Gene Ther Mol Biol Vol 10, 161-164,
2006
Medicine faculty of Shaheed Beheshti Medical sciences
of IRAN & Infectious Diseases & Tropical Medicine Research Center of
SBMU of Iran
__________________________________________________________________________________
*Correspondence: Hossein Goudarzi, School
of Microbiology, Modif Hospital, Shaheed, Beheshti,
University, Tehran-Iran; e-mail: hgod100@yahoo.com
Key words: 16srRNA, meningitis
Abbreviations: cerebrospinal
fluid, (CSF)
Summary
In order to
treatment of patients with meningitis rapid diagnosis of agent is very
important. Now all of researchers have approved qualification and efficiency of
molecular tests. Detection of bacteria from cerebrospinal fluid (CSF) and blood
is big cumbersome as atmosphere condition and usage of antibiotics by patients.
We explored on CSF samples by PCR test and used DG74 and RDR80 primers for 16S
rDNA sequence. Our cases are children with meningitis symptoms that had
referred to hospitals at Tehran. This samples are different from culture, cell
counter and protein glucose amounts. After researching we reached to these
results that 23.5% of case were positive as bacterial culture and 41.1% of them
were positive as PCR test. So sensitivity of PCR was95.23%, specificity of PCR
was 96.66% and efficiency of PCR was 96%.
Rapid identification of bacterial meningitis is very
important. Now, Isolation of bacteria from CSF or blood in 24 hours incubation
is routine method, but some bacteria are fastidious, some patients have received
antibiotic before sampling, so culture will be negative. Growth of bacteria depends on sampling and transfer condition too.
Treatment of cell culture for identifying of viruses in some sample is very
troublesome, expensive and requires to long time. Therefore we need a sensitive
method to solve above problems. Meningitis is an acute life–threatening
infection. The mortality rate is approximately 10-15% (depending on the
bacteria involved), even with appropriate anti microbial therapy. The incidence of disease decreases with
age. The prevalence of a particular etiologic agent is also related to patients
ago. Clinical manifestations vary considerably depending on the virolence of
the organism and the age of patient. In neonates the signs of meningeal irritation
(neckal rigidity and Brudzinski and Kernigs signs are infrequent and often
minimal when found early signs include temperature instability, poor feeding
and vomiting.
In children 1-18 month of age signs and symptoms are
often nonspecific and include fever, irritability, drowziness, Vomiting, poor
feeding, crying when handled, bulging fontanels (due to increased intravascular
pressure) and febrile seizures. So, rapid identification is very impotant.
Chemical tests and cell count of CSF in bacterial and viral meningitis is not
100% specific. The molecular methods in identification of microorganisms in
clinical specimens have developed. One of these methods is PCR, we can use
aseptic primer to multiply of unknown DNA. In our research we used 16S rDNA gene sequence for PCR. As
16srRNA sequence was constant during the evolution than to 23s and 5srRNA and
approximately is identical in all of prokaryotes.
This research is descriptive.
Sampling is done in Tehran pediatric hospitals from children with meningitis.
Sampling method was lumbar puncture. All of tests such as bacteriologic,
biochemistry cell count and PCR was done on sample in sterile condition. 200 ml of each sample in a micro tube is kept in -20ΓC. On remaining of
CSF, the first is done gram staining, bacterial culture, cell count with
hematocytometer, cell typing, considering protein and Glucose.
Bacteriologic culture is
blood agar, EMB and chocolate agar In PCR we use 2 type primers that are
specific for 16S rRNASequence:
DG 74: AGGAGGTATCCAACCGCA
RDR 80: AACTGGAGGAAGGTGGGGAG
PCR is done in Automatic
Thermocycler.
PCR has 3 process:
i.
Denaturation in 94ΓC
ii.
Annealing in 60ΓC
iii. Extension in 72 ΓC
These processes are repeated
30- 35 times. For each sample in micro tube, we use dNTP mixture, PCR buffer,
MgCl2, 2pair primers, Taq polymerase and production of PCR
electrophoresis on 2% gel.
Finding a rapid and
specific test for identifying of bacterial meningitis, 51 CSF samples from
children under 6 years in Mofid hospital from July to March were received
44.7%.
Patients with meningitis were suspected to meningitis, 55.3% were negative for PCR. 34.2% of 44.7% suspected to bacterial meningitis and 10.5% suspected to viral meningitis.
We studied about culture, cell count of CSF in children with meningitis that has been shown in Table 1.We found the positive culture of CSF in children with meningitis was 23.5%, Table 2.We resulted the frequency of positive PCR in CSF of children with meningitis 41.1%, Table 3.
In this research, we use 16srRNA gene sequences of
bacterial to identify bacterial infection on CSF specimens from children who
refer to Tehrans hospitals. David Fredrics in 1999, used PCR method and 16srRNA
sequence in sterile specimens such as blood, spinal fluid, specificity and
sensitivity was more than 97% In 1998 Dagan et al, used PCR for identifying DNA
of pneumococci in children and sera. Blood culture was positive 30% and
sensitivity of PCR was 100%. In 1997 Tang et al, used this method for
identifying of infectious disease such as gold standard. In 1996 Newcombe et
al, used PCR for identifying meningococci in peripheral blood. In 1993 Greisen
et al, used PCR for identifying of 102 bacteria species. Specificity and
sensitivity was more than 96%. It is important to know that sterile fluid such
as patient speciment that treatment with antibiotic, number of bacteria were
low, some of bacteria were fastidious and need to an enrichment media and
specific atmosphere, (for example CO2 or anaerobic) and some of this
bacteria Sensitive to transport conditions. Therefore, we can t identify all of
bacteria by culture and isolation of bacteria and we can t reach to desire
results.
In first group 8 speciment were positive PCR (88.8%).
In second group, all of 12 specimens were positive PCR (100%).
|
Method (%) |
Cell count in LP |
Culture |
Manifestation
of meningitis |
|
|
9 12 8 22 |
10.7 23.5 10.5 55.3 |
N > L N > L L > N ---- |
---- Meningococcus Pneumococcus Haemophilus influenza
---- ---- |
+ + + + |
|
51 |
100 |
N: Neutrophil, L: Lymphocyte |
||
Table 2. The frequence of positive calture in children with
meningitis refer to Mofid hospital in 2000.
|
Frequent
Culture |
Number |
Percent |
|
Positive |
12 |
23.5 |
|
Negative |
39 |
46.5 |
|
Total |
51 |
100 |
23.5% of 51 specimens suspected to bacterial meningitis.
Table 3. The frequency of positive PCR in CSF of children
with meningitis refer to Mofid hospital
|
PCR |
Number |
Percent |
|
Positive |
21 |
41.1 |
|
Negative |
30 |
58.9 |
|
Total |
51 |
100 |
In third, 8 specimens suspected to viral meningitis, only one case was positive PCR, so it had bacterial agent. In fourth group, all of 22 specimens were negative PCR. There fore sensitivity and spesitivity of PCR test with 16S rDNA A gene sequence in identification of bacterial agent in CSF was 95.23% and 96.66%.
Dagan R, Shriker O, Hazan I,
Leibovitz E, Greenberg D, Schlaeffer F, Levy R (1998) Prospective study to determine clinical relevance of
detection of pneumococcal DNA in sera of children by PCR. J Clin Microbiol 36, 669-73.
Fredricks DN, Relman DA (1998) Improved amplification of
microbial DNA from blood cultures by removal of the PCR inhibitor sodium
polyanetholesulfonate. J Clin Microbiol 36,
2810-6.
Fredricks DN, Relman DA (1999) Application of polymerase chain
reaction to the diagnosis of infectious diseases. Clin Infect Dis 29, 475-86.
Gelfand DH and White TJ (1998) In: PCR Protocols: A Guide to
Methods and Applications, Innis MA, Gelfand DH, Sninsky JJ and White TJ, eds,
Academic Press, San Diego, CA,
Greisen K, Loeffelholz M,
Purohit A, Leong D (1994) PCR
primers and probes for the 16S rRNA gene of most species of pathogenic
bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 32, 335-351.
Harrisonn S (1998) Principal of internal medicine,
14ed. Vol 2 MC Grow. Hill company, 2419-2426.
Newcombe J, Cartwright K,
Palmer WH, McFadden J (1996) PCR of
peripheral blood for diagnosis of meningococcal disease. J Clin Microbiol 34,1637-40.
Read SJ, Jeffery KJ, Bangham
CR (1997) Aseptic meningitis and
encephalitis: the role of PCR in the diagnostic laboratory. J Clin Microbiol 35, 691-6.
Snyder L, Champness W (1997) Molecular genetics of bacteria
ASM, Washington DC.
Stein JH (1998) Stein's Internal Medicine, 3th
ed., John J. Hutton, John H. Klippel, Peter O. Kohler, Nicholas F. Larusso,
John M. Eisenberg (Editor), 1281-1291.
Tang YW, Procop GW, Persing
DH (1997) Molecular diagnostics of
infectious diseases. Clin Chem
43,2021-2038.
Wiffiam J, Hauster Jr (1998) Max Sussman, Microbiology and
Microbial infections, 9ed.