central DNA-binding domain; the DNA sequence-specific binding
of wt p53 is regulated by the C-terminal domain of p53 and is activated by a
variety of posttranslational modifications (Hupp et al, 1992). p53 is
phosphorylated and is constitutively expressed at low levels in most normal
tissues (Lane and Crawford, 1979; Linzer and Levine, 1979).
The sequence specificity of
p53 has been determined using random synthetic oligonucleotides followed by
selection by wtp53 and cloning; these studies revealed the 10 bp motif RRRCGYYY (where R is purine and Y pyrimidine) as the binding and recognition
site of wtp53 recognition (El-Deiry et al., 1992); two such 10 bp motifs are
required for p53 binding separated by up to 13 bp of random sequence. Since the 10 bp motif is a palindrome,
the binding site of p53 comprises 4 copies of the half binding sites GYYY oriented in opposite directions, which suggested
that p53 binds either as a dimer to two cruciforms or as a tetramer with each
subunit interacting with one half site. The
second possibility is favored since
Figure 19.
Regulatory circuits involving p53. From Boulikas T (1997) Gene therapy of prostate cancer: p53, suicidal genes, and
other targets. Anticancer Res 17,
1471-1506. With the kind permission of Anticancer Research.
Figure 20. A summary of the apoptotic and cell
cycle restrictive activities of p53. From Boulikas T (1997) Gene therapy of prostate cancer: p53, suicidal genes, and
other targets. Anticancer Res 17,
1471-1506. With the kind permission of Anticancer Research.
biophysical
studies indicate that p53 exists as a tetramer in solution (Stenger et al.,
1992).
Increased levels of p53 upregulate the expression of
specific genes including Cip-1/Waf-1/p21
(El-Deiry et al, 1993), GADD45
(Kastan et al, 1992), cyclin G (Okamoto and Beach, 1994), and mdm2 (Perry et al, 1993; Barak et al,
1993; Momand et al, 1992) which is induced by UV damage in a p53-dependent
pathway (Perry et al, 1993). Gadd45 inhibits cell cycle progression
(Papathanasiou et al, 1991).
Mdm2 acts as a feedback loop for the biological
functions of p53 apparently to moderate the G1/S arrest or apoptosis triggered
by p53 following severe damage to DNA. Mdm2 protein associates with p53 causing
p53 inactivation by preventing its sequence-specific binding to regulatory
targets in DNA (Momand et al, 1992; Oliner et al, 1992). Elevated levels of
Mdm2 mimic the effect of T antigen, E1B of adenovirus, E6 of HPV, which also
inactivate p53 in a similar manner; overexpression of Mdm2 can block the
induction of apoptosis by p53 (Chen et al, 1994).
Additional genes
up-regulated by p53 include human PCNA
(Shivakumar et al, 1995), mouse muscle creatine kinase MCK (Zambetti et al, 1992), EGFR
(Deb et al, 1994), the potent promoter of the death pathway Bax (Miyashita and Reed, 1995), and
thrombospondin-1 (Dameron et al, 1994). Other cellular regulatory regions that
interact with p53 include the RGC repeats in the ribosomal gene cluster (Farmer
et al, 1992; Kern et al, 1992).
The PCNA promoter is
up-regulated in the presence of moderate amounts of wt p53; however, at higher
levels of wt p53 the PCNA promoter is inhibited whereas tumor-derived p53
mutants activate the PCNA promoter (Shivakumar et al, 1995); it has been
suggested that the moderate elevation in wt p53 seen after DNA damage induces
PCNA to cope with its DNA repair activities (Shivakumar et al, 1995); this
inhibition in DNA replication but stimulation in repair by p53 might be
accomplished by an independent pathway involving induction of p21 (El-Deiry et
al, 1993) which interacts with PCNA protein auxiliary to DNA polymerase d to inhibit the replication but not the repair
functions of PCNA (Li et al, 1994).
The bax
gene which induces apoptosis (Figure 21)
is upregulated by p53 whereas the bcl-2
gene which inhibits apoptosis in B cells is down-regulated by p53 (Miyashita et
al, 1994a,b; Miyashita and Reed, 1995). Initiated cancer cells may lead to
tumor development only when a dysfunction in their apoptotic pathway takes
place; some of the mechanisms leading to inactivation of the apoptotic pathway
in cancer cells may result from an up-regulation in the bcl-2 gene (a Bcl-2 chimeric factor is produced in leukemias as a
result of a translocation) or down-regulation of the bax gene. Gene therapy for cancer could involve restoration of the
apoptotic pathway in cancer cells leading to their suicidal death (see below).
Figure 21.
Involvement of Bax and Bcl-2 proteins in apoptosis. Bax is a potent inducer of
apoptosis; binding of Bcl-2 to Bax (also binding of the E1B 19 kDa protein of
adenovirus to Bax) prevents Bax from its apoptotic functions. From Boulikas T (1997) Gene therapy of prostate cancer:
p53, suicidal genes, and other targets. Anticancer
Res 17, 1471-1506. With the kind permission of Anticancer Research.
Binding sites for p53 have
been found at the origin of replication of polyomavirus with an inhibitory
effect on virus replication in vitro (Miller et al, 1995) and at the SV40 ORI
(Bargonetti et al, 1991) as well as in putative cellular origins of replication
(Kern et al, 1991).
A number of genes not
containing p53 response elements may be repressed by p53 (Ginsberg et al, 1991;
Mercer et al, 1991; Shiio et al, 1992; Seto et al, 1992).
C. Binding
of p53 to viral oncoproteins
p53 was first detected in
rodent cells transformed with SV40 in a complex with T antigen (Lane and
Crawford, 1979; Linzer and Levine, 1987). Subsequent studies have shown that
p53 can be complexed with adenovirus E1B (Sarnow et al, 1982; van den Heuvel et
al., 1990) and the E6 oncoprotein of human papilloma virus (Werness et al.,
1990). SV40 T antigen was unable to act as an initiator of SV40 DNA replication
in vitro when complexed with wt murine p53 (Wang et al, 1989) thought to act by
blocking the interaction of T antigen with DNA polymerase a (Gannon and Lane, 1987; Braithwaite et al, 1987).
What appears to be
important in understanding the involvement of p53 in tumorigenesis is that p53
is unable to transactivate the p53-inducible reporter genes in cells that
express one of these viral oncoproteins (Yew and Berk, 1992). In addition, the growth suppressive
effect of p53 protein may be mediated by its association with cellular proteins
(Fields and Jang, 1990; Raycroft et al., 1990). Negative elements that could be
required for an efficient growth shutdown leading to the reversible G0 state or to irreversible out-of-cycle
conditions such as terminal differentiation, apoptosis, and senescence, may be
affected by p53 (Bargonetti et al., 1991).
D.
Transcription repression by interaction of p53 with TBP
Although p53 activates a
number of promoters that contain p53-responsive elements, it represses
transcription from many promoters that lack p53 binding sites; central to the
promoter repression by p53 was thought to be its interaction with the TATA-box
binding protein or TBP (Seto et al, 1992; Mack et al, 1993; Truant et al,
1993). This interaction may activate transcription when TBP interacts with a
preformed p53-DNA complex or may repress transcription when p53 interacts with
DNA-bound TBP (Deb et al, 1994). However, p53 acts as a repressor only in cells
undergoing apoptosis and p53-mediated transcriptional repression is released by
adenovirus E1B or cellular Bcl-2 (Shen and Shenk, 1994; Sabbatini et al, 1995).
Both wild-type and mutant
p53 interact with C/EBP on the human hsp70 promoter (Agoff, 1993), with TFIIH
(Xiao et al, 1994), holo-TFIID (Chen et al, 1993; Liu et al, 1993) and the
TAFII40 and TAFII60 subunits of TFIID (Thut et al, 1995).
E.
Inhibition of DNA replication by wild-type p53
Several lines of evidence
suggested inhibition in DNA replication by wild-type p53 but not by
tumor-derived mutant forms of p53. Indeed, SV40 T antigen was unable to act as
an initiator of SV40 DNA replication in
vitro when complexed with p53 (Wang et al, 1989); mutant p53 was unable to
cause inhibition in the initiating functions of T antigen in vitro (Friedman et al, 1990). Inhibition in DNA replication in vivo by p53 (Braithwaite et al, 1987)
suggested that p53 might interact with cellular DNA replication initiator
proteins or other components of the replication fork. p53 also interacts with
replication protein A (RPA) implicated in DNA replication and in repair;
interaction of p53 inhibits the replication functions of RPA (Dutta et al,
1993) although interaction of p53 with RPA via its acidic domains stimulates
BPV-1 DNA replication in vitro (Li and Botchan, 1993). Immunolocalization of
p53 (also of RB and host replication proteins) at foci of viral replication in
HSV-infected cells (Wilcock and Lane, 1991) provided further evidence for a
direct interaction of p53 with proteins (or DNA sequences) at the replication
fork.
According to a second
model, p53 can cause inhibition in DNA replication by a direct interaction with
origins of replication at the DNA sequence level rather than via its
interaction with replication initiator proteins. The potential role of p53 as a
down-regulator of DNA replication in a DNA-binding-dependent manner has been
suggested from replication assays of polyoma virus in vitro (Miller et al, 1995) and from the inhibition in nuclear
DNA replication by a form of p53, truncated at its C-terminus, which is
constitutively active for DNA binding in transcription incompetent extracts
from Xenopus eggs (Cox et al, 1995).
In the experiments of Miller and coworkers (1995) wild-type p53 suppressed DNA
replication in vitro when the p53 binding site (RGC)16 from the ribosomal gene cluster was
cloned on the late side of the polyomavirus (Py) core origin; when mutated
p53-binding sites were used, the inhibition in Py replication was not observed.
In addition, RPA (able to interact directly with p53) was unable to relieve the
p53-mediated repression in Py replication. Furthermore, tumor-derived mutants
of p53 that had lost their sequence-specific DNA-binding capacity were unable
to inhibit Py replication of the construct with the wild-type oligomerized RGC
sites in vitro.
F.
Differences in biological functions between wild-type p53 and tumor-derived p53
mutants
Tumor-derived mutant forms
of p53 have lost their DNA sequence-specific binding capacities. For example
the Trp-248 and His-273 mutants of p53 have poor DNA-binding abilities and are
unable to activate transcription from constructs containing p53 binding sites
(Farmer et al, 1992).
Wild-type (wt) p53 tumor suppressor protein
negatively regulates cell growth (Hollstein et al, 1991; Prives, 1994). Whereas
the wild-type p53 acts as a tumor suppressor, several of the mutant forms
display oncogenic activities (Levine, 1993; Prives and Manfredi, 1993; Deppert,
1994). Although the wt p53 has been postulated to repress growth by activating
genes that repress growth (p21), many
of the mutant forms have lost their DNA sequence-specific binding and transcriptional
activation capacities (reviewed by Zambetti and Levine, 1993).
According to one model (see
Vogelstein and Kinzler, 1992), wt p53 is a positive regulator for the
transcription of genes that by themselves are negative regulators of growth
control and/or invasion. Indeed, p53 upregulates the genes of p21/CIP1/WAF1
(ElDeiry et al, 1993) and GADD45 (Kastan et al, 1992) whose products interact
with PCNA to inhibit its association with DNA polymerase d thus causing arrest in DNA replication (Smith et al,
1994). This feature of p53 that is central to its ability to suppress
neoplastic growth is lost by mutations on p53 that result in loss of its
ability to bind to DNA or to interact with other transcription protein factors.
Mutant p53 can transactivate genes that up-regulate
cellular growth (Deb et al, 1992; Dittmer et al, 1993) such as PCNA (Shivakumar et al, 1995), EGFR (Deb et al, 1994), multiple drug
resistance (MDR1) (Chin et al, 1992;
Zastawny et al, 1993), and human HSP70
in vivo (Tsutsumi-Ishi et al, 1995). These studies support the idea for an
oncogene function of the mutant p53 protein compared with the tumor suppressor
function of wt p53; mutation in the p53 gene may, thus, cause gain of new
functions such as transforming activation and binding to a distinct class of
promoters which are not normally regulated by wt p53 (Zambetti and Levine,
1993; Tsutsumi-Ishi et al, 1995). At the same time appearance of mutations in
the p53 gene result in the loss of function of the wt p53 (Zambetti and Levine,
1993).
The wild-type but not mutant p53 at low levels
transactivates the human PCNA
promoter in a number of different cell lines; the wild-type p53-response
element from the PCNA promoter functions in either orientation when placed on a
heterologous synthetic promoter; thus moderate elevation of p53 can induce
PCNA, enhancing the nucleotide excision repair functions of PCNA (Shivakumar et
al, 1995). Whereas low levels of wild-type p53 activate the PCNA promoter,
higher concentrations of wt p53 inhibit the PCNA promoter, and tumor-derived
p53 mutants activate the promoter (Shivakumar et al, 1995).
While the wtp53 is endowed with a 3'-to-5'
exonuclease activity, associated with the central DNA-binding domain, and
thought to function during repair, replication, and recombination, the 273His mutant of p53 has lost the exonuclease
activity (Mummenbrauer et al, 1996).
G.
Involvement of p53 in repair and control of the cell cycle
p53 controls the level of
expression of the p21 gene, encoding
a protein that inhibits the activity of cyclin-dependent kinases (CDKs); CDK
activity is essential for the phosphorylation of RB at the G1/S checkpoint of
the cell cycle resulting in the release of E2F transcription factor from RB-E2F
complexes and in the up-regulation by the released E2F of genes required for
DNA synthesis. p21 levels are reduced considerably in tumor cells that have
lost the p53 protein or contain a nonfunctional mutated form of p53 (El-Deiry
et al, 1993). In addition, the p21 inhibitor of cyclin-dependent kinases
associates with PCNA thus blocking its ability to activate DNA polymerase d; this could give rise to the abnormal control in DNA
replication or to the loss of coordination between DNA replication and cell
cycle progression seen in tumor cells. Thus the upregulation of the p21 gene by p53 acts in two different
ways causing a cascade of events.
p53 is linked directly to
homologous recombination processes via its interaction with the RAD51/RecA
protein (StŸrzbecher et al, 1996).
H. A
proposal for an efficient killing of cancer cells using p53/PAX5 expression vectors
Introduction of a null p53
mutation by homologous recombination in murine embryonic stem cells gave mice
which appeared normal but were susceptible to a variety of neoplasms by 6
months of age (Donehower et al, 1992). Relevant to the issue that p53 is dispensable
for embryonic development are the studies of Stuart and coworkers (1995)
suggesting that during early embryo development p53 is not expressed because of the suppression of its gene by Pax5;
at later stages of development Pax5
inactivation allows p53 to be
expressed and exert its control on cell growth (Figure 22).
A significant factor to be
considered in approaches aimed at transferring the wt p53 gene to tumor cells is the impairment of the wt p53 functions
by the endogenous mutant p53 expressed in tumor cells which is able to
tetramerize with wt p53; optimal results will be expected if the endogenous
mutant p53 gene is inhibited
concurrently with overexpression of the wt p53 gene. It has been proposed
(Boulikas, 1997) that effective suppression of tumor growth with p53 vectors
could be achieved by the simultaneous transfer of wt p53 plus Pax5 to cancer
cells; Pax5 is a well established supressor of the p53 gene; its effect is
exerted via a direct interaction of Pax5 with a control element in the first
exon of the p53 gene (Stuart et al,
1995). Pax5 is an homeotic protein, controlling the formation of body
structures during development; Pax5 is expressed in early embryo stages to keep
the levels of p53 low and allow rapid proliferation of embryonic tissues.
Simultaneous transfer to solid tumors of a PAX5 and p53 genes in the same
expression vector but with the wt p53 mutagenized at 2-3 nucleotides to abort
the PAX5 suppressive site was proposed as a strategy to effectively suppress
tumor cell proliferation (Boulikas, 1997).
I. p53
gene bombs that explode in cancer cells
Exogenous genes encoding
"weapons" (suicide genes) and "triggers" have been devised
whose delivery to somatic cells will affect only cancer cells. The production
of mutated forms of p53 at high levels by cancer cells (normal cells do not
have adequate amounts of wt p53 protein) is being exploited to pull a molecular
trigger resulting in the transcriptional activation of a toxic gene and in the
death of cancer cells (da Costa et al, 1996). This invention is based on the
fact that (i) powerful chimeric
transcription factors can be engineered consisting of a DNA-binding domain (DBD) and a transactivation domain (TAD) and (ii) prokaryotic or viral enzymes are able to convert nontoxic
prodrugs into toxic derivatives (suicide genes, see HSV-tk, CD and PNP further
below); the toxic derivative produced in tumor cells which are transfected can
diffuse to surrounding cells causing their killing even in
Figure 22.
Involvement of p53 and Pax5 in B cell apoptosis. Adapted from Stuart et al
(1995).
the absence of transfection of these cells, a
phenomenon known as "bystander effect".
Trigger genes in plasmids
were made up of the DNA-binding domain of GAL4 (aa 1-147) fused in frame to a
protein domain that could interact with p53; the p53-binding domain was the
84-708 aa region of SV40 T antigen or of the 305-393 aa TAD domain of p53
(which acts as a tetramer) and which is similar between wt and mutant p53
(mutations on p53 are within the DBD). The constructs included the E. coli (DeoD) gene which encodes the purine nucleoside phosphorylase (PNP)
under control of the GAL4 response element (known as upstream activating sequence
or UAS); the PNP gene can convert the 6-methylpurine deoxyribose (MeP-dR)
prodrug into the diffusible, toxic 6-methylpurine (see page 69) and can become
a powerful suicide gene under these conditions (Sorscher et al, 1994).
Transfection of cells in culture with these constructs followed by treatment of
the cells with MeP-dR resulted in the death of the cells (da Costa et al,
1996). The mechanism was based on the fact that most normal cells do not
express the p53 gene and those who do express the wt p53 are destined for
programmed cell death; therefore, cancer cells containing elevated amounts of
mutant forms of p53 were amenable to this strategy.
The 55- kDa E1B protein of
adenovirus binds to and inactivates the p53 gene; ONYX-015 is an E1B, 55-kDa
gene-attenuated adenovirus unable to replicate and show cytopathogenicity in
tumor cell lines which express a wt p53 such as in RKO and U20S carcinoma lines
but can cause cytolysis in cell lines expressing a mutated form of p53; a wide
range of human tumor cells, including numerous carcinoma lines with either
mutant or normal p53 gene sequences (exons 5-9), were efficiently destroyed
following intratumoral or intravenous administration of ONYX-015 to nude
mouse-human tumor xenografts; furthermore, combination therapy with ONYX-015
plus chemotherapy (cisplatin, 5-fluorouracil) was significantly greater than
with either agent alone. On the contrary, normal human cells were highly
resistant to cytolysis by the adenovirus (Heise et al, 1997).
J.
Transfer of the p53 gene in cell culture
Preclinical studies have
shown that both viral and plasmid vectors able to mediate high efficiency
delivery and expression of wild-type tumor suppressor p53 gene can cause
regression in established human tumors, prevent the growth of human cancer
cells in culture, or render malignant cells from human biopsies non-tumorigenic
in nude mice. Inhibition in cell proliferation was observed in cell culture and
in tumors after induction of p53
expression with adenovirus vectors (Bacchetti and Graham, 1993; Wills et al,
1994; Zhang et al, 1994).
Transfer of the wild-type
p53 gene using a defective HSV vector into a human medulloblastoma cell line
containing a mutant copy of p53 resulted in p53 expression, increased the
levels of mdm2 proteins and induced cell cycle arrest of the majority of transduced
cells (Rosenfeld et al, 1995).
Apoptosis can be induced in
cultured NCI-H 596 human non-small cell lung cancer cells, which have a
wild-type p53 gene, by EGF signaling in a p53-dependent manner; whereas
treatment of these cells with EGF plus p53 sense oligonucleotides induced
EGF-dependent and p53-dependent apoptosis within 8 hours, antisense p53 gene
therapy suppressed the induction of apoptosis. A new nucleic acid drug was
developed based on a mutated p53 antisense with a mutation at three bases
immediately 5' and 3' from the CG dinucleotides which potentiated the induction
of apoptosis and failed to suppress the induction of EGF-dependent apoptosis
(Murayama and Horiuchi, 1997).
Infection of the
androgen-independent human prostate Tsu-pr1 cell line lacking functional p53
alleles with recombinant adenovirus vectors (replication-deficient) carrying
the p53 gene under control of the CMV promoter resulted in expression of p53
and induced striking morphological changes: the cells were detached from the
substratum, condensed, and exhibited breakdown of the nuclear DNA into
nucleosome-size fragments characteristic of apoptosis; whereas control cells
were able to elicit tumors in nude mice, the AdCMV/p53-infected cells failed to
form tumors (Yang et al, 1995).
K. Animal
studies using p53 gene transfer
Intratracheal injection of
a recombinant retrovirus containing the wt p53
gene was shown to inhibit the growth of lung tumors in mice nu/nu models
inoculated intratracheally with human lung cancer H226Br cells whose p53 gene
has a homozygous mutation at codon 254 (Fujiwara et al, 1994). A number of
other studies have shown suppression in tumor cell growth and metastasis after
delivery and expression of the wt p53
gene (Diller et al, 1990; Chen et al, 1991; Isaacs et al, 1991; Wang et al,
1993).
The safety of the
adenovirus-mediated p53 transduction of the liver in normal rats and in
50%-hepatectomized animals subjected to asanguineous portal perfusion was
examined by Drazan et al (1994). The gene transfer rate in whole liver and
after hepatectomy ranged from 20% to 40%; liver regeneration and hepatocyte
function were unaffected by overexpression of p53.
Delivery of the p53 gene to malignant human breast
cancer cells in nude mice using DOTMA:DOPE 1:1 cationic liposomes (400 nmoles
liposomes/35 mg DNA) resulted in regression (60% reduction in tumor
cell volume) in 8 out of 15 animals treated; animals were receiving one
injection every 10 days (Lesoon-Wood et al, 1995). It was thought that
wild-type p53 expression (tumor cells were expressing mutant forms of p53)
upregulated p21 gene to inhibit cell growth by inhibition in cyclin-dependent
kinases but also via induction of apoptosis preferentially in cancer cells.
When a recombinant
adenovirus encoding wild-type p53 under the control of the human CMV promoter
was introduced into SK-OV-3 human ovarian carcinoma cells it increased by more
than 50% the life span of nude mice injected with these cells; control animals
in this highly aggressive ovarian xenograft model died between 25-45 days from
injection time (Mujoo et al, 1996). Adenoviral transfer of a functional p53
gene into a radiation-resistant SCCHN cell line that harbors mutant p53
restored the G1 block and apoptosis in these cells in vitro and sensitized
SCCHN-induced mouse xenografts to radiotherapy in vivo (Chang et al, 1997).
The efficacy of a
replication-deficient p53 adenovirus construct was tested against three human
breast cancer cell lines expressing mutant p53, MDA-MB-231, -468, and -435 and
was found to be highly effective against 231 and 468 cells as well as their tumor
xenografts in nude mice but not against 435 cells probably due to their low
adenovirus transduction. 37% of growth inhibition of 231 cells was due to p53,
while 49% was adenovirus-specific (Nielsen et al, 1997).
Cytotoxic T lymphocytes (CTLs) recognizing a murine
wild-type p53 were able to discriminate between p53-overexpressing tumor cells
and normal tissue and caused complete and permanent tumor eradication without
damage to normal tissue after adoptive transfer into tumor-bearing p53+/+
nude mice. CTLs, presented by the MHC class I molecule H-2Kb, were generated by
immunizing p53 gene deficient (p53-/-) C57BL/6 mice with syngeneic
p53-overexpressing tumor cells (Vierboom et al, 1997).
L.
Transfer of the p53 tumor suppressor gene to prostate cancer cells
Although primary prostate tumors have few mutations
in the p53 gene (Voeller et al, 1994;
Isaacs et al, 1994), specimens from advanced stages of the disease and
metastases as well as their cell lines frequently display mutations or
deletions at both alleles of the p53 gene (Chi et al, 1994; Dinjens et al,
1994). Three of five prostate cancer cell lines examined (TSUPr-1, PC3, DU145)
and one out of two primary prostate cancer specimens were found to harbor
mutations altering the amino acid sequence of the conserved exons 5-8 of the
p53 gene; transduction of the p53-defective cell lines with the wt p53 gene
using lipofectin showed reduction in tumorigenicity assayed from reduced colony
formation and the cells became growth arrested (Isaacs et al, 1991).
Endocrine therapy is ineffective once the prostate
cancer becomes androgen-independent; these cancers remain unresponsive to
conventional chemotherapy. Androgen-independent and metastatic prostate cancers
were established in athymic male mice by co-inoculation with the LNCaP human
prostate cancer cell line and the MS human bone stromal cell line; these tumors
became necrotic and were successfully eradicated by intratumoral injection of a
recombinant p53/adenovirus; the p53
gene was driven by the CMV promoter and the SV40 poly(A) signal placed in the
E1 region of Ad5 (Ko et al, 1996). It was suggested that in addition to the
tumor suppressor, apoptotic, and antiangiogenesis function of p53, tumor
necrosis was induced by a bystander effect or a general immune response which
attracted immune cells to cause tumor cell killing (Ko et al, 1996).
M. Clinical trials using p53 gene transfer
A human clinical trial at M.D. Anderson Cancer Center
uses transfer of the wild-type p53
gene, in patients suffering with non-small cell lung cancer and shown to have
p53 mutations in their tumors, using local injection of an Ad5/CMV/p53
recombinant adenovirus at the site of tumor in combination with cisplatin
(Roth, 1996; Roth et al, 1996; protocols #29 and 124, Appendix 1). A retroviral vector containing the wild-type p53 gene
under control of a b-actin promoter was used for multiple percutaneous
injections or direct thoracoscopic injections at the site of the tumor into
nine patients, all in advanced stages, with non-small cell lung cancers.
Patients whose conventional treatments failed were selected for a p53 mutation
in the lung tumor. Reduction in tumor volume was achieved via apoptosis
(assayed in posttreatment biopsies) in three patients, and arrest in tumor
growth in three other patients (Roth et al, 1996).
RAC-approved clinical trials (Appendix 1) using p53 cDNA transfer are #29 (treatment of non-small
cell lung cancer with p53 and antisense K-ras), #124 (intratumoral delivery of
adenoviral p53 cDNA plus cisplatin), #130 (intratumoral injection of adenoviral
p53 to treat head and neck squamous cell carcinoma), #131 (primary and
metastatic malignant tumors of the liver), #147 (percutaneous injections of
adenovirus p53 for hepatocellular carcinoma), #148 (advanced or recurrent
adenocarcinoma of the prostate), #152 (intra-tumoral injections of ad5cmv-p53
to patients with recurrent squamous cell carcinoma of the head and neck), #153
(intralesional delivery of adenovirus p53 in combination with chemotherapy in
breast cancer), #154 (intratumoral injection of adeno p53 to patients with
advanced prostate cancer), #155 (intratumoral injection of adeno p53 to
patients with advanced and metastatic bladder cancer), and #156 (adeno p53 for
non-small cell lung cancer).
XVIII. p21
and p16 in cancer gene therapy
A. Molecular action of p21
p53 upregulates the p21/CIP1/WAF1 gene (simply called
p21) (ElDeiry et al, 1993). Induction of the p21/Waf-1/Cip-1 gene causes growth arrest via inhibition of
cyclin-dependent kinases (CDKs). CDKs are upregulated by cyclins which act as
positive regulators of cell cycle progression. Cdk2, also called p33cdk2, is the master regulator
of the cell cycle at the G1/S transition point. Whereas cdk2 is expressed at
constant levels throughout the cell cycle, its activation by phosphorylation is
first detected a few hours before the onset of DNA synthesis; furthermore,
antibodies directed against Cdk2 blocked mammalian cells from entering S phase.
D1 cyclin associates with Cdk2, Cdk4, and Cdk5 to control the G1¨S transition point; the genes of cyclins D1 and E are
overexpressed or rearranged in malignancies and conditional overexpression of
human cyclins D1 and E in Rat-1 fibroblasts causes a decrease in the length of
G1 and an acceleration of the G1/S phase transition. D1 appears to be
specialized in the emergence of cells from quiescence (Go¨G1 transition) whereas cyclin E is more oriented
toward control of the G1/S transition. Cdc2, a close relative of Cdk2 and whose
pattern of phosphorylation is cell cycle-regulated, becomes associated with
cyclin B to regulate the G2¨M transition (see Boulikas, 1995a).
CDK activity is essential for the phosphorylation of
RB at the G1/S checkpoint of the cell cycle resulting in the release of E2F
transcription factor from RB-E2F complexes and in the up-regulation of genes
required for DNA synthesis by the released E2F. p21 levels are reduced
considerably in tumor cells that have lost the p53 protein or contain a
nonfunctional mutated form of p53 (El-Deiry et al, 1993).
Induction of the p21/Waf-1/Cip-1
gene also causes growth arrest via inactivation of PCNA; indeed, the p21
inhibitor of cyclin-dependent kinases associates with PCNA, the accessory of
DNA polymerases a and d , thus blocking its
ability to activate these DNA polymerases; this could give rise to the abnormal
control in DNA replication or to the loss of coordination between DNA
replication and cell cycle progression seen in tumor cells (Li et al, 1994).
B. p21 and
p16 gene transfer
Introduction of the wt p53
or of the p21 downstream mediator of p53-induced growth suppression into a
mouse prostate cancer cell line, deficient in p53, led to an association of p21
with Cdk2; this interaction was sufficient to downregulate Cdk2 by 65% (Eastham
et al, 1995). The p21 gene, driven by CMV promoter into an Adenovirus 5 vector,
was more effective than the AD5CMV-p53 vector, (harboring the p53 gene under
control of the same elements as p21), in reducing tumor volume in syngeneic
male mice with established s.c. prostate tumors; tumors were induced by
injection of 2 million cells in each animal. These studies suggested that p21 expression might have more potent
growth suppressive effect than p53 in this tumor model and that p21 may be
seriously be included in the constellation of anticancer arsenals.
Transfer of p21 is an
effective tool to lead carcinoma cells with inactivated p53 into less malignant
phenotypes. p53 is frequently inactivated by papilloma viruses in carcinomas of
the uterine cervix. Transfer of the p21 gene to HeLa cells, a widely used
uterine cervix cell line, resulted in a significant growth retardation by
blockage of G1 to S transition, reduced anchorage-independent growth and
attenuated telomerase activity (Yokoyama et al, 1997). Introduction of p21 with
adenoviral vectors into malignant cells completely suppressed their growth in
vivo and also reduced the growth of established pre-existing tumours (Yang et
al, 1997).
Transfer of p21 was used to
suppress neointimal formation in the balloon-injured porcine or rat carotid
arteries in vivo (Yang et al, 1996; Ueno H et al, 1997a). A combination therapy
in mice with simultaneous transfer of the p21 gene and of the murine MHC class
I H-2Kb gene, which induces an immune response that stimulates tumor
regression, was more effective than treatment with either gene alone (Ohno et
al, 1997).
Malignant gliomas
extensively infiltrate the surrounding normal brain and their diffuse invasion
is one of the most important barriers to successful therapy; one of the most
frequent abnormalities in the progression of gliomas is the inactivation of the
tumor-suppressor gene p16, suggesting that loss of p16 is associated with
acquisition of malignant characteristics. Restoring wild-type p16 activity into
p16-null malignant glioma cells modified their phenotype. Adenoviral transfer
of the p16/CDKN2 cDNA in p16-null SNB19 glioma cells significantly reduced
invasion into fetal rat-brain aggregates and reduced expression of matrix
metalloproteinase-2 (MMP-2), an enzyme involved in tumor-cell invasion
(Chintala et al, 1997).
XIX. Gene therapies based on transfer of the
retinoblastoma (RB) gene
A. RB and
E2F proteins in the control of the cell cycle and apoptosis
Retinoblastoma protein is a transcription factor (Lee
et al, 1987) involved in the regulation of cell cycle progression genes
(reviewed by White, 1998, this volume). The role of RB on cell proliferation
and tumor suppression arises (i) from
its association with E2F, an association disrupted by RB phosphorylation at the
G1/S checkpoint resulting in release of E2F and in the upregulation of a number
of genes required for DNA replication;
(ii) from the direct association of RB protein with a number of viral
oncoproteins or key regulatory proteins including E1A of adenovirus (Whyte et
al., 1988), SV40 large T (Ludlow et al., 1990) and the human papilloma virus E7
protein (Dyson et al., 1989). Normal
cellular targets of RB, such as the transcription factor E2F (Bagchi et al.,
1991; Chellapan et al., 1991) become dissociated from the RB protein in the
presence of these viral proteins in the cell (E1A, T antigen, E7), leading to
cell cycle progression. This
constitutes a mechanism (also the interaction of viral proteins with p53, see
above) viruses use to render infected cells continuously cycling.
(iii) RB is able to repress directly c-fos gene expression (Robbins et al., 1990) and has been proposed to
have a similar effect on c-myc
expression (Pietenpol et al., 1990).
(iv) RB also suppresses cell growth by directly repressing transcription of
the rRNA and tRNA genes by blocking the activity of RNA polymerase I
transcription factor UBF (Cavanaugh et al, 1995; reviewed by White, 1998).
Hypophosphorylated RB, but not mutant RB, was
associated with the nuclear matrix, particularly concentrated at the nuclear
periphery and in nucleolar remnants, only during early G1; the peripheral
matrix proteins lamin A and C bound RB in vitro. This association was thought
to be important for the ability of RB to regulate cell cycle progression
(Mancini et al, 1994). It is interesting that mutated p53 but not wtp53
interacts with specific types of MARs (Will et al, 1998); nuclear matrix is an
essential structure for replication transcription recombination and repair
processes intimately connected to mechanisms of carcinogenesis.
The tumor suppressor function of RB is believed to
occur by complex formation between E2F and RB or the RB-related proteins p107
and p130, a complex that down-regulates the DNA-binding activities of E2F; the
transcription activating capacity of E2F on the genes it regulates can be
repressed by interaction with RB (Nevins, 1992). Cyclin A, believed to
facilitate DNA replication, also associates with E2F; both types of complexes,
E2F-RB and E2F-cyclin A, can be dissociated by the adenovirus E1A protein. The
release of E2F by E1A results in cell cycling and this constitutes an
additional mechanism of interference of adenoviruses with the proliferation of
the infected cells; release of E2F from RB induced by E1A is critical for
transformation of cells by E1A (for references see Hiebert et al, 1995).
The p107 protein with similarities in structure and
DNA-binding properties to RB also binds cyclin A; whereas RB is complexed to
E2F during G1 the p107-cyclin A complex interacted with E2F as cells entered S
phase (Shirodkar et al., 1992).
E2F is a transcription factor that activates the
adenovirus E2 gene and a number of cellular genes that respond to proliferation
signals and that control the passage of the cell cycle through S phase such as myc and DHFR genes and contributes to the uncontrolled proliferation of
adenovirus-transformed cells (Mudryj et al., 1991; see White, 1998, this
volume). It has been speculated that the physiological function of RB (and also
of its similar protein p107) in negatively-regulating cell growth and in acting
as a tumor suppressor protein are exerted via its ability to down-regulate the
activity of E2F (Shirodkar et al., 1992); this has been subsequently confirmed
by numerous studies. RNA ligands that bind to E2F1 were selected from RNA
libraries and were used to inhibit the induction of S phase in cultured cells
(Ishizaki et al, 1996). Such molecules might find applications in cancer
therapy because of the important role of E2F proteins in the regulation of cell
cycling.
Retinoblastoma protein has
a functional domain (the pocket) for binding to transcription factor E2F
implicated in cell growth control. The
same domain is responsible for the association of RB with the adenovirus E1A,
the SV40 large T, and the human papilloma virus E7 proteins (Kaelin et al.,
1992). Using an approach for
screening lgt11 expression libraries, clones encoding for
RB-binding proteins were identified; among those are RBAP-1 and 2, or
retinoblastoma-associated proteins 1 and 2 (Kaelin et al., 1992) and RBP3
(Helin et al., 1992). RBAP-1 binds
to the RB pocket, copurifies with E2F, contains a functional transactivation
domain, and binds to E2F cognate sequences (Kaelin et al., 1992).
E2F contains a RB-binding
domain in its C-terminus (Helin et al., 1992; Shan et al., 1992). RB binds directly to the activation
domain of E2F1 and silences it, thereby preventing cells from entering S phase.
To induce complete G1 arrest, RB requires the presence of the hbrm/BRG-1
proteins, which are components of the coactivator SWI/SNF complex. This
cooperation was mediated through a physical interaction between RB and
hbrm/BRG-1. RB can contact both E2F1 and hbrm at the same time, thereby
targeting hbrm to E2F1 (Trouche et al, 1997).
E2F cooperates with p53 to
induce apoptosis (Wu and Levine, 1994) and high levels of wild-type p53
potentiate E2F-induced apoptosis in fibroblasts (Qin et al, 1994). The
physiological relevance of E2F in the apoptotic mechanism was thought to arise
from the ability of E2F to act as a functional link between p53 and RB; p53
levels increase in response to high levels of E2F (DP is required for the
association of E2F with RB); overexpression of both E2F-1 and DP-1 led to a
rapid death of (IL-3)-dependent 32D.3 myeloid cells even in the presence of
survival factors (Hiebert et al, 1995). Overexpression of exogenous E2F-1 using
a tetracycline-controlled expression system in Rat-2 fibroblasts promoted S-phase
entry and subsequently led to apoptosis (Shan and Lee, 1994).
B.
Phosphorylation of RB: the TGF-b1, IL-1,
and IL-6 connection
Work from several groups
has shown that RB is un- or under-phosphorylated in G0/G1 and becomes
phospho-rylated in its N-terminal domain during S and G2/M (Buchkovich et al.,
1989; Chen et al., 1989; DeCaprio et al., 1989; Mihara et al., 1989). Only under-phosphorylated RB interacts
with E2F (Chellappan et al., 1991). Treatment with TGF-b1 maintained RB protein in its active dephosphorylated
form, thus providing a link between RB growth suppression and growth inhibition
by TGF-b1.
Interleukin-6 (IL-6), known to mediate autocrine and
paracrine growth of multiple myeloma (MM)
cells and to inhibit tumor cell apoptosis was determined to exert this function
via phosphorylation of RB protein; this finding could explain the abnormalities
of RB protein and mutations of RB gene associated with up to 70% of MM patients
and 80% of MM-derived cell lines. Culture of MM cells with RB antisense, but
not RB sense, oligonucleotide triggered IL-6 secretion and proliferation in MM
cells; phosphorylated pRB was constitutively expressed in MM cells and IL-6
shifted pRB from its dephosphorylated to its phosphorylated form (Urashima et
al, 1996).
Interleukin-1 (IL-1) causes G0/G1 phase growth arrest
in human melanoma cells, A375-C6 via hypophosphory-lation of RB protein.
Exposure to IL-1 caused a time-dependent increase in hypo-phosphorylated RB
that correlated with an accumulation of cells arrested in the G0/G1 phase; this
was abrogated by the SV40 large T antigen which binds preferentially to
hypo-phosphorylated RB, but not by the K1 mutant of the T antigen, which is
defective in binding to RB (Muthukkumar et al, 1996).
C. Genes regulated by RB protein
RB represses a number of genes by sequestering or
inactivating the positive transcription factor E2F and seems to activate some
other genes by interacting with factors like Sp1 or ATF-2 (Rohde et al, 1996).
RB protein is a master regulator of a complex network of gene activities
defining the difference between dividing and resting or differentiated cells.
Using the method of differential display Rohde et al (1996) detected a number
of genes which were upregulated by ectopic expression of the RB gene in
RB-deficient mammary carcinoma cells including the endothelial growth regulator
endothelin-1 and the proteoglycans versican and PG40.
Introduction of the wild-type RB gene via
retrovirus-mediated gene transfer has provided several RB-reconstituted
retinoblastoma cell lines (Huang et al., 1988; Chen et al., 1992). These RB+ cell lines showed little difference in
their growth rates in culture when compared to the parental or revertant RB- cells; however, RB+ cells invariably lost their
tumorigenicity in nude mice assays (Chen et al., 1992). RB protein down-regulates its own gene and this negative
autoregulation is mediated by the transcription factor E2F; this was shown by
inserting the promoter of the RB gene 5' of the bacterial CAT reporter gene
followed by its transfection into RB+ and RB- retinoblastoma
cells: RB promoter activity was signifi-cantly decreased in RB+ cells (Shan et al., 1994).
D. Transcription factors (TFs) that regulate the RB
gene
Several mutations have been found in the promoter
region of the RB gene, suggesting that inappropriate transcriptional regulation
of this gene contributes to tumorigenesis. The presence of E2F recognition
sites in promoters of a number of growth-related genes suggested that
expression of these genes might be affected by RB. Understanding the nature and availability of TFs which regulate
the RB gene in particular cell types is instructive for a successful gene
therapy application involving transfer of RB.
An E2F recognition site lies within a region critical
for RB gene transcription; binding of E2F-1 at this site transactivates the RB
promoter; striking back, the resulting overexpression of RB suppresses
E2F-1-mediated stimulation of RB promoter activity and, thus, the expression of
RB is negatively autoregulated through E2F-1 (Shan et al, 1994). Up-regulation
of the RB gene by E2F was shown by co-transfection of RB- osteosarcoma Saos2 cells in culture with a plasmid expressing
E2F-1 under the control of the CMV immediate-early gene promoter-CAT construct:
expression of E2F-1 stimulated RB promoter activity 10-fold under conditions
where E2F-1 had little effect on c-jun,
c-myc, and EGR-1 gene expression
(Shan et al., 1994). The
autoregulation of RB gene by RB may be accomplished via a direct protein-DNA
complex formation, via protein-protein interaction regulating the activity of
other transcription factors on the promoter of the RB gene, or both.
Two distinct DNA-binding factors, RBF-1 and ATF, play
an important part in the transcription of the human RB gene. The promoter of
the human RB gene and of the mouse RB1 gene (Zacksenhaus et al., 1993) contain
binding sites for ATF, and a Sp1-like transcription factor (Mitchell and Tijan,
1989) where the RBF-1 (retinoblastoma binding factor 1) may bind (Sakai et al.,
1991). Human RB gene is also regulated by AP-1 (Linardopoulos et al, 1993), as
well by the early response transcription factor, nerve growth factor inducible
A gene (NGFI-A) which is expressed in prostate cells and binds to the site
GCGGGGGAG at -152 to -144 within the RB gene promoter (Day et al, 1993). The
ATF site of the RB promoter is a responsive element during myogenic
differentiation; RB promoter activity increased about 4-fold during
differentiation and was reduced when a point mutation was designed in the ATF
site (Okuyama et al, 1996).
pRB activates expression of the human transforming
growth factor-b2 gene through ATF-2; the human RB gene promoter is
autoregulated by RB protein via an ATF-2-like binding site at the
carboxyl-terminal domain of pRB; overexpression of RB stimulates RB promoter
activity through the ATF binding site in a variety of different cell types
(Park et al, 1994).
The candidate oncoprotein Bcl-3, previously
characterized as a member of the IkB family, activated
transcription of the RB gene, whose promoter has no typical NF-kB sites, via binding to a DNA element identical to
E4TF1/GABP site; Bcl-3 promoted tetramerization of E4TF1. Expression of the
antisense bcl-3 RNA in myoblasts suppressed induction of RB and myogenic
differentiation whereas transient expression of bcl-3 in myoblasts was shown to
induce expression of the endogenous RB (Shiio et al, 1996).
Two oncogenic point mutations at the Sp1 and ATF
sites of the RB gene promoter were identified in two separate hereditary RB
families. The Sp1 consensus site mutation was blocking the action of RBF-1,
recently identified as the human GABP/E4TF1, a transactivator from the
adenovirus early-region 4 promoter. The human GABP/E4TF1 protein enhanced the
core RB promoter activity, whereas it did not stimulate a mutant RBF-1 site and
was proposed to be the most essential transcription factor for human RB gene
activation (Clark et al, 1997).
Whereas binding of the Sp1 transcription factor is
not significantly affected by methylation of the CpG dinucleotide within its
binding site, 5'-GGGCGG (lower strand, 5'-CCGCCC) methylation of the outer C is
inhibitory (mammalian cells also have the capacity to methylate cytosines at
CpNpG sites) and in particular methylation of both cytosines mCpmCpG
inhibited binding by 95%; endogenous mCpmCpG methylation
of an Sp1 site in the CpG island promoter of the RB gene was identified by
genomic sequencing in a proportion of retinoblastoma tumors which were
extensively CpG methylated in the RB promoter (Clark et al, 1997).
E. RB gene transfer
Functional loss of the RB gene has been implicated in
the initiation or progression of several human tumor types including cancer of
the eye, bone, bladder, and prostate. The cancer suppressor activity of RB was
directly demonstrated by the introduction of a normal RB gene into
retinoblastoma cells that have lost the RB function (inability to be
phosphorylated because of mutations at the appropriate sites) by mutation at
both alleles; this led to the suppression of the neoplastic phenotype and loss
of the tumorigenicity of RB cells in nude mice (Huang et al, 1988). Expression
of the normal RB gene into the human prostate carcinoma cell line DU145,
mediated by recombinant retrovirus integration, also resulted in loss of its tumorigenic
ability in nude mice (Bookstein et al, 1990). Studies with tumor cells
reconstituted with RB ex vivo and implanted into immunodeficient mice, as well
as with germline transmission of a human RB transgene into tumor-prone Rb+/-
mice have demonstrated cancer suppression (see Riley et al, 1996).
DU145 cells express a shorter protein lacking 35
amino acids from exon 21 due to a 105 nucleotide in-frame deletion (Bookstein
et al, 1990). The human bladder carcinoma cell line J82 contains a mutated RB
protein with exactly these features (Horowitz et al, 1989); this 35 amino acid
stretch is required for complexation with T antigen and E1A. However, the two
cell lines have lost exon 21 of RB because of a different type of mutation: J82
cells have a point AG to GG mutation in the intron 20-splice acceptor site but
the type of mutation in DU145 leading to exon 21 loss is different (Bookstein
et al, 1990).
Intratumoral infection of spontaneous pituitary
melanotroph tumors arising in immunocompetent Rb+/- mice with a
recombinant adenovirus carrying the RB cDNA inhibited the growth of tumors,
re-established innervation by growth-regulatory dopaminergic neurons, and
prolonged the life spans of treated animals (Riley et al, 1996).
Retrovirus-mediated gene transfer of RB to the breast
carcinoma cell lines MDA-MB468 and BT549, both of which harbor partial RB gene
deletions as well as point mutations of their p53 genes, restored its
expression in cells, reduced their ability to grow in soft agar, and their
tumorigenicity in nude mice, although it did not significantly altered growth
rate in culture (Wang et al, 1993).
Future therapeutic approaches using the RB gene are
directed toward inhibition in cell proliferation (such as to inhibit neointima
formation and smooth muscle cell proliferation in arterial diseases, see
Arterial injury below and Chang et al, 1995) rather that aggressive suppression
and apoptosis of solid tumors; p53 is a better gene than RB for tumor
eradication.
XX. Induction of apoptosis for cancer gene therapy
A. Apoptosis as an essential process
Apoptosis has become a basic tool in developing
cancer research in establishing new anticancer strategies. The health of a
multicellular organism depends both on the ability of the body to produce new
cells but also on the ability of certain type of cells to perish,
self-destruct, when they become superfluous or severely damaged. Apoptosis, or
programmed cell death, is a biological process associated with pronounced
morphological changes, chromatin condensation, drop in pH, and intranucleosomal
DNA degradation by which a cell actively commits suicide. Virtually all tissues
have apoptotic cells; salient examples in the adult are: the eye lenses which
consist of apoptotic cells that replaced their cytoplasm with crystallin;
intestinal wall cells which migrate to the tip of the finger-like projections
over several days where they die; ineffectual T cells which mature in thymus
and which would attack the bodyÕs own tissues are eliminated by apoptosis
before entering the bloodstream; skin cells migrate from the deepest layers to
the surface where they commit suicide forming the outer layer of the skin.
Apoptosis is an essential process during embryogenesis: mammals eliminate
neuron cells as the nervous system is formed; tadpoles delete their tails by
apoptosis (reviewed by Duke et al, 1996).
Virus-transformed as well as severely X-ray-damaged
or UV-damaged cells are similarly eliminated from the tissue via apoptosis; if
they are left they can form malignant cells. Initiated cancer cells may lead to
tumor development only when a dysfunction in their apoptotic pathway takes
place. Although the biochemical aspects of cell death are fraught with the
problem of cause versus effect, the role of apoptosis in neoplasia and its regulation
by a number of oncogenes and p53 has emerged. Apoptosis is essential for normal
development and homeostasis; deregulation in the positive control of apoptosis
is associated with cancer and autoimmune disease whereas deregulation in the
negative control of apoptosis is associated with degenerative diseases
(reviewed by White, 1993; Duke et al, 1996).
B. Molecular mechanisms for apoptosis: p53, Bax,
Bcl-2, c-Myc and other proteins
Apoptosis is of special interest in gene therapy not
only of cancer but of other diseases such as arterial disease. Apoptosis is a
complex process involving a significant number of apoptotic and antiapoptotic
mechanisms. The cytotoxic (killer) T lymphocytes of the immune system of the
infected organism bind to virus-infected cells inflicting their eradication
with two different type of proteins: Perforin is a transmembrane molecule
transferred from the killer T cell to the membrane of the infected cells
forming holes on the membrane of the target cell allowing uptake of proteases
called granzymes that activate ICE-like proteases to induce apoptosis. A number
of antiviral drug development strategies are based on blockage of the activity
of antiapoptotic viral proteins.
Expression of a number of genes induce apoptosis;
their protein products include adenovirus E1A (Debbas and White, 1993; Lowe and
Rudley, 1993) and c-Myc (Hermeking and Eick, 1994; Wagner et al, 1994). A
number of proteins when expressed at sufficient amounts block apoptosis; these
include Bcl-2 and E1B 19 kDa protein of adenovirus (Debbas and White, 1993;
Chiou et al, 1994). Exposure of cells to a variety of growth factors including
IL-3, IL-6, and erythropoietin, acting as survival factors, inhibit induction
of apoptosis (Johnson et al, 1993; Yonish-Rouach et al, 1993; Canman et al,
1995).
The role of p53 in these molecular processes has been
discussed in previous pages in this review. The involvement of p53 in apoptosis
is thought to occur via upregulation of bax
and downregulation of bcl-2 genes by
wt p53 but not by mutated p53 proteins; Bax protein induces apoptosis and its
upregulation triggers the apoptotic mechanism in cells which display elevated
levels of p53 as a result, for example, of DNA damage. Down-regulation of Bcl-2
has a similar effect on the induction of apoptosis. p53 may induce apoptosis
independently of transcription, although the G1 arrest by p53 requires
transcription of p53 targets (reviewed by Ko and Prives, 1996). Induction of
the apoptotic pathway by p53 was proposed to involve: (i) transcriptional induction of redox-related genes; (ii) formation of reactive oxygen species;
and (iii) the oxidative
degradation of mitochondrial components (Polyak et al, 1997). The potential of
p53 in cancer gene therapy is discussed above.
While p53 and E1A activate apoptosis, Bcl-2 and E1B
19k proteins inhibit apoptosis. All four protein molecules act upstream of Bax
which is a potent inducer of apoptosis: both the cellular Bcl-2 and the 19 kDa
protein E1B of adenovirus are able to interact with Bax inhibiting its
involvement in induction of apoptosis (Han et al, 1996; Figure 1 on page 9). E1A acts upstream of p53 by increasing the
half-life of p53 resulting in an accumulation of p53 molecules in the nucleus
(Lowe and Ruley, 1993); increased levels of p53 are then believed to upregulate
the bax gene (Figure 1). The survival factors IL-3 and IL-6 appear to prevent
p53-dependent apoptosis (see White, 1993).
p53 induces apoptosis after exposure to UV
irradiation (Ziegler et al, 1994) and hypoxia (Graeber et al, 1996); this acts
as a protective mechanism for the removal of severely damaged cells from the
body which could become initiated cancer cells and progress to tumors.
Spontaneous or radiation-induced apoptosis mediated by p53 has been shown to
act for the removal of cells from the gastrointestinal tract in mice (Merritt
et al, 1994) and the skin after sunburn (Ziegler et al, 1994). Epidermal growth
factor (EGF) has induced apoptosis in various cancer cell lines via a novel
signal transduction pathway of EGF mediated through p53 (Murayama and Horiuchi,
1997).
c-myc
expression, normally induced in proliferating hematopoietic cells by mitogens,
drops dramatically by mitogen withdrawal leading to cell arrest in G1. During deregulated c-myc expression,
c-myc levels were not down-regulated
upon mitogen withdrawal; instead, DNA synthesis continued resulting in
apoptosis but not in growth arrest. The
transforming segment of c-Myc was responsible for induction of apoptosis (see
White, 1993).
Pax5 is a repressor of expression of the p53 gene
interacting directly with a regulatory region within exon 1 of the p53 gene. At
early stages during pre-B cell development the levels of Pax5 are high and p53
is down-regulated; however, later in development Pax5 levels drop and the p53
gene is activated; this process was proposed to lead to the decision of B cells
to enter apoptosis or differentiate into plasma cells (Stuart et al, 1995).
Down regulation of the Cu2+/Zn2+ superoxide dismutase (SOD1) induced oxidative stress and
apoptosis (Troy et al, 1996). A great deal of oxidative damage during the
procedures for ex vivo-modification of cells induces their apoptosis; transfer
of the Cu2+/Zn2+ superoxide dismutase to ex vivo modified
cells increased their survival after implantation (see Nakao et al, 1995). This
demonstrates the importance of blocking apoptotic pathways during cell
manipulation for successful ex vivo gene therapy.
Gene therapy for cancer could involve restoration of
the apoptotic pathway in cancer cells leading to their suicidal death; this
could be effected by overexpression of the bax
gene, by suppression of the endogenous bcl-2
gene (see below), or by transfer of the wt p53 gene.
C. Role of tumor necrosis factor (TNF)
The tumor necrosis factor-a (TNF-a) is a cytokine produced
by macrophages, monocytes, lymphoid cells, fibroblasts and other cell types in
response to inflammation and infection. TNF-a
is produced by lipopolysaccharide (LPS)-stimulated macrophages; the molecular
pathways leading to TNF-a production in these specialized cells involves activation by LPS of several kinases
including the extracellular-signal-regulated kinases 1 and 2 (ERK1 and ERK2),
p38, Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK), as well
as activation of the immediate upstream MAPK activators MAPK/ERK kinases 1 and
4 (MEK1 and MEK4) and of MEK2, MEK3, and MEK6 (Swantek et al, 1997).
TNF-a binds to two type of
specific receptors, TNFR1 and TNFR2, causing their trimerization and leading to
activation of a number of kinases (ceramide-activated kinase, IkB kinase, Raf-1, Jun N-terminal kinases or JNKs,
p38/Mpk2). Activation of Raf-1, JNK, and p38/Mpk2 contribute to the induction
of AP-1 whereas activation of IkB kinase is leading to
the activation of the transcription factors NF-kB.
This activation leads further to upregulation of genes and induction of other
cytokines, metalloproteinases, and immunoregulatory proteins (see Liu et al,
1996 and the references cited therein).
TNF can induce apoptotic death or necrosis in some
tumor cells; this effect of TNF could be mediated by activation of
sphingomyelinases and phospholipases, synthesis of metabolites of arachidonic
acid, generation of free radicals, changes in intracellular calcium, generation
of DNA strand breaks and activation of poly(ADP-ribosyl)ation, or activation of
ICE-like proteases.
TNF-a, IL-1b, IFN-g, and vitamin D3 after
binding to their transmembrane receptors stimulate the production of the second
messager ceramide from sphingomyelin in the plasma membrane by activating
sphingomyelinase; this results in a cascade of signal transduction events that
result in down regulation of c-myc and induction of apoptosis, to terminal
differentiation, or to RB-mediated cell cycle arrest (Figure 23).
IL-1 signaling leads to NF-kB activation and to protection against TNF-induced
apoptosis. The IL-1R-associated kinase (IRAK) is homologous to Pelle of
Drosophila. Two additional proximal mediators, both associating with the IL-1R
signaling complex, were required for IL-1R-induced NF-kB activation: IRAK-2, a Pelle family member, and
MyD88, an adaptor molecule containing a death domain (Muzio et al, 1997).
Treatment of different cell types with TNF-a results in the activation of the MEKK1 pathway of
protein kinases ultimately resulting in AP-1 transcription factor activation
and in the upregulation of several cytokine genes. TNF-a-stimulation also results in the activation of NF-kB and inhibition of apoptosis (Figure 24). A TNF-responsive
Figure 23. A pathway leading to the
induction of growth arrest and apoptosis by the cytokines TNF-a, IL-1b, and IFN-g. The
pathway is conserved between mammalian cells and yeast. Adapted from Nickels
and Broach (1996). From Boulikas T (1997)
Gene therapy of prostate cancer: p53, suicidal genes, and other targets. Anticancer Res 17, 1471-1506.
Reproduced with the kind permission from Anticancer Research.
serine/threonine
protein kinase termed GCK-related (GCKR) most likely signals via
mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase
(ERK) kinase kinase 1 (MEKK1) to activate the SAPK pathway (Shi and Kehrl,
1997).
D. NF-kB as
anti-apoptotic molecule and TNF-a signaling
Activation of NF-kB
is believed to lead to the activation of antiapoptotic genes that have not been
fully identified. The antiapoptotic role of NF-kB
at the molecular level and the TNF-a connection consists of
the following events; signaling by TNF-a induces trimerization
of its receptors, an event causing three different cascades: (i) Activation of IkB kinase and activation of NF-kB, a pathway which prevents cell death. A key step for NF-kB activation leading
to the activation of the stress-activated protein kinase (SAPK, also called
c-Jun N-terminal kinase or JNK) is the recruitment to the TNF receptor of TNF
receptor-associated factor 2 (TRAF2).
(ii) induction of apoptosis via a different pathway involving activation of
sphingomyelinase in plasma membrane and generation of ceramide leading to EGFR
activation and induction of apoptosis; (iii) activation of MEKK1 and JNK
protein kinases which is not linked to apoptotic death but to AP-1 activation (Figure 24). The antiapoptotic function
of NF-kB may
involve activation of the manganese superoxide
dismutase and of the zinc finger protein A20; expression of these genes is
induced by TNF and each of them provides protection against apoptosis (Liu et
al, 1996).
bcl-2 upregulation during progression of prostate
cancer was implicated in the acquisition of the androgen-independent growth; a
strong antioxidant that interferes with activation of NF-kB in prostate carcinoma cells, potentiated TNF-a-stimulated apoptosis signaling through a
bcl-2-regulated mechanism; based on these studies, modulation of the NF-kB survival signaling was proposed to be used to
clinical advantage in the treatment of prostate cancer patients (Herrmann et
al, 1997).
Transgenic mice lacking the p65 (RelA) subunit of NF-kB displayed increased apoptosis and degeneration in
the liver providing further support to an apoptotic function of NF-kB (Beg et al, 1995). The TNF-induced death of mouse
primary fibroblasts expressing deregulated c-Myc was inhibited by transient
overexpression of the p65 subunit of NF-kB, which increased NF-kB activity in the cells (Klefstrom et al, 1997). Rel (a protooncogene, member of the NF-kB family) is implicated in both positive and negative
regulation of GM-CSF expression in a variety of cell types (Gerontakis et al,
1996).
The elucidation of IL-1, TNF, IFN and other signaling
pathways would lead to the discovery of new drugs causing specific inhibition;
for example, members of the IL-1 signaling cascade may provide therapeutic
targets for inhibiting IL-1-induced inflammation (Muzio et al, 1997).
Figure 24. TNF-a signaling
via trimerization of its receptors (TNF-aR1), is
causing: (i) activation of IkB kinase
and activation of NF-kB, a
pathway which prevents cell death via activation of the manganese superoxide dismutase and of the zinc
finger protein A20. (ii) induction
of apoptosis via second message ceramide (see Figure 23) and (iii) activation
of JNK leading to AP-1 activation and up-regulation of cytokine genes.
E. Interleukin-1b converting enzyme (ICE) and apoptosis
The human interleukin-1b
converting enzyme (ICE) is a cysteine-rich protease that can cleave the
inactive 31 kDa precursor of IL-1b to generate the active
cytokine; it has similarities to the C.
elegans CED-3 protein. This protease plays a central role in apoptosis; the
exact role and the involvement of IL-1b have not been
elucidated; it is believed that signals from IL-1b,
TNF-a, vitamin D3, and interferon-g, which induce an antiproliferative response,
converge on sphingomyelin of plasma membrane activating a sphingomyelinase
which generates a ceramide second messenger (Figure 23); in S. cerevisiae,
this leads to signal transduction via activation both of a cytoplasmic protein
phosphatase 2A and a protein kinase leading to down-regulation in c-myc expression and induction of
apoptosis as well as RB-mediated cell cycle arrest via EGFR activation (Nickels
and Broach, 1996).
At least 10 ICE-like proteases have been identified
which mediate apoptotic death after their induction by a number of stimuli (see
Martin and Green, 1995); these are divided into three families: (i) the ICE/CED3 family, including ICE
itself; (ii) the CPP32/Yama family;
and (iii) the Ich-1/Nedd2 family;
they all contain the conserved QACRG
pentapeptide in which the central cysteine participates in proteolytic
catalysis (see JŠnicke et al, 1996). Activation of these proteases by induction
of apoptosis results in the cleavage of a large number of key regulatory
proteins including among others poly(ADP-ribose) polymerase or PARP (Lazebnik
et al, 1994), RB (JŠnicke et al, 1996), PKCd (Emoto et al, 1995), Gas2
affecting microfilament reorganization (Brancolini et al, 1995), the
DNA-dependent protein kinase (Casciola-Rosen et al, 1995), and the sterol
regulatory element binding proteins (SREBPs) catalyzed by CPP32 ICE-like
protease (PARP et al, 1996). Since cleavage of a single protein has not been
shown to cause cell death it is not clear how many substrate protein molecules
need to be cleaved. In addition different apoptotic pathways may exist and may
operate in different cell types.
Expression of the murine ICE cDNA in Rat-1 cells induced programmed cell death and this
phenomenon could be reversed by overexpression of the bcl-2 oncogene (Miura et al, 1993). Expression of members of the
family of cysteine proteases related to ICE have been shown to be necessary for
programmed cell death in a number of organisms (Yuan et al, 1993).
Overexpression of murine ICE or of
the ICE-like proteases NEDD-2/ICH-1 and Yama/apopain induced apoptosis (Miura
et al, 1993). Mice lacking ICE were resistant to apoptosis induced by Fas
antibody (Kuida et al, 1995).
F. Role of poly(ADP-ribose) polymerase (PARP)
PARP is a central mediator of genome integrity and
transmits signals from DNA damage to recruit locally DNA repair activities
(Zardo et al, 1998; Quesada, 1998, this volume). An additional role of PARP is
its involvement in apoptosis causing suppression of an apoptotic endonuclease;
PARP is cleaved by an ICE-like protease during TNF-induced apoptosis (Lazebnik
et al, 1994). Cleavage of PARP would abort these pathways resulting in loss of
recruitment of DNA repair enzymes at damaged sites but also in loss in the
inhibitory function of poly(ADP-ribose) groups on key regulatory enzymes (DNA
ligase, topoisomerase). It is unlikely that PARP proteolysis by an ICE-like
protease is a primary event since PARP-deficient mice show normal resistance to
DNA damaging agents (Wang et al, 1995).
G. Apoptosis in autoimmune disease and ischemic heart
disease
T cells are produced by bone marrow and then migrate
to the thymus gland where they mature. The cytotoxic or killer T cells directed
against foreign bodies are released in the bloodstream; a specific apoptotic
mechanism eliminates T cells directed against specific antigens on healthy
cells. However, the body allows some mildly self-reactive lymphocytes to
circulate; although harmless, exposure to a microbe or food antigen can
stimulate them causing an expansion in their proliferation and resulting in a
mild autoimmune disease. Such mild autoimmune reactions usually disappear when
the stimulating antigen is cleared away; in more severe autoimmune disease,
however, these lymphocytes survive longer inducing apoptosis and
self-destruction in healthy cells in various tissues.
A number of classical diseases may originate by
autoimmune mechanisms including initiation of atherosclerosis by apoptotic
death of the epithelial cells in the arterial wall, diabetes by destruction of
the pancreatic cells, lupus erythematosus, rheumatoid arthritis, and others.
The mechanism via which T lymphocytes directed against self antigens defy
apoptosis is not known; the mechanism might involve overexpression of the Bcl-2
gene in these lymphocytes or down-regulation of a gene encoding for the Fas
ligand that sends a death message to the lymphocyte (Weih et al, 1996; reviewed
by Duke et al, 1996).
Excessive necrotic death in cells of the coronary
artery wall results by oxygen and glucose deprivation after blockage of a blood
vessel feeding a segment of the heart (also the brain in stroke). Destructive
free radicals are then produced during inflammation of the area which can cause
apoptotic or necrotic death in cells in the surroundings. Since both brain and
heart cells in the adult are not regenerated, Biotech Companies (for example
Genentech) are focusing in developing drugs that block free radical formation,
inhibit ICE-like proteases, or inhibit apoptosis via other mechanisms.
The progressive loss of neuron cells in senile or
other brain diseases such as AlzheimerÕs disease, ParkinsonÕs disease,
HuntingtonÕs disease, and amyotrophical lateral sclerosis may ensue by
apoptosis. Etiologic factors may include excessive levels of neurotransmitters,
low levels of NGF, free radical-mediated damage, and deregulation in the
expression of genes encoding apoptotic regulators during aging. Deregulation in
apoptosis may also have a share in the induction of osteoporosis.
XXI. Genes
involved in the regulation of apoptosis as targets for gene therapy
Many of the molecular controllers of apoptosis
including cytokine signaling pathways (TNF-a,
IL-1b), tumor suppressor proteins (p53), viral proteins
(E1A of adenovirus), cellular oncoproteins (Myc), proteins that control the
cell cycle (E2F), apoptosis inducers (Bax) and antiapoptotic molecules (Bcl-2,
NF-kB) could constitute potential targets for
pharmacological intervention for the treatment not only of cancer but of other
human disease. Although for cancer treatment it is desirable to induce
apoptosis, the opposite effect, that is inhibition of apoptotic pathways is
desirable in the gene therapy of heart disease and degenerative brain disease
(see below).
A. Gene therapy that targets bcl-2
Bcl-2 protein is overexpressed in a variety of human
leukemias because of translocation of its gene to the immunoglobulin locus;
Bcl-2 is associated with the outer surface of the mitochondrion and appears to
be involved in scavenging oxygen radicals. Overexpression of the bcl-2 gene in tumors is thought to be
responsible for the poor response of the tumors to antineoplastic drugs and
radiation therapy blocking apoptosis of the tumor cells. Bcl-2 can interact
with members of the Bcl-2 family including Bax, Bcl-X-S, Bcl-X-L, and Mcl-1 but
also with heterologous protein molecules including BAG-1, Raf-1, and R-Ras.
Introduction of the bcl-2 gene into human diploid breast epithelial MCF10A cells
(containing the wild-type p53 gene)
resulted in suppression in p21 gene
expression although the level of expression of p53 was not affected; these studies suggested that Bcl-2 may
inhibit the functional activity of p53 protein and might regulate the
commitment of cells to commit suicide or proliferate (Upadhyay et al, 1995).
Overexpression of the bcl-2 gene in tumors is thought to be responsible for the poor
response of the tumors to antineoplastic drugs and radiation therapy blocking
apoptosis of the tumor cells; therefore, down-regulation of the bcl-2 gene specifically in tumor cells
could induce apoptosis. Primary untreated human prostate cancers were found to
express significant levels of this apoptosis-suppressing oncoprotein; this is a
striking difference with normal prostate secretory epithelial tissue not
expressing Bcl-2 (Raffo et al, 1995). Transfection of LNCaP human prostate
cancer cells with a plasmid expressing bcl-2
rendered these cells highly resistant to a variety of apoptotic stimuli (serum
starvation or treatment with phorbol ester) and induced earlier and larger
tumors in nude mice. The ability of Bcl-2 to protect prostate cancer cells from
apoptotic stimuli correlated with the ability of the cells to form
hormone-refractory prostate tumors in nude mice (Raffo et al, 1995).
The Bcl-2 oncoprotein suppresses apoptosis and, when
overexpressed in prostate cancer cells, makes these cells resistant to a
variety of therapeutic agents, including hormonal ablation. Overexpression of
BCL-2 is common in non-Hodgkin lymphoma leading to resistance to apoptosis and
promoting tumorigenesis. Therefore, bcl-2 provides a strategic target for the
development of gene knockout therapies to treat human prostate cancers (Dorai
et al, 1997) and non-Hodgkin lymphomas (Webb et al, 1997).
Down-regulation of Bcl-2 can be accomplished with
antisense. In patients with relapsing non-Hodgkin lymphoma, BCL-2 antisense
therapy led to an improvement in symptoms; antisense oligonucleotides targeted
at the open reading frame of the BCL-2 mRNA showed effectiveness against
lymphoma grown in laboratory animals and has entered human clinical trials. The
first study was conducted on nine patients with BCL-2-positive relapsed
non-Hodgkin lymphoma using a daily subcutaneous infusion of 18-base, fully
phosporothioated antisense oligonucleotide administered for 2 weeks (Webb et
al, 1997). A local inflammation at the infusion site was noted. A reduction in
tumour size was observed in two patients (one minor, one complete response)
using computed tomography scans; in two other patients, the number of
circulating lymphoma cells decreased during treatment. In four patients, serum
concentrations of lactate dehydrogenase fell, and in two of these patients symptoms
improved (Webb et al, 1997).
A divalent hammerhead ribozyme, constructed by
recombining two catalytic RNA domains into an antisense segment of the coding
region for human bcl-2 mRNA was able to rapidly degrade bcl-2 mRNA in vitro; it
was then tested for its ability to eliminate bcl-2 expression from
hormone-refractory prostate cancer cells. When this hammerhead ribozyme was
directly transfected into cultured prostate cancer cells (LNCaP derivatives),
it significantly reduced bcl-2 mRNA and protein levels within 18 hr of
treatment and induced apoptosis in a low-bcl-2-expressing variant of LNCaP, but
not in a high-bcl-2-expressing LNCaP line (Dorai et al, 1997).
B. Bcl-xs
Many cancers overexpress a member of the Bcl-2 family
of inhibitors of apoptosis, such as Bcl-2 and Bcl-xL. Members of the Bcl-2
family were found to be essential for survival of cancer cells derived from
solid tissues including breast, colon, stomach, and neuroblasts (Clarke et al,
1995). On the contrary, Bcl-xs is a dominant negative repressor of Bcl-2 and
Bcl-xL; thus, Bcl-xs induces apoptosis. Transient overexpression of Bcl-xs in
MCF-7 human breast cancer cells, which overexpress Bcl-xL, with a
replication-deficient adenoviral vector induced apoptosis in vitro;
intratumoral injection of the bcl-xs adenovirus on solid MCF-7 tumors in nude
mice showed a 50% reduction in size with evident apoptotic cells at sites of
injection (Ealovega et al, 1996).
An adenovirus vector expressing bcl-xs specifically
and efficiently killed carcinoma cells arising from multiple organs including
breast, colon, stomach, and neuroblasts even in the absence of an exogenous
apoptotic signal such as x-irradiation. In contrast, normal hematopoietic
progenitor cells and primitive cells capable of repopulating SCID mice were not
killed by the bcl-xs adenovirus. Thus, transfer of the bcl-xs gene could be
used in killing cancer cells contaminating the bone marrow of patients
undergoing autologous bone marrow transplantation (Clarke et al, 1995).
C. E2F-1 and TNF-a gene transfer
E2F cooperates with p53 to induce apoptosis; high
levels of wild-type p53 potentiate E2F-induced apoptosis in fibroblasts. The
physiological relevance of E2F in the apoptotic mechanism is thought to arise
from the ability of E2F to act as a functional link between p53 and RB; p53
levels increased in response to high levels of E2F. Targeted disruption of the
E2F-1 gene yields transgenic animals with an excess of mature T cells due to a
defect in lymphocyte apoptosis (Field et al, 1996).
Overexpression of the transcription factor E2F-1
could induce apoptosis in quiescent rat embryo fibroblasts in a p53-dependent
manner; however, Hunt et al (1997)
have shown that overexpression of the E2F-1 gene after adenoviral transfer can
mediate apoptosis in the absence of wild-type p53: adenovirus-mediated transfer
of the E2F-1 gene under control of the CMV promoter to human breast and ovarian
carcinoma cell lines resulted in the induction of significant morphological
changes in four of the five cell lines that had mutations in the p53 gene
within 48 h of transduction characteristic of apoptosis.
Retroviral vector-mediated transfer of the TNF-a gene into the DNA of human tumor cells induced
apoptosis in high- TNF-a-producing clones generated from a human lymphoma
T-cell line (ST4); the apoptotic death of the cells was associated with a
downregulation of the apoptosis-preventing gene, bcl-2, while the expression of
bax and p53 genes persisted (Gillio et al, 1996).
D. E6, E7 of human papillomavirus (HPV)
E6 and E7 of HPV possess transforming ability, have
been shown to interact with the cellular tumor suppressors p53 and RB (Werness
et al, 1990; Dyson et al., 1989) and are believed to play a central role in
HPV-induction of cervical carcinogenesis as well as in the maintenance of the
malignant phenotype. Viruses have developed strategies to shut down protein
synthesis in the host and subdue its protein synthesizing machinery to produce
progeny virus when infecting cells. Because virus-infected cells commit suicide
to protect the organism from further infection viruses have evolved mechanisms
to prevent apoptosis of the host cell ensuring their propagation; E6 protein
interacts with p53 to exclude p53 molecules from their apoptotic functions and
to inhibit apoptosis in HPV-infected cells thus giving to HPV a proliferation
advantage.
27-mer phosphorothioate oligodeoxynucleotides
(oligos) targeting the ATG translational start region of HPV-16 E6 and E7
sequences showed antiproliferative effects in all HPV-16-positive cell lines
tested and in primary cervical tumor explants while the endometrial and two
ovarian primary tumors as well as the HPV-negative C33-A cell line and
HPV-18-positive cell line HeLa were relatively insensitive to the HPV-16 oligos
(Madrigal et al, 1997).
E. Prevention of apoptosis for gene therapy of heart
disease and for ex vivo manipulations of therapeutic cells
As induction of apoptosis is the desired effect for
the gene therapy of cancer, prevention of apoptosis by gene therapy can fight
heart disease. Cardiomyocyte death results from heart ischemia proceeding via
necrosis and from reperfusion which induces additional cardiomyocyte death by
apoptosis; prevention of apoptosis would constitute an important target for
fighting heart disease. Prevention of apoptosis should also solve a major
problem in cell culture cells which are subject to oxidation damage during
their manipulation for ex vivo gene
transfer and most important during the step of reimplantation, encapsulation in
biopolymer membranes for surgical implantation, and similar processes.
Prevention of apoptosis could be effected by transfer and overexpression of the
bcl-2 gene. Also prevention of
oxidative damage during reimplantation of ex
vivo-modified cells could be reduced by transfer and overexpression of the
Cu/Zn superoxide dismutase gene (Nakao et al, 1995).
Overexpression of bcl-2 delayed onset of motor neuron
disease and prolonged survival in a transgenic mouse model of familial
amyotrophic lateral sclerosis (Kostic et al, 1997).
XXII. E1A and HER-2/neu (c-erbB-2) in cancer gene
therapy
A. HER-2/neu
The human epidermal growth factor receptor-2 (HER2),
a membrane tyrosine kinase highly expressed in many epithelial tumors, could be
a target for cancer gene therapy.
The HER-2/neu (also called c-erbB-2) proto-oncogene is overexpressed in
many human cancer cells, including those of breast cancer and ovarian cancer
correlating with lower survival rate in ovarian cancer patients; amplification
or overexpression of HER-2/neu has also been observed in human lung cancer and
has been correlated with poor prognosis and chemoresistance.
A reversible transformation of NIH3T3 fibroblasts by
overexpression of the HER2/c-erbB2 receptor tyrosine kinase under control of a
tetracycline-responsive promoter has been demonstrated in tissue culture;
induction of HER2 expression resulted in cellular transformation in vitro and
treatment of transformed cells with the effector anhydrotetracyline
switched-off HER2 expression and induced morphological and functional changes
characteristic for non-transformed cells (Baasner et al, 1996).
B. E1A-based gene therapy
E1A-based gene therapy approaches are now in clinical
trials (see below); the molecular mechanism behind this approach is that the
E1A protein of Adenovirus 5 represses HER-2/neu transcription and functions as
a tumor suppressor gene in HER-2/neu-overexpressing cancer cells. Breast cancer
cells that overexpress HER-2/neu are more resistant to chemotherapeutic agents
such as paclitaxel (Taxol) and docetaxel (Taxotere) than those that do not
overexpress HER-2/neu; paclitaxel sensitivity correlated with HER-2/neu
expression level in a panel of mouse fibroblasts expressing different levels of
HER-2/neu; downregulation of HER-2/neu expression by E1A sensitized the cells
to paclitaxel. Transfer the E1A gene into two human breast cancer cell lines
that overexpress HER-2/neu and E1A gene transfer sensitized these cells to the
drug by repressing HER-2/neu expression (Ueno NT et al, 1997).
Increased HER-2/neu expression led to more severe
ovarian malignancy and increased metastatic potential in animal models; the
adenovirus 5 E1A gene repressed HER-2/neu gene expression and suppressed growth
of human ovarian cancer SKOV-3 cells, which overexpress HER-2/neu, in cell
culture (Yu et al, 1995). Intraperitoneal injection of SKOV-3 cells into female
nu/nu mice elicited tumors and the animals died within 160 days of severe tumor
symptoms; cationic liposome-mediated delivery of the E1A gene into
adenocarcinomas that developed in the peritoneal cavity and on the mesentery of
the mice significantly inhibited growth and dissemination of ovarian cancer
cells; about 70% of the treated mice survived at least for 365 days (Yu et al,
1995).
Regulatory regions derived from the 5' flank of the
human prostate-specific antigen (PSA) gene were inserted into adenovirus type 5
DNA to drive the expression of the E1A gene; infection of cells in culture with
this recombinant adenovirus was able to drive the expression of the E1A gene
only in cell lines which expressed PSA such as the human LNCaP cells but not in
human DU145 cells which do not express PSA; the recombinant adenovirus
destroyed large LNCaP tumors (1x109 cells) and abolished PSA production in
nu/nu mouse xenograft models after a single intratumoral injection (Rodriguez
et al, 1997).
A replication-deficient adenovirus containing the E1A
gene, Ad.E1A+,
was used to transduce E1A into HER-2/neu-overexpressing and low expressing
human lung cancer cell lines and shown a better therapeutic efficacy in
HER-2/neu-overexpressing cells. The cell culture studies were then extended to
animal studies: tumor-bearing mice established by intratracheal injection of
lung cancer cells overexpressing HER-2/neu and treated by i.v. tail injections
of Ad.E1A+ showed suppression of the intratracheal
lung cancer growth. However, no significant tumor suppression effect was
observed in mice bearing a low HER-2/neu-expressing cell line
with the same regimen (Chang et al, 1996).
C. Clinical trials with E1A and c-Erb-B2
Liposome-mediated E1A gene transfer suppressed tumor
development and prolonged survival of mice bearing human breast cancer cells
overexpressing HER-2/neu. These studies resulted in the initiation of a phase I
clinical trial using an E1A-liposome complex administered to patients with
HER-2/neu-overexpressing breast or ovarian cancer (Protocol 205 in Table 4 of following article, pages
203-206). The principal investigators are Drs. Hortobagyi, Lopez-Berstein, and
Hung at MD Anderson Cancer Center, Houston, Texas). The safety of this regimen
was shown by intraperitoneal injection of E1A/liposomes in normal mice and at
cumulative doses 5 to 40 times the DNA-lipid starting dose proposed for the
phase I clinical trial (Xing et al, 1997). A Phase I multicenter study of
intratumoral E1A gene therapy using cationic liposome gene transfer is also in
course for patients with unresectable or metastatic solid tumors that
overexpress HER-2 /neu (protocol 209, see page 205).
Delivery of an anti-erbB-2 single chain (sFv)
antibody gene for previously treated ovarian and extraovarian cancer patients
is in clinical trials using adenoviral gene delivery (protocol #133). A
clinical trial for tumor vaccination with HER-2
/Neu using a B7 expressing tumor cell line prior to treatment with HSV-tk
gene-modified cells is in phase I for ovarian cancer (protocol #96, page 165).
XXIII. Suicidal genes for cancer therapy (prodrug
gene therapy)
A. Molecular mechanism of cell killing with HSV-tk
gene and ganciclovir (GCV)
Expression of genes encoding prodrug-activating
enzymes can increase the susceptibility of tumor cells to prodrugs, and may
ultimately achieve a better therapeutic index than conventional chemotherapy (Table 3). Direct suppression of tumor
growth by cytotoxic gene therapy is a successful gene transfer approach. This
approach has promise for a variety of other applications where excess cell
proliferation is detrimental and has also been used to restrict intimal
hyperplasia of the arterial wall and smooth muscle cell growth to limit
restenosis after artery angioplasty (see below).
Cancer cells can be induced to be conditionally
sensitive to the antiviral drug ganciclovir after their transduction with the
thymidine kinase (tk) gene from the
herpes simplex virus (HSV); ganciclovir (GCV) is the
9-{[2-hydroxy-1-(hydroxymethyl)-ethoxy]methyl}guanine (Field et al, 1983); it
is converted by HSV-tk into its
monophosphate form which is then converted into its triphosphate form by
cellular enzymes and is then incorporated into the DNA of replicating mammalian
cells leading to inhibition in DNA replication and cell death (Moolten, 1986;
Borrelli et al, 1988; Moolten and Wells, 1990). It is only viral TK, not the
mammalian enzyme, that can use efficiently ganciclovir as a substrate and this
drug has been synthesized to selectively inhibit herpes virus replication
(Field et al, 1983); indeed, the mammalian TK has a very low affinity for this
guanosine analog. The toxicity of ganciclovir is manifested only when cells
undergo DNA replication and it is not harmful to normal nondividing cells. This
treatment strategy has been used for hepatocellular carcinoma (Huber et al,
1991; Su et al, 1996), fibrosarcoma, glioma (Culver et al, 1992, see below),
adenocarcinoma (Osaki et al, 1994), prostate cancer (Eastham et al, 1996) and
many other cancers.
B. Treatment gliomas in rats with HSV-tk plus ganciclovir
Brain tumors have the privilege of escaping
immunologic rejection; therefore brain tumors are inaccessible to cancer
immunotherapy. Culver and cowor-
Table 3. Prodrugs and enzymes used for
their activation
|
Prodrug-activating enzyme |
Prodrug |
Toxic substance it is converted to |
|
Thymidine
kinase from HSV |
9-{[2-hydroxy-1-(hydroxymethyl)-ethoxy]methyl}guanine
or ganciclovir (GCV) |
GCV
monophosphate |
|
Cytosine
deaminase (CD) from E. coli |
5-fluorocytosine
(5FC) |
5-fluorouracil
(5FU) |
|
Purine
nucleoside phosphorylase (PNP) from E.
coli |
6-methylpurine-2Õ-deoxyriboside
(MeP-dR) |
6-methylpurine
(a very toxic adenine analog) |
|
Purine
nucleoside phosphorylase (PNP) from E.
coli |
Arabinofuranosyl-2-fluoroadenine
monophosphate (F-araAMP) commercially known as fludarabine |
A very
toxic adenine analog |
|
Human
deoxycytidine kinase (dCK) |
Cytosine
arabinoside (ara-C) |
A toxic
drug inducing lethal strand breaks in DNA |
|
Nitroreductase
from E. coli |
5-(aziridin-1-yl)-2,4-dinitrobenzamide
(CB1954) |
A potent
dysfunctional alkylating agent which crosslinks DNA |
kers
(1992) took advantage of the fact that retroviral vectors require DNA synthesis
for stable integration into the host genome to target gliomas in rats. Murine
fibroblasts were transduced with a retroviral vector expressing the HSV-tk gene (see above); the tumor cell mass
was then infiltrated by intratumoral injection of the HSV-tk-producing fibroblasts. This treatment gave a
continuous local infusion of retroviral vector from the injected fibroblasts,
integrating into the dividing cells of the growing brain tumor but not into the
nondividing normal cells in the surroundings. Treatment of rats at day 5 after
transplantation with ganciclovir (GCV) resulted in the complete regression of
the tumor cell mass; this was thought to be induced by killing of cells that
respond to signals promoting angiogenesis in the immediate vicinity of the
tumor; vascular endothelial cells in the normal brain tissue, exhibiting
cycling at a low rate, apparently were not affected. Other proliferating
tissues, such as intestinal epithelium, thymus, and bone marrow, which might
also uptake the retroviral HSV-tk vector
and then be destroyed during GCV treatment were not affected by this approach
over a 30 day period of treatment with GCV (Culver et al, 1992).
A replication-defective, highly purified retroviral
vector at titers of 108 colony forming units/mL was used to treat 9L
gliosarcoma cells in rat brain. Animals with established 9L tumors treated with
intralesional injection of the HSV-tk retrovirus
followed by GCV treatment showed at day 26 that 29% (4/14) had no tumor and 50%
(7/14) of the animals had < 1% tumor volume; substantial numbers of CD4+ and CD8+ lymphocytes infiltrated the tumors of animals treated with
HSV-tk and GCV; the former tumor bed
in cured animals contained cell debris, immune cells, and fibroblasts without
signs of damage to the adjacent brain tissue (Kruse et al, 1997).
C. The bystander effect of HSV-tk/GCV
During HSV-tk/GCV treatment of brain tumors products
from the dying cells in the brain tumor killed nearby non-HSVtk-transduced
cancer cells without affecting normal cells, an effect described as
"bystander" antitumor effect (Culver et al, 1992). The bystander
effect of the HSV-tk plus GCV system
appears to be powerful and significant, circumventing the low efficiency of
transduction in vivo with recombinant
retroviruses. Because of this effect, the low-level percentage of cells that
can be transduced with a retrovirus can cause the elimination of a much larger
percentage of proliferating cells in their surroundings (Kimura et al, 1996).
In vitro, the ÒbystanderÓ effect works by transfer of
cytotoxic small molecules between cells via gap junctions. In order to
understand the Òbystander effectÓ mechanism during which adjacent nontransduced
tumor cells are killed, Yamamoto et al (1997) used Renca cells from a renal
carcinoma cell line transduced with a retroviral vector bearing the HSV-tk gene to inoculate BALB/c mice. After
complete regression of inoculated tumors with GCV treatment, the animals were
challenged with nontransduced tumor cells. In these animals, tumor-specific
cytotoxic CD8+ T cells were
efficiently induced which promoted the rejection or significant growth
inhibition of challenged tumor cells.
In a similar experiment, set to assess the Òbystander
effectÓ in vivo, mixtures of HSV-tk-transduced and nontransduced oral squamous carcinoma
cells were implanted subcutaneously in the left flank of nude mice, and naive
HSV tk- cells were implanted subcutaneously in the right
flank. Treatment with GCV eradicated the tumors in the left flank consistent
with a predicted bystander effect but also resolved or arrested the growth of
the naive tumors in the right flank. The histology of regressing tumors from
the right flank showed an infiltration of lymphoid cells suggesting that an
immune-related antitumor response accounted for the distant bystander effect
(Bi et al, 1997; see also Ramesh et al, 1998 this volume).
The induction of higher levels of HSV-tk expression does not augment the
sensitivity to GCV: adenoviral vectors that expressed HSV-tk at different
efficiencies from CMV versus RSV promoters did not display a significant
difference in antitumor effects; thus, increasing the HSV-TK enzyme levels per
cell above a minimal threshold level will not be effective in cell killing with
GCV. To enhance the therapeutic responses of the HSV-tk/GCV system one needs to
improve other parameters such as to use higher doses of GCV, to enhance the
"bystander effect," to engineer mutant HSV-tk genes with higher
substrate affinities, or to discover vectors with increased transduction
efficiencies (Elshami et al, 1997).
Suicide gene therapy may be useful not only for
short-term tumor regression mediated by direct cell killing and bystander
effect, but may also exert a therapeutic vaccination effect resulting in
long-term tumor regression and prevention of recurrence (Yamamoto et al, 1997).
D. Additional examples of tumor eradication with
HSV-tk/GCV
Chen et al (1996) used a recombinant adenoviral
vector containing the HSV-tk gene for the treatment of metastatic colon
carcinoma in the mouse liver; the HSV-tk alone exhibited substantial
regression, although all treated animals suffered from subsequent relapses.
Delivery of the HSV-tk + mouse IL-2 genes in adenoviral vectors to the hepatic
tumors induced an effective antitumor immune response which nevertheless waned
with time, and the treated animals eventually succumbed to hepatic tumor
relapse; however, after combination treatment with HSV-tk, mouse IL-2, and
mouse GM-CSF a fraction of the animals developed long-term antitumor immunity
and survived for more than 4 months without tumor recurrence (Chen et al,
1996).
Microinjection of the HSV-tk gene, under control of a-fetoprotein enhancer and albumin promoter, in a
linear form flanked by the adeno-associated virus ITRs into pronuclei of mouse
embryos led to transgenic animals expressing preferentially HSV-tk into adult liver cells; this led to
an approach for the treatment of hepatocellular carcinomas (Su et al, 1996).
Subcutaneous tumors induced by injection of RM-1 (mouse prostate cancer) cells
in mice followed by injection of HSV tk in
an adenovirus vector and treatment with ganciclovir for 6 days showed reduction
in tumor volume (16% of control) and higher apoptotic index in tumor cells
(Eastham et al, 1996). Recombinant adenoviruses carrying the HSV-tk gene under
control of the CMV promoter displayed a significant cell killing efficiency for
the eradication of brain tumors and leptomeningeal metastases in rats (Vincent
et al, 1997).
Pancreatic cancer is the fifth leading cause of
cancer death in the United States. In order to treat peritoneal dissemination,
one of the most common complications of the malignancies of the digestive
system such as gastric or pancreatic cancers, mice were intraperitoneally
(i.p.) inoculated with the human pancreatic cancer cell line PSN-1; i.p.
transfer of the HSV-tk suicidal gene under control of the potent hybrid CAG
promoter was achieved with a DNA-lipopolyamine complex given eight days from
the injection of cancer cells; animals were treated with GCV for 8 days; 8 out
of 14 mice treated with HSV-tk and
GCV were free of tumors on day 24. The gene transfer method resulted in the
transduction of tumor nodule cells and not in normal organs as shown by reverse
transcription polymerase chain reaction (RT-PCR) analysis as well as by
transfer of the lacZ gene under similar conditions and localization of the blue
staining; HSV-tk was expressed in about 10% of tumor cells but not in the
normal pancreas or in the small intestine (Aoki et al, 1997).
A murine pancreatic ductal adenocarcinoma cell line
was used to induce intrahepatic solid tumors into the left lateral liver lobe;
intratumoral injection of an adenovirus vector carrying the HSV-tk gene under
control of the RSV promoter in combination with intraperitoneal administra-tion
of ganciclovir caused a significant reduction in tumor volume and necrosis;
because pancreatic cancer patients have an overall low survival since
metastases have already taken place at the time of diagnosis and because
surgical resection of pancreatic cancers does not significantly change the
clinical outcome even in combination with chemotherapy, gene therapy might
offer an effective approach in the near future (Block et al, 1997).
HSV-tk gene transfer was successfully used to
eradicate adenocarcinoma-derived peritoneal carcinomatosis, a common clinical
situation which, in most cases cannot be controlled by surgery or chemotherapy.
DHD/K12 colon carcinoma cells stably expressing the HSV-tk gene were injected intraperitoneally to rats leading to the
development of peritoneal carcinomatosis within 2-3 weeks from injection (Figure 25A). Treatment of these animals
with GCV (Figure 25C) resulted in
the eradication of the peritoneal tumor nodes. It ought to be emphasized,
however, that the same spectacular results are not expected when treating
tumors in patients; tumor cells in patients need first to be transduced with
the HSV-tk gene whereas the cells
used to elicit these tumors in animals were already transduced with the HSV-tk gene in cell culture and most or all
cells were expressing the viral thymidine kinase.
Retrovirus-mediated transfer of HSV-tk was used to kill proliferating cells
in rabbit models of proliferative
vitreoretinopathy (PVR); traction retinal detachment results from
proliferation of retinal pigment epithelial, glial, macrophages, and fibroblast
cells in the vitreous cavity of the eye forming contractile membranes on both
surfaces of the retina; PVR may ensue after retinal surgery or trauma and can
be induced in rabbit models by surgical vitrectomy to facilitate cell
attachment to the retina. Injection, into the vitreous cavity, of rabbit dermal
fibroblasts transduced in vitro with
retroviral vectors carrying the HSV-tk
gene was used to preferentially kill
proliferating cells for PVR in rabbit models; all eyes received 0.2 mg GCV on
the following day and on day 4; significant inhibition of PVR was observed thus
providing a novel therapeutic strategy for this disease (Kimura et al, 1996).
E. Expression of cytosine deaminase (CD) gene from E. coli and treatment with
5-fluorocytosine
Another suicide gene approach has been the expression
of the cytosine deaminase (CD) from E.
coli; mammalian cells, unlike certain bacteria and fungi, do not posses
this enzyme. The CD protein normally catalyzes the conversion of cytosine to
uracil but has been exploited for the conversion of the prodrug
5-fluorocytosine (5FC) into the toxic 5-fluorouracil (5FU); treatment of cells,
transfected with this construct, with 5FC resulted in the conversion of the 5FC
into the antitumor drug 5FU into CD-expressing tumor cells (Mullen et al, 1992;
Austin and Huber, 1993; Huber et al, 1993; 1994; Richards et al, 1995).
This approach has been used for the treatment of
primary and metastatic hepatic tumors based on the overexpression of the
suicidal CD gene under control of the
regulatory regions of the tumor marker gene carcinoembryonic antigen (Richards
et al, 1995, see below).
Szary et al (1997) have developed a model for tumor
radiosensitization using the CD gene/5FC system; when melanoma cells were
transfected with the CD gene, subsequent treatment with 5FC sensitized the
cells to radiation damage; 5FC did not change the radiosensitivity of parental,
nontransfected cells; increased toxicity to radiation damage was thought to
arise from 5-fluorouracil generated by CD.
Figure 25. Eradication of peritoneal
carcinomatosis with HSV-tk plus GCV. Intraperitoneal injection to rats of
DHD/K12 colon carcinoma cells stably expressing the HSV-tk gene caused peritoneal carcinomatosis at day 21 (A). The animal whose intraperitoneal
cavity is shown in (B) was treated
with HBSS buffer alone and the animal shown in (C) was treated with GCV for 5 days at 150mg/Kg. The letter ÒTÓ
indicates the peritoneal tumor nodes. From Lechanteur C, Princen F, Bue SL,
Detroz B, Fillet G, Gielen J, Bours V, and Merville M-P (1997) HSV-1 thymidine
kinase gene therapy for colorectal adenocarcinoma-derived peritoneal
carcinomatosis. Gene Ther 4,
1189-1194. Reproduced with the kind permission of the authors (Vincent Bours,
University of Lige, Belgium) and of Stockton Press.
Infection of the human breast cancer cell line,
MDA-MB-231, with a recombinant adenovirus expressing the Escherichia coli CD resulted in high levels of cytosine deaminase
enzyme activity and infected cells became 1000-fold more sensitive to 5-FC than
cells infected with a control adenovirus; only 10% of infected cells in a
population were needed to induce complete cytotoxicity of noninfectious cells
exposed to 5-FC via bystander effects. Direct injection of the CD-adenovirus
into human breast tumor xenografts in nude mice, followed by daily
intraperitoneal injection of 5-FC was sufficient to inhibit tumor growth (Li et
al, 1997).
F. Bacterial purine nucleoside phosphorylase (PNP)
gene
Another suicide gene/prodrug couple is the E. coli DeoD gene which encodes the
purine nucleoside phosphorylase (PNP). The E.
coli PNP, unlike the mammalian endogenous PNP, can utilize certain
adenosine analogs as substrates including nontoxic purine nucleosides
converting them to very toxic adenine analogs; these substrates include
6-methylpurine-2Õ-deoxyriboside (MeP-dR) and arabinofuranosyl-2-fluoroadenine
monopho-sphate (F-araAMP) commercially known as fludarabine. This enzyme
converts the 6-methylpurine deoxyribose (MeP-dR) prodrug into the diffusible,
toxic 6-methylpurine and can become a powerful suicide gene under these
conditions (Sorscher et al, 1994).
The significant advantages in eradicating
experi-mentally-induced human tumors in nude mice with this system were: (i) the bystander effect was 2-3 orders of
magnitude higher than with HSV-tk/GCV and tumor eradication could be seen only
after 3 doses of PNP/MeP-dR treatment, (ii)
the MeP-dR and F-araAMP crossed readily the cell membrane unlike GCV, and (iii) PNP/MeP-dR could kill both proliferating
and nonproliferating tumor cells as has been demonstrated by eradication of the
slowly-growing D54MG glioma tumors expressing the bacterial PNP gene in nude
mice after treatment with MeP-dR (Figure
26; Parker et al, 1997).
G. Deoxycytidine kinase/ara-C and
nitroreductase/5-(aziridin-1-yl)-2,4-dinitrobenzamide
The human deoxycytidine kinase (dCK) can
phosphorylate the prodrug cytosine arabinoside (ara-C), a cytidine analog, and
catalyze its conversion into a toxic drug inducing lethal strand breaks in DNA.
Although ara-C is a potent antitumor agent for hematologic malignancies it is
ineffective against solid tumors; transduction of the dCK cDNA with adenovirus and retrovirus into the 9L gliosarcoma
cell line followed by establishing intradermal and intracerebral gliomas in
syngeneic rats demonstrated the efficacy of systemic ara-C treatment of the
animals in eradicating these tumors (Manome et al, 1996).
The
prodrug 5-(aziridin-1-yl)-2,4-dinitrobenzamide (CB-1954) is a weak,
monofunctional alkylating agent which can be activated by Escherichia coli nitroreductase to a potent dysfunctional
alkylating agent which crosslinks DNA. Transduction of colorectal and
pancreatic cancer cell lines with the nitroreductase gene using a retroviral
vector rendered them 50 to 500-fold more sensitive than parental cells to
CB1954; concentrations of CB1954 which were minimally toxic to nontransduced
cells achieved 100% cell death in a 50:50 mix of parental cells with transduced
cells expressing nitroreductase due to "bystander" cell killing
(Green et al, 1997).
H. Preferential expression of suicidal genes in
cancer cells using promoters/ enhancers from tumor-specific genes
The principle of VDEPT (virus-directed enzyme
/prodrug therapy) was used to target hepatocellular carcinoma using the
regulatory region from the tumor-specific a-fetoprotein gene to
drive the Varicella zoster thymidine kinases gene (Huber et al, 1991).
A similar gene therapy approach has been developed
for the treatment of primary and metastatic hepatic tumors based on the
overexpression of the suicidal gene cytosine deaminase (CD) from E. coli under
control of the regulatory regions of the tumor marker gene carcinoembryonic
antigen (CEA) (Richards et al, 1995);
this created a chimeric gene that was specifically expressed in neoplastic
cells. Development of this strategy has necessitated the identification of the
regulatory regions of
Figure 26. A nude mouse xenograft model was
developed bearing malignant gliomas by s.c. injection of D54MG human cells or
D54MG human cells transduced and expressing E.
coli PNP which are called D54-PNP cells; tumors were successfully
eradicated with MeP-dR treatment. Representative animals from each of 4 groups
at completion of the study (62 days) are shown: Group 1: nude mice were injected with D54MG cells, vehicle treated.
Group 2: nude mice were injected
with D54MG cells, MeP-dR treated. Group
3: nude mice were injected with D54-PNP cells, vehicle treated. Group 4: nude mice were injected with
D54-PNP cells, MeP-dR treated. From Parker WB, King SA, Allan PW, Bennett LLJr,
Secrist JAIII, Montgomery JA, Gilbert KS, Waud WR, Wells AH, Gillespie GY, and
Sorscher EJ (1997) In vivo gene therapy of cancer with E. coli purine nucleoside phosphorylase.
Hum Gene Ther 8, 1637-1644. With the
kind permission from the corresponding author (Eric Sorscher, University of
Alabama at Birmingham) and Mary Ann Liebert, Inc.
the
CEA gene; isolation of 14.5 kb of 5'
flanking sequences for this gene followed by subcloning into luciferase pGL2
basic vectors and testing for luciferase activity in transfected LoVo, SW1463,
Hep3B, and HuH7 cell lines (the first two express CEA whereas the other two do not) has identified the CEA promoter between bases -90 and +69,
and two enhancers one at -13.6 to -10.7 and the other at -6.1 to -4.0 kb
(Richards et al, 1995); these sequences were able to sustain high levels of
expression of the CD gene into CEA-expressing cell lines.
Regulatory sequences from the CEA gene (-322 to +111 bp) were also used to express the HSV
thymidine kinase gene in pancreatic and lung neoplasms (Dimaio et al, 1994;
Osaki et al, 1994).
XXIV. Transfer of drug resistance genes
A. Principles and genes used
An attractive approach to circumvent
chemotherapy-induced myelosuppression is the use of gene-transfer technology to
introduce new genetic material into hematopoietic cells. Protection of bone
marrow progenitor cells by introduction of a drug resistance gene allows larger
and curative doses of chemotherapy to be administered to the patient as was
shown in several pre-clinical studies. Drug resistance genes under experimental
consideration are shown on Table 4.
Clinical trials are now under way to evaluate the potential use of two gene
sequences: MDR1 (protocols #43, 44, 59, 89, and 100) and O6-methylguanine
DNA methyltransferase (#101 see Appendix
1) (see also Lee et al, 1998, this volume).
Dose-limiting hematopoietic toxicity produced by the
cytosine nucleoside analogue cytosine arabinoside (Ara-C) is one of the major
factors that limit its use in the treatment of neoplastic diseases. Deamination
of Ara-C by cytidine deaminase results in a loss of its antineoplastic
activity. Transfer of human cytidine deaminase into murine fibroblast and
hematopoietic cells conferred drug resistance to Ara-C protecting them from
drug toxicity (Momparler et al, 1996). It is worth mentioning that
apolipoprotein B mRNA editing involves the deamination of cytidine by the
cytidine deaminase catalytic subunit that creates a new termination codon and
produces a truncated version of apo-B (apo-B48); the cytidine deaminase
catalytic subunit (apo-B mRNA-editing enzyme catalytic polypeptide 1) of the
multiprotein editing complex has been identified (Yamanaka et al, 1995).
B. Mechanism of MDR1 resistance
A great deal of our knowledge of basic insights on
drug uptake and molecular mechanisms of drug action were elucidated from the
study of resistance of tumor cells to chemotherapeutic agents. The
P-glycoprotein or p170 encoded by the multidrug resistance MDR1 gene uses the energy of ATP to extrude a variety of drugs
apparently unrelated; the only chemical similarity is that they contain
condensed aromatic rings and have a positive charge at neutral pH; these drugs,
most of which are effective against a variety of human tumors, include
molecules found in nature such as colchicine, doxorubicin (also called
adriamycin, member of the anthracycline family), actinomycin D, vinblastine,
etoposide, taxol, vinca alcaloids, and epipodophyllotoxins collectively called
MDR-type of drugs (reviewed by Gottesman and Pastan, 1988; see Lee et al, 1998
this volume).
Cell lines resistant to drugs accumulate far less
amounts of drug compared with parental cells because of overexpression of the MDR1 gene; development of multidrug
resistance by tumor cells poses a major impediment to successful cancer
chemotherapy. A number of cell lines with multidrug resistance have been
derived like KB and K562 cells (Marie et al, 1991; Fardel et al, 1995). The P-glycoprotein
is a 1280 amino acid molecule in human cells (Chen et al, 1986) or 1276 amino
acid molecule in mouse cells with 80% sequence similarity to the human protein
(Gros et al, 1986). P-glycoprotein has 12 hydrophobic domains grouped into
pairs representing transmembrane domains. The molecule has a 500 amino acid
duplication; each duplicated segment possesses an ATP-binding site on the
cytoplasmic side; it also has several site of glycosylation near the N-terminus
to the exterior side. Its gene is amplified in multidrug resistant
Table 4. Drug resistance gene designs
|
Drug resistance gene |
Confers resistance to |
Reference |
|
MDR1
(multidrug resistance) |
Daunomycin,
doxorubicin, taxol |
Galski et
al, 1989; Podda et al, 1992; Sorrentino et al, 1992 (see below) |
|
Mutant
dihydrofolate reductase |
Methotrexate
(MTX) |
Williams
et al, 1987; Corey et al, 1990; Li et al, 1994; Zhao et al, 1997 |
|
Glutathione
transferase |
DNA
alkylating agents |
reviewed
by Maze et al, 1997 |
|
O6-methyl
guanine transferase |
Nitrosoureas |
Allay et
al, 1995 |
|
Cytidine
deaminase |
Cytosine
arabinoside (Ara-C) |
Momparler
et al, 1996 |
|
Aldehyde
dehydrogenase |
Cyclophosphamide |
reviewed
by Koc et al, 1996 |
cell
lines accompanied by an increased expression of the 4,500 to 5,000-nt in size
mRNA for P-glycoprotein (Chen et al, 1986).
Rates of drug influx for lipid-soluble drugs are
proportional to drug concentrations in the medium; P-glycoprotein alone or in
conjunction with other cellular components seems to transport drugs to the
exterior of the cell, a mechanism pronounced in drug-resistant cell lines.
Consistent with the presence of a membrane-bound, exchangeable pool of drug and
a cytoplasmic, non exchangeable pool, P-glycoprotein was proposed to directly
interact via its hydrophobic transmembrane domains with the membrane-associated
drug molecules (anthracyclins, vinca alcaloids) to mediate their efflux to the
extracellular milieu (Gros et al, 1986). Doxorubicin, an inhibitor of
topoisomerase II which is a major nuclear matrix component, has been shown to
interact with hydrophobic regions in calmodulin; calmodulin is also a nuclear
matrix protein. Photoaffinity-labeled analogs of vinblastine showed direct
binding of this drug to P-glycoprotein (Safa et al, 1986).
Expression of P-glycoprotein is consistently low in
bone marrow cells rendering them particularly sensitive to certain MDR-type of
anticancer drugs; chemotherapy with these drugs largely depletes or wipes off
bone marrow pluripotent stem cells from patients (myelosuppression). One
approach to this problem has been removal and deep-freezing of bone marrow
samples from cancer patients prior to chemotherapy; in a second phase CD34+
cells are isolated from the frozen bone marrow specimen using negative
selection on soybean agglutinin plates followed by a positive selection on
plates coated with anti-CD34+ antibody (Ward et al, 1994) which are
then reimplanted to the patient or are simply injected intravenously and find
their way to the bone marrow where they implant; this is a costly undertaking.
Gene therapy approaches are being aimed at
transferring the MDR1 gene under the
control of a strong promoter/enhancer into bone marrow stem cells; transfected
stem cells, from which all B and T cells are derived, would be rendered
resistant to chemotherapeutic drugs used to treat cancer patients and allow
administration of higher doses of these drugs. Furthermore, even if a small
percentage of cells are successfully transfected, these cells could be expanded
by selection with MDR-drug. The same approach could be used to express a nonselectable
gene such as the b-globin gene to treat sickle cell anemias and
thalassemias inserted in the same construct with the MDR1 gene as has been suggested by Ward and coworkers (1994).
C. Transfer of the MDR1 gene into bone marrow cells
The purpose of this approach is to overexpress the MDR1 gene in bone marrow cells in ex vivo or in vivo protocols in order to render stem cells resistant to cancer
chemotherapy; this will prevent destruction of the bone marrow stem cells
during treatment of cancer patients with antineoplastic drugs for killing tumor
cells. Transfer of the MDR1 cDNA into primary human hematopoietic progenitor
cells of cancer patients undergoing high-dose chemotherapy will protect the
bone marrow from the dose-limiting cytotoxicity of cytostatic agents.
Transgenic mice expressing the human MDR cDNA in their bone marrow cells were
resistant to doxorubicin (Galski et al, 1989; Mickisch et al, 1991). Retroviral
transfer of MDR1 resulted in high
level expression of both RNA and P-glycoprotein; taxol-treatment of mouse bone
marrow cells killed those that had not been transfected and resulted in an
enrichment of the cells containing the human gene (Sorrentino et al, 1992;
Podda et al, 1992). Transfer of the MDR1 gene via a retrovirus into human CD34+
cells, isolated from bone marrow and stimulated with IL-3, IL-6, and stem cell
factor, showed that 20-70% of the CFU-GM or BFU-E cells contained the
transferred MDR1 gene by PCR analysis
(Ward et al, 1994).
AAV and cationic liposomes have been used for the
transfer of the human MDR1 cDNA to NIH-3T3 cells followed by selection of
successfully transfected cells based on the drug-resistant phenotype conferred
by the P-glycoprotein efflux pump; a single intravenous injection of the
bicistronic vector complexed to cationic liposomes into recipient mice,
achieved delivery of MDR1 and human
glucocerebrosidase cDNAs in all the organs tested (Baudard et al, 1996).
Eckert et al (1996) have designed novel retroviral
vectors termed SF-MDR and MP-MDR which significantly elevated survival of
transduced primary human hematopoietic progenitor cells under moderate doses of
colchicine and paclitaxel in vitro when compared with a conventional
MoMuLV-based vector; the novel vectors were based on the spleen focus-forming
virus or the myeloproliferative sarcoma virus for the enhancer DNA sequence and
the murine embryonic stem cell virus for the leader.
A bicistronic retroviral vector (HaMID) containing a
modified human MDR-1 cDNA and a mutant human dihydrofolate reductase cDNA bearing
a leucine to tyrosine substitution at codon 22 was constructed and used to
transduce the human CEM T lymphoblastic cell line as well as primary murine
myeloid progenitors; HaMID-transduced cells were highly resistant in the
presence of 25 nM taxol and 100 nM trimetrexate simultaneously while control
cells were entirely growth inhibited (Figures
27, 28; Galipeau et al, 1997).
Several
human clinical trials, approved by RAC and FDA, are under way with the
long-term goal of transferring the MDR1
gene into bone marrow cells of advanced cancer patients using retroviral
infection. A human gene therapy protocol (#100) for chemoprotection of patients
treated for testicular cancer with high doses of carboplatin and etoposide
proposes to use transplantation of these patients with autologous peripheral
blood stem cells (drawn, purified and cryopreserved prior to chemotherapy
treatment) and transduced with the MDR1
Figure 27. Structure of the retroviral
vectors used to deliver the MDR1 and DHFR genes. The vectors are based on the
Harvey murine sarcoma virus. A single transcript (arrow) is initiated in the
retroviral 5Õ LTR promoter. HaMDR1sc (top) contains the MDR1sc cDNA and
HaDHFR(L22Y) (middle) contains a mutant DHFR cDNA. The bicistronic (two-gene)
vector HaMID (bottom) contains both MDR1 and DHFR genes. From Galipeau J,
Benaim E, Spencer HT, Blakley RL, Sorrentino BP (1997) A bicistronic retroviral vector for protecting hematopoietic
cells against antifolates and P-glycoprotein effluxed drugs. Hum Gene Ther 8, 1773-1783. Reproduced
with kind permission from the authors and Mary Ann Liebert, Inc.
Figure 28. Growth inhibition assays
comparing the effect of 25 nM taxol, 100 nM trimetrexate (TMTX) alone and in
combination on CEM cells transduced with HaDHFR(L22Y), HaMDR1sc, or HaMID.
Drug-selected CEM cells were washed and seeded at 1x105 cells/ml in
2 ml of media containing the indicated concentrations of drugs. After 72 hr,
the percentage of growth was calculated by dividing the number of cells at each
drug concentration by the number of cells present in control medium (100%
growth). Quadruplicate experiments are shown. aCells preselected in
100 nM trimetrexate. bCells preselected in 25 nM taxol. From
Galipeau J, Benaim E, Spencer HT, Blakley RL, Sorrentino BP (1997) A bicistronic retroviral vector
for protecting hematopoietic cells against antifolates and P-glycoprotein
effluxed drugs. Hum Gene Ther 8,
1773-1783. Reproduced with kind permission from the authors and Mary Ann
Liebert, Inc.
cDNA.
Similar protocols (#43, 44, 59, 89) use CD34+ autologous bone marrow
cells retrovirally-transduced with MDR1 cDNA for hemoprotection of patients
treated for ovarian, brain, or breast cancers (Appendix 1).
XXV. Antisense gene therapy of cancer.
Among
a variety of approaches to gene therapy of cancer, antisense oncogene gene
therapy is a strategy aiming at correcting genetic disorders of cancer through
correction of the abnormal expression of oncogenes implicated in signal
transduction and control of proliferation. A number of protocols have been
approved using antisense gene or oligonucleotide delivery. Protocol 29 uses a
combination of p53 cDNA and K-ras antisense for non-small cell lung cancer.
Protocol 41 uses antisense Rev for AIDS, protocol 91 antisense RRE decoy gene
and protocol 168 uses antisense TAR and transdominant Rev protein genes for HIV
infections. Protocol 64 uses antisense c-fos or antisense c-myc for breast
cancer. Protocol 82 uses intraprostate injection of antisense c-myc for
advanced prostate cancer. Protocol 162 uses TGF-§2 antisense gene-modified
autologous tumor cells for malignant glioma. And, protocol 189 uses antisense
Insulin-like Growth Factor I for glioblastoma (see below).
A. Antisense c-fos and c-myc
Because c-fos proto-oncogene has been implicated as a
regulator of estrogen-mediated cell proliferation, antisense c-fos has been
used to cause an inhibition of s.c. tumor growth and invasiveness of cells the
growth of which depends on estrogen. Ex vivo transduction of MCF-7 human breast
cancer cells with antisense c-fos, regulated by mouse mammary tumor virus
control elements and delivered by a retroviral vector, produced expression of
anti-fos RNA, decreased expression of the c-fos target mRNA, induced
differentiation, and inhibited s.c. tumor growth and invasiveness in breast
cancer xenografts in nude mice; a single injection of anti-fos inhibited i.p.
MCF-7 tumor growth in athymic mice with a corresponding inhibition of c-fos and
TGF-b1 (Arteaga and Holt, 1996). A phase I clinical study
for the treatment of metastatic breast cancer uses in vivo infection with
breast-targeted retroviral vectors expressing antisense c-fos or antisense
c-myc RNA (Holt et al, 1996; protocol #64, Appendix
1, page 163).
B. Antisense insulin-like growth factors I and II and
their receptors
Insulin-like growth factors I and II (IGF-I and -II)
are expressed preferentially in bone tissue and contribute to bone metastases
of cancer cells expressing IGF receptors. Prostate cancer cells express IGF-I
receptor; this favors metastasis to bone, the most frequent tissue for prostate
metastasis. An antisense IGF-IR construct, under control of the ZnSO4-inducible
metallothionein-1 promoter, was engineered by reverse transcription-PCR on
total RNA with primers specific for the 0.7 kb cDNA of IGF-IR and subcloned
into episomal vectors in the antisense orientation. Transfection of the
construct into prostate cancer PA-III cells in culture was able to reduce
dramatically the expression of IGF-IR after induction of the cells with ZnSO4 (Burfeind et al, 1996). This inhibition
resulted in reduction in expression of both uPA and tPA; whereas PA-III cells
were able to induce large tumors in nude mice, PA-III cells transfected with
the antisense vector either developed tumors 90% smaller or remained tumor
-free for long times postinjection (Burfeind et al, 1996).
Lafarge-Frayssinet et al (1997) have developed a
strategy for inducing a protective immunity by tumor cells transfected by the
IGF-I antisense vector: the hepatocarcinoma cell line LFCI2-A, expressing both
IGF I and II, produces voluminous tumors when injected subcutaneously into
syngeneic rats; when LFCI2-A cells were transfected with an episomal vector
expressing IGF-I antisense RNA, the cells became poorly tumorigenic exhibited a
4-fold increase of the MHC class I antigen, and, when injected subcutaneously,
inhibited the growth of the parental tumoral cells or induced regression of
established tumors; this loss of tumorigenicity and protective immunity was not
observed after transfection with the IGF-II antisense vector
(Lafarge-Frayssinet et al, 1997). Cationic lipid-mediated transfer of antisense
cDNA for IGF I is in clinical trial for glioblastomas (protocol #189 in Table 4 in Martin and Boulikas, 1998,
this volume, page 203).
C. Antisense ras gene transfer for pancreatic tumors
K-ras point mutations occurs at a characteristically
high incidence in human pancreatic cancers. Stable expression of a plasmid
expressing antisense K-ras RNA into pancreatic cancer cells with K-ras point
mutations (AsPC-1 and MIAPaCa-2) resulted in a significant suppression of cell
growth; the effect of antisense treatment was not found in cells with a
wild-type K-ras gene (BxPC-3). When the AsPC-1 cells with the K-ras point
mutation were inoculated into the intraperitoneal cavity of nude mice, followed
3 days later by i.p. treatment with the antisense K-ras in a liposome complex,
only 2 of 12 mice showed any evidence of tumors on day 28 compared with 9 out
of 10 control mice that developed peritoneal dissemination and/or solid tumors
on the pancreas (Aoki et al, 1995).
D. Antisense oligonucleotides to metallothionein
Abdel-Mageed and Agrawal (1997) have inhibited the
expression of metallothionein (MT) gene using an 18-mer MT antisense
phosphorothioate oligomer (complementary to a region 7 bases downstream from
the AUG translational start site of the human MT-IIA gene) to elicit
antiproliferative effects in breast carcinoma MCF7 cells; indeed, there is an
increased MT gene expression in breast cancer which is associated with
metastasis and poor prognosis of the disease; overexpression of MT potentiated
the growth of MCF7 cells, whereas downregulation of MT elicited
antiproliferative effects. Transfection of MCF7 cells with the antisense
oligomer inhibited cell growth by 50-60% and induced morphological changes
suggestive of apoptotic cell death at 72 hours posttransfection compared to
cells transfected with a random 18-mer; the antisense oligomer induced
chromatin cleavage into oligonu-cleosomal fragments, a 2-fold increase in the
levels of c-fos and p53 transcripts, a 2.5-fold decrease in c-myc transcripts,
and a decrease in Bcl-2 protein levels compared to random oligomer-transfected
cells.
On the contrary, the expression of MT was 2.5-fold
elevated after transfection of the cells with an expression plasmid
encompassing the human MT-IIA cDNA, constitutively driven by b-actin promoter and this was associated with a 2-fold
increase in cell multiplication (Abdel-Mageed and Agrawal, 1997)
E. Other antisense approaches
Transfer of an antisense cyclin G1 construct was used
to inhibit osteosarcoma tumor growth in nude mice. Overexpression of the cyclin
G1 gene is frequently observed in human osteosarcoma cells, and its continued
expression is essential for their survival. This modality resulted in a
decrease in the number of cells in S and G2/M phases of the cell cycle
concomitant with an accumulation of cells in the G1 phase (Chen et al, 1997). Figure 29 shows that nude mice treated
with the antisense cyclin G vector (panel A) have smaller tumors that animal
treated with a control vector (panel B). The results of the measurements of the
size of the tumor in treated and control animals are shown in C.
Figure 29. Photographs of nude mice treated with antisense cyclin G
vector (panel A) have smaller tumors
that animal treated with a control vector (panel
B). Panel C: the relative tumor
size (% of day 0 tumor size divided by 100) is plotted, on the vertical axis,
as a function of time (days), plotted on the horizontal axis. From Chen DS, Zhu
NL, Hung G, Skotzko MJ, Hinton DR, Tolo V, Hall FL, Anderson WF, Gordon EM (1997) Retroviral vector-mediated
transfer of an antisense cyclin G1 construct inhibits osteosarcoma tumor growth
in nude mice. Hum Gene Ther 8,
1667-1674. Reproduced with kind permission from the authors and Mary Ann
Liebert, Inc.
The replication and expression of hepatitis B virus
(HBV) could be inhibited through antisense gene transfer and this could become
a new method for clinical gene therapy against HBV; infection of the human
hepatoblastoma cell line 2.2.15, which expresses HBV surface antigen and
releases HBV particles, with retroviral vectors carrying an antisense preS/S or
preC/C genes of HBV inhibited expression of the surface antigen (Ji and St
1997).
Phosphorothioate antisense oligos directed against
c-myc and p53 in different cell lines (CAOV-3, SKOV-3, and BG-1) were shown to
have both antiproliferative and stimulatory activity, as single agents and in
combination; it was concluded that further in vitro studies are needed before
considering clinical trials with these agents in gynecologic cancers (Janicek
et al, 1995).
Transfection of antisense cDNA constructs
encom-passing different regions of the c-erbB-2 gene in the lung carcinoma cell
line Calu3, which overexpresses the c-erbB-2 oncogene, reduced significantly
anchorage-independent growth and tumor size in nude mice (Casalini et al,
1997).
Antisense oligonucleotides
against PCNA and cdc2 kinase transferred into injured arterial walls by
protein-liposomes greatly reduced mRNA levels for those genes and inhibited
neointima formation of the injured artery for 8 weeks; double-stranded
oligonucleotides containing the consensus sequence for E2F binding sites also
inhibited the growth of smooth muscle cells and prevented neointima formation
(Kaneda et al, 1997). Antisense oligonucleotides to angiotensinogen1-receptor
mRNA and to angiotensinogen mRNA reduced blood pressure (Tomita et al, 1995;
Phillips, 1997; Phillips et al, 1997).
XXVI. Triplex gene therapy
A. Molecular mechanisms for triplex formation
Natural purine.pyrimidine
sequences in regulatory regions of genes in eukaryotic cells with a mirror
symmetry can form triple-helical structures; in addition, purine-rich segments
in DNA unable to form triple helices on their own can be targeted by DNA or RNA
oligonucleotides able to form triplex structures with their target DNA and
these unusual structures can inhibit transcription factor binding,
transcription initiation, and nuclear enzymatic activities. Understanding the
advantages, limitations and pitfalls for using oligonucleotides as gene
bullets, development of strategies for boosting their therapeutic efficiency,
their covalent linkage to DNA damaging molecules to hit a specific genomic DNA
sequence, and improvements to the methods for their delivery to cells could
make reality their use as tools of micro-targeting specific genomic sites and
as pharmacogenomic drugs.
Formation of triple helical DNA was found to take
place on AT- and GC-rich stretches. A pyrimidine third strand oligonucleotide,
studied by NMR and other approaches, interacts with purine residues in the
major groove of the target duplex in a parallel orientation (Moser and Dervan,
1987; Rajagapol and Feigon, 1989; de los Santos et al, 1989) whereas a purine
oligonucleotide binds in an antiparallel orientation relative to the purine
strand in the duplex (Cooney et al, 1988; Kohwi and Kowhi-Shigematsu, 1988;
Beal and Dervan, 1991). In this case G can recognize GC pairs and A or T can
recognize AT pairs. Specificity is provided from T.AT and C+GC base
triplets where the bases of the third polypyrimidine strand establish Hoogsteen
base pairing with the purine strand of the duplex (Hoogsteen, 1959; Rajagopal
and Feigor, 1989).
The H form is the structural basis for S1-nuclease
hypersensitivity (Mirkin et al, 1987). A restriction fragment from a human U1
gene containing the sequence d(C-T)18.d(A-G)18 under
supercoiling and pH less than or equal to 6.0 showed S1 hyperreactivity in the
center and at one end of the (C-T)n tract, and continuously from the
center to the same end of the (A-G)n tract providing strong support for a
triple-helical model (Johnston, 1988).
Homopyrimidine oligodeoxyribonucleotides with EDTA-Fe
attached at a single position bound the corresponding homopyrimidine-homopurine
tracts within large double-stranded DNA by triple helix formation and cleaved
at that site (Moser and Dervan, 1987). Studies from the group of Claude HŽlne
have similarly focused on the development of artificial scissor
oligonucleotides based on triplex technology (Praseuth et al, 1988; Perrouault
et al, 1990). However, the feasibility of employing this exciting in vitro
technology to animal studies has not yet been demonstrated.
Intramolecular or intermolecular triple helices could
be recognized by specific proteins that stabilize triplex structures and might
play a role in gene regulation; a protein from HeLa cell nuclear extracts was
identified that binds to a 55 nucleotide-long DNA oligomer that could fold on
itself to form an intramolecular triple helix of the Py Pu x Py motif (Guieysse
et al, 1997).
Triplex-forming oligophosphoramidates containing
thymines and cytosines or 5-methyl cytosines (5' T4CT4C6T
3') bind strongly to a 16 base pair oligopurine.oligopyrimidine
sequence of HIV proviral DNA even at neutral pH and are remarkably stable
compared to oligonucleotides with natural phosphodiester linkages. The
phosphoramidate oligomers induced an efficient arrest of both bacteriophage and
eukaryotic transcriptional machineries (SP6, T7 or Pol II) under conditions
where the phosphodiester oligos had no inhibitory effect and blocked the RNA
polymerases at the triplex site (Giovannangeli et al, 1996).
Oligonucleotide-directed triplex formation has been
shown to inhibit binding of transcription factors to their cognate DNA
sequences. A 21 bp homopurine element insert flanking a single Sp1 site in the
adenovirus E4 promoter was used to study the effect of oligo targeting on transcriptional
efficiency in vitro; assembly of the triple helical complex repressed basal
transcription by rendering the triplex target inflexible and by blocking
assembly of the promoter into initiation complexes; Sp1 was unable to cause
derepression (Maher et al, 1992). Thus DNA triplexes can inhibit transcription
initiation not only when directed to a TF binding site occluding its binding
but also to a flanking region by other possible repression mechanisms including
stiffening of the double helix (Maher et al, 1992).
B. Triplex targeting of IGF-I
Oligonucleotide-directed triple helix formation
targeted toward IGF-I to inhibit its expression was studied following stable
transfection of C6 rat glioblastoma cells with a plasmid from which an RNA was
transcribed that coded for the third strand of a potential triple helix. A
plasmid encoding the oligopurine variant of the triple helix but not the
oligopyrimidine or a control sequence caused a dramatic reduction of IGF-I RNA
and protein levels in cultured cells, morphological changes, and increased
expression of protease nexin I and MHC class I molecules; the transfected cells
displayed a reduced capacity for tumor growth when injected in nude mice
(Shevelev et al, 1997).
XXVII. Gene transfer to some characteristic tissues
or cell types
A. Transduction of hematopoietic stem cells (HSCs)
Hematopoietic stem cells (HSCs), which can be
isolated with high speed flow-cytometric cell sorting from fetal or adult bone
marrow and cytokine-mobilized peripheral blood, have extensive self renewal and
multilineage repopulating potential; HSCs are being used as an hematopoietic
graft to treat cancer patients undergoing high dose chemotherapy which
eradicates HSCs; GM-CSF treatment of the patient can enhance mobilization of
true HSCs; furthermore, HSCs can be stably transduced at high efficiency
(32-75%) by co-culture with a cell line producing recombinant retroviruses
containing the neomycin-resistant gene and are targets for hematopoietic
cell-based gene therapy especially for the treatment of patients with multiple
myeloma (Chen et al, 1995).
The efficiency of gene transfer into monkey
pluripotent hematopoietic stem cells (PHSCs) is at least one order of magnitude
lower than what has been achieved in mice because primate PHSCs seem to require
quite different culture conditions for their maintenance and transduction than
mouse PHSCs. Successful retroviral vector-mediated gene transfer into monkey
PHSCs supported maintenance of the long-term repopulating ability of autologous
monkey grafts and has closed the gap between gene transfer experiments in mouse
models and primates opening the door to the clinical application of bone marrow
gene therapy to humans (Van Beusechem and Valerio, 1996).
Retroviral vectors pseudotyped with vesicular
stomatitis G glycoprotein (VSV-G) and expressing a murine cell surface protein,
B7-1, were used to infect the human T-cell line Jurkat and human peripheral
blood lymphocytes (PBLs); the transduction efficiency of PBLs with the
pseudotyped vector reached a maximum of 16-32% at an moi of 40 (Sharma et al,
1996). Introduction of a mutant H-ras gene (along with a neomycin resistance
gene) into normal human bone marrow progenitor cells with a retrovirus followed
by selection in cell culture with G418 suggested that expression of mutant
H12-ras resulted in enhanced proliferation of early myeloid cells at the
expense of differentiation (Maher et al, 1994).
Dendritic cells (DCs) which are the most potent
antigen-presenting cells (APCs) for the initiation of antigen-specific T-cell
activation can be highly enriched from peripheral blood-adherent leukocytes by
short-term culture in the presence of IL-4 and GM-CSF; adenoviral vectors
expressing luciferase, b-galactosidase, IL-2, and IL-7 readily transduced
human DCs compared to other methods (Arthur et al, 1997).
Transduction of hematopoietic stem cells with human
IL-1Ra cDNA was used to alleviate symptoms of RA; the HSCs were subsequently
injected into lethally irradiated mice; all of the mice survived and over 98% of
the white blood cells in these mice produced biologically active human IL-1Ra
type from 2-13 months after transplantation; the animals had the human IL-1Ra
protein in their sera for at least 15 months (Boggs et al, 1995).
B. Gene transfer to the brain
Several molecular approaches, including gene transfer
with retroviral, adenoviral and herpes simplex virus vectors, as well as
antisense vectors, and antisense oligonucleotides have been shown to have in
vitro and in vivo activities against brain tumor cells. These approaches are
especially important for the treatment of glioblastomas which remain incurable
despite an aggressive combination regimens using surgery, radiation, and
chemotherapy (reviewed by Yung, 1994).
Intrathecal transplantation of polymer-encapsulated
cell lines genetically engineered to release the human ciliary neurotrophic
factor (CNTF) provided a means to deliver CNTF continuously behind the
blood-brain barrier and bypass the immunologic rejection of allogeneic cells;
for example, transduction of mouse C2C12 myoblasts with human CNTF followed by
membrane encapsulation and intrathecal implantation in adult rats could
partially rescue motor neurons from axotomy-induced cell death (Deglon et al,
1997).
Since adult brain cells are nonproliferative, they
are refractory to retroviral infection that could deliver the tyrosine
hydroxylase gene to the brain to alleviate degeneration at the nigrostriatal
pathway in Parkinson disease (PD). Implantation of immortalized fibroblasts,
primary fibroblasts, or myoblasts, stably transfected in culture with the TH
gene (Jiao et al, 1993) or direct injection of lipofectin-plasmid DNA complexes
containing the TH gene under the influence of the SV40 promoter/enhancer (Cao
et al, 1995) reduced behavioral abnormalities in PD animal models. A 7 kb
region encompassing the TH promoter was able to confer expression of b-galactosidase in catecholaminergic cell types in the
substantia nigra pars compacta compared to other regions of the brain after
HSV-1-mediated transfer to adult rat brains (Song et al, 1997).
C. Gene transfer to hepatocytes
Hepatocytes are responsible for the production of
many therapeutically important proteins such as LDL-R which clears LDL from the
serum and the blood clotting Factors VIII and IX which are defective in
hemophiliacs. Portal vein, rather than systemic intravenous injection, has been
used to transduce preferentially hepatocytes (or liver macrophages, known as
Kuppfer cells). For example, the Factor IX gene was delivered to a portal vein cannulated
into a splenic vein in animals previously subject to two-third hepatectomy and
resulted in the expression of low levels of factor IX for up to about 5 months;
0.3-1% of hepatocytes were found to be transduced (Kay et al, 1993).
An adenovirus LDL-R cDNA, infused into the portal
vein of rabbits deficient in LDL receptor, resulted in the expression of human
LDL-R protein in the majority of hepatocytes that exceeded the levels found in
human liver by at least 10-fold (Kozarsky et al, 1994). According to an ex vivo
protocol, cultured hepatocytes from a FH patient were transduced ex vivo with
the LDL receptor gene and transplanted by infusion into the portal vein of the
patient (Wilson et al, 1992; Grossman et al, 1994).
Delivery of a 5.6 kb genomic clone or of a 834-bp
cDNA clone encoding the kallikrein gene into the portal vein or tail vein of
spontaneously hypertensive rats resulted in significant reduction of their
blood pressure for about 5-6 weeks (Chao et al, 1996). Portal vein injection of
the human kallistatin cDNA in an adenoviral vector into spontaneously
hypertensive rats resulted in a significant reduction of blood pressure for 4
weeks; this method resulted in the transduction not only of liver but also of
spleen, kidney, aorta, and lung (Chen et al, 1997).
Hepatocyte Growth Factor (HGF) is the most potent
mitogen of mature hepatocytes; transfer of the human HGF gene into a
recombinant retroviral cell line produced HGF in the supernatant which was
correctly processed and biologically active; primary mouse and human
hepatocytes could be transduced with the supernatant of transfected cells and,
thus, this cell line should be useful for in vivo liver gene therapy (Pages et
al, 1996a).
D. Gene transfer to the embryo
Introduction of normal genes in utero or in the early postnatal period could become a successful
approach to correct genetic defects; several studies have shown that adenoviral
or retroviral vector-mediated gene transfer during the ebryonic or neonatal
period results in prolonged gene expression. Gene transfer (or gene disruption)
has been extensively studied in preimplantation embryos giving rise to
transgenic animals difficient in a specific protein (e.g. Smith et al, 1995;
Fong et al, 1995; Shalaby et al, 1995).
Gene transfer to the embryo has shown the importance
of the promoter, large genomic regulatory regions, cell-cell interactions and
gene switch taking place during embryogenesis in maintaining transgene
expression in different tissues; results obtained in embryos reflect the in
vivo patterns of tissue-specific expression which could be useful to direct
efforts in promoter choices for somatic gene transfer to the adult (as is the
case for most gene therapy applications). Furthermore these studies provide the
foundation of a new era where genetic manipulation of the embryo could
permanently correct monogenic genetic disorders such as hemophilias,
thalassemias and others.
The promoter of the tie gene, which encodes a receptor tyrosine kinase that is
expressed in the endothelium of blood vessels, was used to drive the expression
of a luciferase reporter gene construct; in cultured cells the luciferase
activity was not restricted to endothelial cells. In contrast, in transgenic
mice expression of the reporter b-galactosidase was
restricted to endothelial cells undergoing vasculogenesis and angiogenesis; in
adult transgenic mice, tie promoter
activity in lung and many vessels of the kidney was as high as in the vessels
of the corresponding embryonic tissues, whereas in the heart, brain and liver, tie promoter activity was downregulated
and restricted to coronaries, cusps, capillaries, and arteries (Korhonen et al,
1995).
A retroviral VEGF expression vector was used to
infect quail ebryo and to increase the level of VEGF during critical periods of
avian limb bud growth and morphogenesis. Overexpression of VEGF in the limb bud
exclusively resulted in hypervascularization as reflected by an increase in
vascular density from an augmentation of the VEGF signaling mechanism in a
permissive environment; vascular permeability was also dramatically increased
leading to local edema (Flamme et al, 1995).
An avian leukosis virus (ALV)-based retroviral vector
system was used for the efficient delivery of genes into preimplantation mouse
embryos; a subset of the integrated proviruses expressed the delivered
chloramphenicol acetyltransferase (CAT) reporter gene either from the
constitutive viral promoter contained in the long terminal repeat or from the
internal nonviral tissue-specific promoter in different sets of experiments.
Thus, many of the sites that are
accessible to viral DNA insertion in preimplantation embryos were thought to be
incompatible with expression in older animals (Federspiel et al, 1996).
Baldwin and coworkers (1997) have found that the
expression of lacZ gene under control of CMV or RSV promoter transferred to
early, postgastrulation mouse embryos gave tissue-specific patterns of
expression which depended on the type of promoter used. Embryos were injected
into the mesoderm of the neural fold (A
in Figure 30) and b-galactosidase activity was detected in the head
Figure 30.(A) E7.25
(1-2 somite) mouse embryos were injected via a micropipette inserted directly
into the mesoderm of the neural fold (nf).
Thus, all head fold mesoderm and neural epithelium were directly exposed to the
recombinant adenovirus carrying the LacZ reporter gene (aip, anterior intestinal portal; ys, yolk sac; epc,
ectoplacental cone).
(B) Following 36 h in culture, b-galactosidase
activity was detected in the head process and pharyngeal arches of the embryo;
a smaller amount of b-galactosidase
activity was detected within the outflow tract (ct) of the developing heart (1
and 2, first and second pharyngeal
arches, v, ventricle).
(C) Low and (D) high
magnification dual immunofluorescent photomicrographs of a sagittal section
through the head and heart of an embryo stained with a polyclonal antibody to b-galactosidase
(red) detected by a
rhodamine-conjugated second antibody as well as a monoclonal antibody to
PECAM-1 (CD-31) (green) which is
specific for endothelial cells and is detected by a fluorescein-conjugated
secondary antibody. Despite exposure of all cell types within the head fold of
the embryo b-galactosidase activity is
restricted to a subpopulation of endothelial cells within the aortic sac (as) and first pharyngeal arch artery (pha); (m, myocardium; e,
endocardium). From Baldwin HS, Mickanin C, and Buck C (1997) Adenovirus-mediated gene transfer during initial organogenesis
in the mammalian embryo is promoter-dependent and tissue-specific. Gene Ther 4, 1142-1149. Reproduced with
the kind permission of the authors (H Scott Baldwin, ChildrenÕs Hospital of
Philadelphia) and Stockton Press.
process
(B in Figure 30); sagittal sections through the head and heart of the
embryos (c, d) were stained for b-galactosidase (red)
and for endothelial cells (green);
the micrographs show that while not all endothelial cells demonstrated b-galactosidase activity (green only), b-galactosidase was restricted to endothelial cell
populations (yellow).
DIVISION THREE: GENE THERAPY OF HUMAN DISEASE OTHER
THAN CANCER
XXVIII. Ex vivo gene therapy
A. Ex vivo (and in vivo) gene therapy on animal
models
A number of experimental approaches for the gene
therapy of human disease are first being tested on animal models (preclinical
trials) before receiving approval for phase I clinical trials on humans. A
number of animal models have been developed such as hemophiliac dogs, rats with
high blood pressure, rabbits with coronary heart disease, nude or SCID mice
bearing a variety of human cancers, mice with symptoms resembling those of
ParkinsonÕs disease patients etc. Then, gene transfer has been used to treat
these animals and alleviate the symptoms. The success of these studies is a
prelude for their approval as a gene therapy technology on human patients.
Ex vivo techniques although cumbersome are safer,
because all genetic manipulations occur outside the body and cells may be
extensively screened prior to implantation. According to ex vivo protocols cells from the mammalian body are removed,
cultured, transduced with therapeutically important genes, and reimplanted into
the body of the same individual. A representative number of such studies on
animal models are summarized on Table 5.
Some examples will be mentioned here. More
information can be found in the specialized sections of this review. Ex vivo
gene therapy for PD was performed on animal models with TH deficiency using
implantation of immortalized rat fibroblasts releasing L-dopa (Wolff et al,
1989), or using primary fibroblasts (Fisher et al, 1991) and myoblasts (Jiao et
al, 1993) stably transfected in culture with the TH gene. Retroviral vectors have successfully treated
mucopolysaccharidosis VII by implantation of ex vivo modified mouse skin
fibroblasts to mice (Moullier et al, 1993). Surgical implantation of factor
VIII gene-transduced primary mouse fibroblasts into the peritoneal cavity in
SCID mice resulted in correction of hemophilia A (Dwarki et al, 1995). Ex vivo
transduction of primary myoblasts in mice with the factor IX gene followed by
transplantation of the transduced cells led to partial correction of hemophilia
B (Dai et al, 1992; Yao et al, 1994).
Intraarticular injection of syngeneic synovial cells
transduced with the IL-1R antagonist protein gene alleviated the symptoms of
arthritis (Bandara et al, 1993). Similarly, ex vivo retroviral transfer of the
secreted human IL-1Ra cDNA to primary synoviocytes followed by engraftment in
ankle joints of rats with induced arthritis significantly suppressed the
severity of the disease (Makarov et al, 1996; see also Ghivizzani et al, 1997).
To demonstrate feasibility of the ex vivo FH therapy, three baboons underwent a
partial hepatectomy, their hepatocytes were isolated, cultured, transduced with
a retrovirus containing the human LDL-R gene, and infused via a catheter
(Grossman et al, 1992).
An important number of studies on cancer
immunotherapy have been performed on animal models (For example, see Vieweg et
al, 1994; Wiltrout et al, 1995; Caruso et al, 1996; Bramson et al, 1996; Tahara
et al, 1996; Zhang et al, 1996; Rakhmilevich et al, 1997; Aruga et al, 1997;
Clary et al, 1997; Ju et al, 1997)
Studies with tumor cells reconstituted with RB ex
vivo and implanted into immunodeficient mice have demonstrated cancer
suppression (see Riley et al, 1996). Transfer of the Cu2+/Zn2+ superoxide dismutase into ex vivo
modified cells protected the cells from oxidative damage during manipulation
and increased their survival after implantation (Nakao et al, 1995). Ex vivo
transfer of the MDR1 gene in bone
marrow cells has been used to render stem cells resistant to cancer
chemotherapy (Lee et al, 1998, this volume). Ex vivo transduction of MCF-7
human breast cancer cells with antisense c-fos produced expression of antifos
RNA, and inhibited s.c. tumor growth and invasiveness in breast cancer
xenografts in nude mice (Arteaga and Holt, 1996).
Direct in vivo injection of a gene (intratumoral,
intravenous, etc) must be distinguished from ex vivo gene therapy methods. Some
representative direct in vivo studies to animals using genes are summarized on Table 6.
B. Ex vivo gene therapy on humans
The first person to be treated ex vivo was a
4-year-old suffering with ADA deficiency in 1990 (see ADA deficiency below).
The US Patent Office has issued in 1995 a patent covering all ex vivo gene therapy to French Anderson,
Steven Rosenberg, and Michael Blaese; the technique was developed at NIH in the
1980s and an exclusive license to this work has been awarded to Gene Therapy
Inc, (Rockville, Maryland). Of the 220 protocols for Clinical Trials approved
by NIH's Recombinant DNA Advisory Committee (RAC), a significant number (over
100) use ex vivo gene therapy
applications (see Gavaghan, 1995). Ex vivo protocols are marked In Vitro
in Appendicx 1 and Table 4 in following article (pages
203-206). Also protocols proposing immunotherapy use ex vivo transduction of
cells from cancer patients with cytokine genes and immunization of the patient
with the transduced cells (Appendix 1).
Transduction of cells in vitro with adenoviruses makes the patients own cells antigenic
leading to their destruction by T lymphocytes thus eliminating the therapeutic
effect after reimplantation (e.g. Yang et al, 1994). It was thought that this
antigenicity arises from the adenoviral proteins expressed in transduced cells;
however, recent data have demonstrated that antigenicity could also arise from
the expression of the therapeutic recombinant protein (see above).
Ex vivo approaches have concentrated on correction of
mutated genes involved in purine metabolism including adenosine deaminase (ADA)
deficiency in severe combined immunodeficiency (SCID) patients, PNP (purine
nucleoside phosphorylase) deficiency, and the therapy of Lesh-Nyhan syndrome
caused by a deficiency in hypoxanthine-guanine phosphoribosyltransferase
(HG-PRT). The first human trial to be approved for ex vivo gene therapy was for
the treatment of ADA deficiency which began in 1990 (Karlsson, 1991; Ferrari et
al, 1991). Ex vivo studies include
transfer of factor IX gene in skin fibroblasts from hemophilia B patients in
China followed by subcutaneous injection of the cells to the patient (Wilson et
al, 1992; reviewed by Anderson, 1992). From 1990-1992, a clinical trial was
initiated using retrovirus mediated transfer of the 1.5 kb ADA gene cDNA to T
cells from two children with severe combined immunodeficiency following
multiple transplantations of ex vivo
modified blood cells; the vector was integrated and the ADA gene was expressed
for long periods (Blaese et al, 1995; Bordignon et al, 1995).
A clinical protocol for the therapy of amyotrophic
lateral sclerosis uses a semipermeable membrane to enclose the ex vivo modified xenogenic BKH cells;
the membrane is implanted intrathecally to provide human ciliary neurotrophic
factor (Deglon et al, 1996; Pochon et al, 1996). An ex vivo clinical trial on
humans, homozygous for mutations in the LDL receptor gene, is performed using
cultured hepatocytes from the patient which are transduced ex vivo with the LDL
receptor gene and transplanted by infusion into the portal vein of the patient
(Wilson et al, 1992; Grossman et al, 1994).
Cancer immunotherapy uses transfer of cytokine genes
(IL-2, IL-7, IFN-g, GM-CSF) to autologous (cancer patientÕs) cells
followed by immunization of the patient to elicit activation of tumour-specific
T lymphocytes capable of rejecting tumour cells from the patient, especially on
immunoresponsive malignancies such as melanomas, colorectal carcinomas, and
renal cell carcinomas (Uchiyama et al, 1993; Chang et al, 1996; Finke et al,
1997; Das Gupta et al, 1997; Mahvi et al, 1997).
Table 5. Ex vivo studies on animal models
|
Gene target |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
|
ADA |
SCID
(severe combined immunodeficiency) |
Retrovirus |
Immunodeficiient
mice were injected with peripheral blood lymphocytes from ADA- patients transduced with a retroviral
vector for human ADA |
Restoration
of immune functions (presence of human immunoglobulin and antigen-specific T
cells) |
Ferrari
et al, 1991 |
|
bcl-2 |
prostate
cancer |
|
bcl-2 expressing LNCaP human prostate
cancer cells are rendered highly resistant to apoptotic stimuli |
LNCaP-bcl-2 cells induced earlier, larger,
and hormone-refractory prostate tumors in nude mice |
Rafo et
al, 1995 |
|
Factor IX |
hemophilia
B |
|
Injection
of transduced primary myoblasts into the muscle |
Factor IX
was being synthesized and delivered to the circulation for over 6 months |
Dai et
al, 1992 |
|
Factor IX |
hemophilia
B |
retr |
Transplantation
of retrovirus-transduced keratinocytes |
Human
factor IX was detected in the bloodstream of nude mice in small quantities
for one week |
Gerrard
et al, 1993, |
|
Factor IX |
hemophilia
B |
retrovirus |
Mouse
primary myoblasts were infected with retrovirus expressing the canine factor
IX under control of mouse muscle creatine kinase and human CMV promoter;
myoblasts were injected into the hindlegs of recipient mice; secreted canine
factor IX was monitored in the plasma |
Sustained
expression of factor IX for over six months without any apparent adverse
effects on the recipient mice; however, the levels of the factor IX protein
secreted into the plasma (10 ng/ml for 107 injected cells) were not sufficient to be of therapeutic
value; 100 times higher amounts of factor IX were needed |
Dai et
al, 1992; Yao et al, 1994 |
|
Factor
VIII |
Hemophilia
A |
transferrin |
Transfection
of fibroblasts and myoblasts with B-domain-deleted factor VIII gene followed
by implantation into mice |
Therapeutic
levels of factor VIII in the blood of the animals for 24 hours |
Zatloukal
et al, 1994 |
|
Factor
VIII |
Hemophilia
A |
Retrovirus |
Mouse
primary fibroblasts infected with a recombinant retrovirus containing factor
VIII gene deleted at the B domain |
Therapeutic
levels of factor VIII in blood of animals for 1 week after surgical
implantation into the peritoneal cavity in SCID mice of 15 million cells in
the form of neo-organs |
Dwarki et
al, 1995 |
|
Growth
hormone (human) |
none |
mice
electroporation |
Ex vivo modified C2C12 cells with the hGH gene under control of the
inducible UAS promoter and a synthetic hybrid steroid receptor (TAXI),
activating transcription from the inducible promoter after treatment with the
synthetic nontoxic drug inducer RU486; transplanted in mouse muscle |
This
model allows up to 100-fold induction of the hGH gene and can be finely tuned
to lower levels of induction |
Delort
and Capecchi, 1996 |
|
Growth
hormone (human, hGH) |
general |
retr |
Injection
of genetically engineered myoblasts into mouse muscle |
hGH could
be detected in serum for 3 months; myoblasts were fused into preexisting
multinucleated myofibers that were vascularized and innervated |
Dhawan et
al, 1991 |
|
HSV-tk |
glioma |
Retr |
To
directly transfer HSV TK gene and
kill transduced proliferating brain tumor cells with ganciclovir without
affecting nondividing normal cells |
Murine
fibroblasts transduced ex vivo with HSV TK retroviral vectors caused complete
regression of gliomas in rat brain after intratumor injection |
Culver et
al, 1992 |
|
HSV-tk |
pancreatic
cancer |
retrovirus |
BXPC3
primary human pancreatic adenocarcinoma cells were transduced with retroviral
vector carrying the HSV-tk gene driven by the CEA promoter; engrafted
subcutaneously into nude mice eliciting pancreatic tumors |
Animals
treated with 0.1 mg/Kg ganciclovir exhibited a significant reduction in tumor
growth |
DiMaio et
al, 1994 |
|
HSV-tk |
proliferative
vitreoretinopathy (PVR) |
retrovirus-transduced
rabbit dermal fibroblasts |
Traction
retinal detachment results from proliferation of retinal pigment cells in the
vitreous cavity of the eye; PVR may ensue after retinal surgery or trauma and
can be induced in rabbit models by surgical vitrectomy. |
Significant
inhibition of PVR (killing of proliferating cells in the retina) was observed
in rabbit PVR models after injection into the vitreous cavity of rabbit
dermal fibroblasts transduced in vitro;
all eyes received 0.2 mg GCV on the following day and on day 4; |
Kimura et
al, 1996 |
|
IL-1
-receptor antagonist protein gene |
Rheumatoid
arthritis (RA) |
Retr |
Synovial
cells were surgically removed from joints of animals with experimental
arthritis, cultured, transduced with the IL-1 -receptor antagonist protein
gene and reimplanted into the respective donors by intraarticular injection |
Improvement
in RA symptoms |
Bandara
et al, 1993 |
|
IL-1
receptor antagonist (IL-1Ra) |
Rheumatoid
arthritis (RA) |
Retr |
Degradation
of cartilage in RA is stimulated by IL-1; to inhibit IL-1; RA synovial
fibroblasts transfected with the IL-1Ra gene were coimplanted with normal
human cartilage in SCID mice |
IL-1Ra expression
protected the cartilage from chondrocyte-mediated degradation. |
Otani et
al, 1996; Makarov et al, 1996; Muller-Ladner et al, 1997b |
|
IL-2;
GM-CSF |
prostate
cancer |
|
Dunning
rat R3327-MatLyLu prostate tumor model (an anplastic androgen-dependent,
nonimmunogenic tumor that metastasizes to the lymph nodes and the lung);
cytokine (IL-2)-secreting human tumor cell preparations (tumor vaccines) were
used for the treatment of advanced human prostate cancer in rats |
All
animals with subcutaneously established tumors were cured; the cancer vaccine
induced immunological memory that protected the animals from subsequent tumor
challenge; GM-CSF was less effective than IL-2. |
Vieweg et
al, 1994 |
|
LDL
receptor |
Familial
hypercholesterolemia (FH) |
Retr |
Watanabe
heritable hyperlipidemic rabbit (deficient in both alleles of LDL receptor
gene); establish hepatocyte culture from animal liver; transduce with LDL
receptor gene responsible for LDL internalization into hepatocytes to reduce
blood serum cholesterol; transplant hepatocytes into the animal |
30-40%
decrease in serum cholesterol that persisted for 4 months |
Chowdhury
et al, 1991 |
|
Nerve
Growth Factor (NGF) |
Alzheimer's
disease |
rat and
primate |
Delivery
of NGF by ex vivo-modified allogeneic cells surrounded by a semipermeable
membrane and implanted intrathecally |
Release
of NGF by the implant which is not subject to immunologic rejection due to
the membrane |
Kordower
et al, 1994 |
|
XPD
(ERCC2) |
xeroderma
pigmentosum (XP) |
Retr |
To
transduce ex vivo human keratinocytes and produce skin grafts on
immunodeficient mice; use it on XP patients as reconstructive surgery to
alleviate cancers in UV-exposed areas |
The
retroviral vector carrying the XPD gene and neoR under control of SV40
enhancer fully complemented the DNA repair deficiency of primary skin
fibroblasts |
GšzŸkara
et al, 1994; Carreau et al, 1995 |
|
TH (Tyrosine hydroxylase) |
Parkinson's
disease (PD) |
Retrovirus |
Rat
fibroblasts transduced with tyrosine hydroxylase (TH) produced and released
L-dopa to the culture medium; |
When
grafted to the striatum of Fischer rats with a prior 6-hydroxydopamine
lesion, primary fibroblasts containing the TH transgene survived for 10
weeks, continued to express the transgene, and reduced rotational asymmetry. |
Wolff et
al, 1989 |
|
TH |
Parkinson
disease (PD) |
|
Overexpress
TH that converts tyrosine to L-DOPA to alleviate degeneration of dopaminergic
nigrostriatal neurons (DNN) in PD rat models; unilateral destruction of DNN
in animals with 6-hydroxydopamine and administration of apomorphine caused PD
rats to turn contralaterally (7 or more rotations/min). |
Implantation
of transgenic immortalized fibroblasts and myoblasts intracerebrally improved
rotational behavior |
Fischer
et al, 1991 |
|
TH |
Parkinson's
disease (PD) |
HSV |
Infection
of 6-hydroxydopamine-lesioned rats, used as a model of PD, with a defective
herpes simplex virus type 1 vector expressing TH |
Conversion
of endogenous striatal cells into L-dopa-producing cells |
During et
al, 1994 |
|
TH |
Parkinson's
disease (PD) |
Lipofectin |
To
alleviate the symptoms of PD in TH-deficient rats (PD animal models; perform
colateral rotations at 15 rounds/min upon administration of apomorphine) |
Primary
muscle cells were transduced with TH cDNA under control of CMV promoter; 10
million cells were injected into brains of TH-deficient rats; this resulted
in 75% decrease in the number of rotations/min for more than 6 months |
Jiao et
al, 1993 |
Table 6. In vivo somatic gene transfer strategies to animal
models
|
Gene target or delivered |
Human disease |
Method |
Animal model, objective, and method |
Results |
Reference |
|
HSV TK
and ganciclovir |
hepatocellular
carcinoma |
AAV mice |
To
preferentially kill hepatocellular carcinoma cells by the suicadal gene HSV
TK (driven by the a-fetal
protein (AFP) enhancer and albumin promoter) with ganciclovir |
Selective
killing of AFP-positive cells in culture; transgenic mice were established by
injection of AAV ITRs, neoR, and HSV
TK genes as a linear DNA fragment; HSV TK was expressed predominantly in
adult liver. |
Su et al,
1996 |
|
Prostaglandin
G/H synthase |
acute lung
injury |
Cat lipid
rabbit |
Rabbits
intravenously transfected with the PGH synthase gene |
Increased
plasma levels of prostacyclin and PGE2; protection of lungs in rabbits
against endotoxin-induced inflammation, pulmonary edema, release of
thromboxane B2, and pulmonary hypertension |
Conary et
al 1994 |
|
Ornithine
transcarbamylase (OTC) |
OTC-deficiency |
Adenovirus |
iv
injection of recombinant adenovirus to spf-ash
mice (OTC-deficient) |
Correction
of enzyme deficiency in OTC-deficient mice for over 1 year. |
Stratford-Perricaudet
et al, 1990 |
|
a1-antitrypsin |
a1-antitrypsin-deficiency
in lung |
Adenovirus |
The
adenovirus major late promoter was linked to a human a1-antitrypsin gene for its transfer to lung epithelia of
cotton rat respiratory pathway |
Both in
vitro and in vivo infections have shown production and secretion of a1-antitrypsin by the lung cells for over 1 week |
Rosenfeld
et al, 1991 |
|
a1-antitrypsin |
a1-antitrypsin-deficiency
in liver |
Cat lipid
mice |
Protect
connective tissue from the lytic action of the leukocyte neutrophil elastase;
plasmid was encapsulated into negatively-charged liposomes containing
phoshpatidylcholine |
Small
liposomes were much more effective in delivering the a1-antitrypsin
gene to mouse hepatocytes in vivo. |
Ali–o et
al, 1996 |
|
a1-antitrypsin
(AT, human) |
acute and
chronic lung diseases. |
Cat lipid |
Aerosol
and intravenous transfection to lungs of rabbits |
Human a1AT mRNA and protein were detected for at least 7 days;
immunohistochemical staining showed a1AT
protein in the pulmonary endothelium following intravenous administration, in
alveolar epithelial cells following aerosol administration, and in the airway
epithelium by either route |
Canonico
et al, 1994 |
|
CFTR |
Cystic
fibrosis (CF) |
Adenovirus |
To
alleviate the symptoms of CF |
Expression
of CFTR after intratracheal instillation into lungs of cotton rats;
expression between days 2-10 |
Rosenfeld
et al, 1992 |
|
CFTR
(cystic fibrosis transmembrane conductance regulator) |
Cystic
fibrosis (CF) |
Cat lipid |
To
express the normal CFTR gene in lungs of Edinburgh insertional mutant mouse
(cf/cf) after delivering CFTR cDNA-liposome complexes into the airways by
nebulization. |
Full
restoration of cAMP related chloride responses in some animals; human CFTR
cDNA expression in the same tissues |
Alton et
al, 1993 |
|
CFTR |
Cystic
fibrosis (CF) |
Lipofectin |
To
express the human CFTR gene in lungs in CFTR-deficient transgenic mice by
tracheal instillation of lipofectin-plasmid |
Successful
transfer of the CFTR gene to
epithelia and to alveoli deep in the lung leading to correction of the ion
conductance defects found in the trachea of transgenic mice |
Hyde et
al, 1993. |
|
CFTR |
CF |
Lipofectin |
Transduction
of airway epithelial cells in normal mice by intratracheal instillation of a
plasmid carrying the CFTR gene
under control of the Rous sarcoma virus promoter |
Airway
epithelial cells were the major target and site of expression of CFTR |
Yoshimura
et al, 1992 |
|
CFTR cDNA
(human) |
Cystic
fibrosis (CF) |
AAV |
Intratracheal
instillation into neonatal New Zealand white rabbits |
Epithelial
expression of the human CFTR fusion protein was detected using antisera to
both the human CFTR R domain and the amino-terminal epitope at up to 6 weeks
after vector inoculation, a time coinciding with the completion of the
alveolar phase of lagomorph lung development |
Rubenstein
et al, 1997 |
|
p53 |
lung
cancer |
retrovirus |
Lung
tumors were elicited in nu/nu mice after intratracheal inoculation with human
lung cancer H226Br cells whose p53 gene has a homozygous mutation at codon
254 |
Intratracheal
injection of a recombinant retrovirus containing the wt p53 gene was shown to
inhibit the growth of the tumor |
Fujiwara
et al, 1994 |
|
MHC |