F. LPS induced EAE relapses
In previous studies, we have shown
that TNF-a induced relapses were prevented by
injection of IL-10, while SEB induced relapses were more effectively prevented
by TGF-b injections (Crisi et al, 1995). Since gram negative bacterial
endotoxin, LPS, induces the rapid release of TNF-a, we studied the effect of IL-10/MBP
and TGF-b1/MBP T cells on the incidence and
severity of EAE relapses induced by LPS. As can be seen from the results in Figure 6B and in Table 2, LPS (1 mg), injected on day 21 after immunization with PLP in CFA
(or 10 days after transduced T cell transfer), caused an exacerbation of EAE
severity in control (no T cells) mice. In this experiment the overall EAE
severity was somewhat greater and the rate of recovery somewhat slower than in
most other experiments. An additional group that received untransduced MBP
specific T cells (not shown) had a slightly higher severity of EAE than the no
T cell control and all of these mice died after injection of LPS. At the time
of LPS injection, recipients of IL-10/MBP T cells were beginning to show a
somewhat lowerEAE severity than the controls and the effect of LPS was minimal
(Figure 6B and Table 2). The TGF-b1/MBP T cell recipients had significantly less disease than
the other groups and failed to show a significant effect after LPS injection (Figure 6B and Table 2). An additional group of mice received both IL-10/MBP and
TGF-b1/MBP T cells, but the protective
effects of these combined transduced T cells were not additive (not shown). In
the experiment shown in Figure 6A,
LPS was injected 8 weeks after T cell transfer. As seen in Table 2 and in Figure 6A,
under these conditions LPS induced similar relapses in control and TGF-b1/MBP T cells treated mice. Thus, in
these mice, in which cDNA for TGF-b1 could no longer be detected in spinal cords (Figure 2), there was no protection
against EAE relapses.
In an additional experiment, shown in Figure 7, TGF-b1/MBP or IL-10/MBP T cells were injected at the same
time as LPS into mice that had partially recovered from PLP induced EAE. Cells
(2x106, iv) and LPS (1 mg, ip) were injected on
day 34 after immunization with PLP in CFA. A second injection of LPS (5 mg) was given 1 week later. In the control group, each
injection of LPS induced a slight increase in the EAE score, which lasted only
a few days. In the mice receiving TGF-b1 transduced cells, no
relapse of the EAE could be detected. In the mice receiving IL-10 transduced T
cells, the EAE relapses were somewhat less marked than in the control mice. The
recovery after day 45 was accelerated in both the transduced T cell-treated as
compared to the control group of mice (Figure
7). On day 9-16 after cell transfer, the cDNA of the transduced cytokine
was detectable in the spinal cord of a large percentage of the mice receiving
TGF-b1/MBP cells and again a somewhat lower percentage of
the mice receiving IL-10/MBP cells (Figure
2B). These results show that TGF-b1/MBP T cells can enter
the CNS and protect against exacerbations of EAE, even when given late during
the course of the disease.
III. Discussion
The
present results confirm our previous findings (Chen
et al, 1998) that latent TGF-b1 transduced MBP-specific Th1 cells protect against
PLP-induced EAE in (SJL x BALB/c) F1 mice, even when injected shortly after the
onset of disease. When left untransduced, the same Th1 cells slightly increase
the severity of actively induced EAE (Chen
et al, 1998), and induce adoptive EAE in BALB/c mice (Abromson-Leeman
et al, 1995). It should be noted that PLP in CFA was used for the induction of EAE,
so as to avoid having MBP depots present in any other sites of the body,
possibly detaining MBP-specific T cells from reaching the CNS (Chen
et al, 1998).
Clearly, the only difference between the
transduced and the untransduced cloned T cells is the enhanced production of
TGF-b1. The transduced cells remain Th1, because they
produce mRNA for TNF, LTa, LTb and IFN-g, and not for IL-4 or IL-10 (Chen
et al, 1998). Even though this Th1 cytokine profile is unaltered after transduction
with TGF-b1, the cells lose their capacity to aggravate EAE in
the recipients, and instead significantly ameliorate the development of EAE.
Therefore, the functional properties of these cells in vivo have been changed by the engineered production of latent
TGF-b1. In both EAE and experimental asthma, the
protective effect of TGF-b1 transduced T cells is abrogated by the simultaneous
injection of neutralizing anti-TGF-b, which only interacts
with active TGF-b (Chen
et al, 1998; Hansen et al, 2000). It should be noted that, under normal conditions,
most cells including T cells only produce latent TGF-b, i.e., TGF-b from which the latency
associated protein (LAP) must be removed to uncover the receptor binding region
before it exerts any biological activity (Wakefield
et al, 1988). In inflammatory infiltrates this most likely occurs by enzymes such as
plasmin and/or acidification in macrophages (Nunes
et al, 1995; Godar et al, 1999). In addition, several other proteins have been shown
to be capable of removing the LAP from TGF-b,
such as thrombospondulin (Ribeiro et al, 1999) and the integrin avb6 (Munger
et al, 1999).
TGF-b may affect autoimmune disease through down
regulation of: 1) TNF-a and LT production (Espevik
et al, 1987; Stevens et al, 1994); 2) responses to IL-12 (Pardoux
et al, 1997); 3) macrophage and microglia activation (Nelson
et al, 1991; Vodovotz et al, 1993; Lodge and Sriram, 1996); 4) cytokine enhanced class II MHC expression (Epstein
et al, 1991); and 5) migration of T cells into the CNS (Santambrogio
et al, 1993; Fabry et al, 1995). TGF-b induces the synthesis
of IL-10 by macrophages (Maeda et al, 1995; Kitani et al, 2000), but the present results suggest that this is
unlikely to be the mechanism by which TGF-b1/MBP T cells protect
against EAE, since IL-10/MBP T cells are less effective. TGF-b also stimulates its own production (Fiorelli et al, 1994) and, therefore, a few TGF-b1/MBP T cells retained in an infiltrate on the basis
of their specificity for myelin protein, may cause oligodendrocytes and
macrophages in their vicinity to produce more TGF-b. An additional mechanism by which TGF-b may influence autoimmunity is through the promotion
of immunoregulatory CD8+ T cell development (Quere and Thorbecke, 1990; Rich et al, 1995; Powrie
et al, 1996; Thorbecke et al, 1999).
The primary mechanism by which IL-10 protects
against the development of autoimmune diseases, such as CIA, is thought to be
through inhibition of the production of pro-inflammatory cytokines such as TNF-a, IL-1 and IL-6 (Walmsley
et al, 1996; Kim et al, 2000) and of chemokines, such as MIP-1a and MIP-2 (Kasama
et al, 1995). Moreover, IL-10 directs T cells away from harmful Th1 responses and
associated IgG2a antibody formation, into the direction of Th2 (Kim
et al, 2000; Stevens et al, 1988). Indeed, the resistance of IL-10 transgenic mice to
induction of EAE is attributed to the inhibition of Th1 responses in such mice (Cua
et al, 1999). Similar to TGF-b, IL-10 counteracts the activation of macrophages and
in this respect synergizes with TGF-b (Oswald
et al, 1992). In contrast to TGF-b, however, IL-10 fails to inhibit NO production by
macrophages induced by an extraneous source of TNF-a (Bogdan
et al, 1991; Corradin et al, 1993). Both cytokines counteract the upregulation of class
II MHC and of FASL expression by IFN-g (de
Waal Malefyt et al, 1991; Epstein et al, 1991; Arnold et al, 1999), and inhibit the expression of contact sensitization
in sensitized mice (Epstein et al, 1991; Ferguson et al, 1994). It is, therefore, not immediately clear why TGF-b1/MBP T cells are much more effective in our model of
EAE than IL-10/MBP T cells, and why the effects of these cells given
simultaneously are not additive. Neither of the transduced cloned T cells has
been affected in its ability to proliferate in response to MBP, and both are
detectable in spinal cords after transfer, although the persistence of the
IL-10/MBP cells is somewhat shorter.
In the airway hyper-reactivity model, transfer of OVA-specific
IL-10-transduced T cells results in pronounced inhibition of airway
hyper-reactivity (Oh et al, unpublished observations). The differences in the
effectiveness of OVA-transduced cells in these systems may reflect differences in
the effects of IL-10 on the Th2 effector cells mediating the airway
hyper-reactivity vs the Th1 cells mediating EAE, or in the effects of IL-10 on
APCs in the two sites. Another possibility is that the IL-10 produced by the
transduced T cells inhibits antigen presentation (van
der Veen and Stohlman, 1993; Frei et al, 1994; de Vries, 1995) to themselves in
vivo, resulting in a reduced proliferation of these T cells which affects
their performance in the more chronic situation of the EAE model, but is less
important in acute airway hyper-reactivity.
It has been reported that, unlike TGF-b, IL-10 also has immune-stimulating effects on CD8 T
cells (Chen and Zlotnik, 1991; Balasa et al, 1998; Groux et
al, 1999) and B cells (Briere et al, 1993). Moreover, while IL-10 inhibits pro-inflammatory
cytokine production in macrophages, it does not affect endothelial cells (Sironi
et al, 1993) or dendritic cells from rheumatoid synovial fluid (MacDonald
et al, 1999). It is possible that the greater inhibition of NO production exerted by
TGF-b1 is of importance, as NO has been linked to damage
of the CNS in EAE in various studies (Lin
et al, 1993; Okuda et al, 1995; Waldburger et al, 1996). It should also noted that in transgenic mice, IL-10
expressed under control of an MHC class II promoter causes enhanced
susceptibility to Leishmania infection, while IL-10 expressed only in T cells
does not have this effect (Groux et al, 1999). In this respect it is perhaps relevant that in the
present studies, the enhanced cytokine production is only in a small population
of transferred T cells. While the transduced cytokines, latent TGF-B1 and
IL-10, were produced by the T cells to approximately the same levels (in ng
amounts), it is not sure what the effective concentrations required in vivo might be for each of these
cytokines, or how much of the latent TGF-b1 produced by the cells
becomes activated at the sites where it exerts its effect. We have not been
able to obtain a higher production of IL-10 in the T cells.
In view of the consideration that
clinical application of transduced T-cell therapy in humans would have to be
performed after initiation of disease, the possibility of affecting relapses of
EAE was also investigated in these studies. The relapses studied here were
induced by injection of TNF-a and IFN-g inducing agents, which
may mimic clinical situations in which relapses of demyelinating disease are
known to occur, such as during infections (Edwards
et al, 1998; Metz et al, 1998). Both SEB
and LPS induce a burst of TNF-a production and,
although unlike IL-10, TGF-b cannot overcome the effects of injected TNF-a, TGF-b does inhibit TNF-a production (Espevik
et al, 1987), which may be an important aspect of the inhibitory effect on these
relapses. SEB, in addition, stimulates Vb3 and Vb8 T cells (Marrack
and Kappler, 1990), and causes production of large amounts of T cell cytokines.
In previous studies on EAE with injected
cytokines, we found that IL-10 protected against TNF-a induced relapses, while TGF-b was more effective against SEB induced relapses (Crisi
et al, 1995). In the present study, TGF-b1/MBP T cells prevent
both the SEB- and LPS-induced increments in EAE scores, and both IL-10/MBP and
TGF-b1/MBP T cells ameliorate EAE relapses induced by
injection of LPS during the interval when the transduced T cells are still
detectable in the CNS. More importantly, injection of the MBP-specific T cells
at the time of the induction of the EAE relapse also results in significant
protection, particularly by the TGF-b1 transduced cells.
It is of interest that, even though TGF-b1 producing cells are known to be relatively abundant
in mucosal linings in the lung (Magnan
et al, 1997; Vignola et al, 1997), injection of TGF-b1/OVA
T cells nevertheless significantly protects against the local inflammatory
responses accompanying airway hyper-reactivity (Hansen
et al, 2000). Apparently, a protective effect can only be obtained with these
transduced T cells if they localize at the site of the inflammation. In the EAE
model, this can only be obtained with T cells specific for a myelin component
and activated in vitro prior to cell
transfer. It has been shown that activated T cells which penetrate the
blood-brain-barrier during EAE have upregulated adhesion molecules on their
surfaces, such as VLA-4 and LFA-1, and that the presence of adhesion molecules
on cloned T cells influences their capacity to transfer EAE to recipient mice (Kuchroo
et al, 1993; Barten et al, 1995). In addition, contact of microvascular endothelial
cells with activated T cells causes the enhancement of VCAM-1 and ICAM-1
expression on the endothelial cells (Lou
et al, 1996). Thus, antigen stimulation of MBP-specific T cells is needed before
they can either transfer EAE (Kuchroo
et al, 1993) or protect against EAE, when transduced with TGF-b (Chen
et al, 1998). It is somewhat surprising that activated T cells of unrelated
specificity (KLH or OVA), with the numbers of cells used in the present study,
cannot protect against EAE, even though they produce large amounts of latent
TGF-b in vitro.
In previous experiments it was shown that the TGF-b cDNA from OVA/TGF-b1
cells was barely detectable in the spinal cord 12 days after cell transfer (Chen
et al, 1998). The results suggest that, in the absence of specific antigen within
the CNS, T cell numbers, proliferation and/or continued localization within
infiltrates during the course of the EAE must have been insufficient when
compared to those of MBP-specific cells. In the asthma model, however, the
accumulation in the lung of T cells of any specificity can be obtained by
allowing the mice to inhale the relevant antigen (Tsuyuki et al, 1997). Therefore, while there is no protective effect of
TGF-b1/KLH cells against airway hyperreactivity in OVA
sensitized and challenged mice, partial protection with such cells is obtained
in mice sensitized by inhalation of OVA alone and challenged with OVA + KLH.
Prolonged systemic treatment with active
TGF-b is contraindicated in patients, because it induces
liver fibrosis and glomerulosclerosis (Calabresi
et al, 1998), as also seen in transgenic mice (Clouthier
et al, 1997). A major advantage of the present approach to control autoimmune
disease is that the TGF-b1 constitutively produced in the transferred cells is
latent rather than active, and is therefore unlikely to have these side
effects. Under normal conditions, latent TGF-b
is present ubiquitously, in platelet a granules (Fava
et al, 1990), as well as attached to the matrix of connective tissue (Heine
et al, 1990; Munger et al, 1997; Evanko et al, 1998) and to g-globulin in the serum
of mice (Rowley et al, 1995) and humans (GJT, CH and GMH, unpublished
observations). The latent TGF-b1 produced by the
antigen specific T cells in inflammatory infiltrates in the CNS is apparently
activated, possibly by neighboring macrophages in the lesions (Nunes
et al, 1995). Indeed, an increase in active TGF-b1
can be detected in the asthma model in bronchoalveolar lavage fluid harvested
from mice receiving TGF-b1/OVA T cells one day after measurement of airway
hyper-reactivity (Hansen et al, 2000). In
contrast, levels of active TGF-b are low in
bronchoalveolar lavage fluid from OVA-immunized mice receiving KLH/TGF-b rather than OVA/TGF-b
Th1 cells. These data indicate that the TGF-b1
transduced OVA-specific T cells reach the lung in mice that have been
challenged intranasally with OVA and that the latent TGF-b1 secreted by the T cells is activated in the
inflammatory environment created by OVA-specific Th2 cells, either by
macrophages via interaction with plasmin (Munger
et al, 1997; Godar et al, 1999) and/or betaglycan (Chong
et al, 1999), or by interaction with other known TGF-b
activating moieties, such as thrombospondin-1 (Ribeiro
et al, 1999) or avb6 (Munger
et al, 1999), the latter of which is prominently represented in epithelial cells in
the lung.
The
results so far obtained with TGF-b1 transduced T cells
indicate that production of TGF-b1 confers
immune-modulating properties on auto-reactive T cells, that allow them to
control the behavior of other inflammatory cells in their immediate vicinity.
We propose that the genetic engineering of auto-reactive T cells with latent
TGF-b, or up-regulating their ability to produce TGF-b by other means, such as through inhibition of CD26
(dipeptidyl peptidase IV) (Kahne et al, 1999) may represent a clinically viable approach to the
treatment of autoimmune diseases.
IV.
Materials and Methods
A. Mice
(SJL x BALB/c) F1 hybrid mice, 6-8
weeks old females, were purchased from the Jackson Lab. (Bar Harbor, ME).
B. Studies on EAE
SJL
x BALB/c mice were injected sc. with 200 mg PLP
peptide 139-151 (Molecular Dynamics, Sunnyvale, CA), emulsified in incomplete
FreundÕs adjuvant containing 200 mg killed
H37RA Mycobacteria tuberculosa. The mice received 200 ng
pertussigen iv, 24 and 48 h later. The EAE was scored (double blind read) as
follows: 1 = limp tail; 2 = partial hind leg paralysis; 3 = total hind leg
paralysis; 4 = hind and front limb paralysis; 5 = moribund (Santambrogio
et al, 1993). Predictable
EAE relapses (Crisi et al, 1995) were induced by injection
of Staphylococcus enterotoxin B (SEB,
Toxin Technology, Sarasota, FL), 0.5 mg ip, or of
LPS (lipopolysaccharide B, E. coli
0111:B4 , Difco Labs, Detroit, MI),
1-5 mg ip. Transduced and control
cloned T cells (2-3 days after activation with the relevant antigen in vitro, 3 x 106
cells/mouse) were injected iv into mice which had been immunized
with PLP 12 days earlier. Differences between groups of mice for mean EAE
severity were evaluated by StudentÕs t test; for EAE incidence by Chi2
test.
C. T cell clones
The MBP-specific cloned T cells
were derived from BALB/c mice immunized with MBP in CFA (Abromson-Leeman
et al, 1995) and were
donated by Dr. M. Dorf (Dept. of Pathology, Harvard U. Med. School). Cells were
activated by exposure to MBP peptide 59-76 (10mg/106
cells, Peptide Synthesis, Keck Biotechnology Resource Center, New Haven, CT) in
the presence of antigen presenting cells (APC, 5 x 106 g-irradiated
spleen cells). Keyhole limpet hemocyanin (KLH) specific (D3) and ovalbumin
(OVA) specific (BOT.A3) BALB/c Th1 cell clones were grown and activated as
described previously (Rizzo et al, 1992). For experiments in which
TGF-b contents of supernatants were to
be measured, cells received 1% Nutridoma (Boehringer Mannheim, Indianapolis,
IN) instead of serum in the medium. All the T cell clones were stimulated every
2-3 weeks by the corresponding antigens: MBP (10 mg/ml), KLH
(1 mg/ml), OVA (10 mg/ml).
D. Studies
on airway hyper-reactivity:
Immunization
Protocol of Normal BALB/c Mice to Induce Airway Hyper-reactivity. TGF-b producing
cells Th1 cells were also transferred into OVA-immunized BALB/c mice. BALB/c
mice were immunized with OVA i.p. (50 mg) complexed
with aluminum potassium sulfate (alum) on day 0, and intranasally with 50 mg OVA in 50
ml of PBS or 50 mg OVA and
25 mg KLH in 50 ml of PBS on
days 7, 8 and 9. Some mice received TGF-b1 producing
OVA or KLH specific Th1 cells iv (2.5 x 106 cells/mouse) on day 7.
Airway hyper-reactivity to inhaled methacholine was measured 24 h after the
last intranasal dose of OVA (day 10). Lung fixation was performed the following
day.
E. Measurement of airway
responsiveness
Airway
responsiveness was assessed as described previously (Hansen et
al, 2000) by
methacholine-induced airflow obstruction from conscious mice placed in a whole
body plethysmograph (model PLY 3211, Buxco Electronics Inc., Troy, NY).
Pulmonary airflow obstruction was measured by Penh using the following formula:
Penh = (Te/RT-1) x (PEF/PIF), where Penh=enhanced pause (dimensionless),
Te=expiratory time, RT=relaxation time, PEF = peak expiratory flow (ml/s), and
PIF = peak inspiratory flow (ml/s). Enhanced pause (Penh), minute volume, tidal
volume, and breathing frequency were obtained from chamber pressure, measured
with a transducer (model TRD5100) connected to preamplifier modules (model
MAX2270) and analyzed by system XA software (model SFT 1810). Measurements of
methacholine responsiveness were obtained by exposing mice for 2 min to NaCl
0.9% (Portable Ultrasonic, 5500D, DeVilbiss Health Care, Inc. Sommerset,
Pennsylvania), followed by incremental doses (2.5-40 mg/ml) of aerosolized
methacholine and monitoring Penh. Results were expressed for each methacholine
concentration as the percentage above baseline Penh values after NaCl 0.9 %
exposure.
F. Transduction of T cell clones
The cDNA (base pairs 352-1550)
encoding murine TGF-b1
(generously provided by DNAX, Palo Alto, CA) was subcloned into the pMFG
retroviral vector as previously described (Dranoff et al, 1993). The cDNA of murine IL-10
(base pairs 77-623) was similarly subcloned into the pMFG vector. CRIP-TGF-b and
CRIP-IL-10 packaging cells, producing the replication defective retrovirus,
were generated as reported previously (Danos and
Mulligan, 1988). The titers of the retroviruses were
0.5 copies as determined by Southern analysis. No replication competent virus
was detected using the his mobilization assay (Hartman
and Mulligan, 1988).
Transduction of T cell clones was done by co-culture with packaging cells for
48 h in the presence of 2 mg polybrene
per ml (Cepko and Pear, 1997). The packaging cells were g-irradiated
(2800 r) and plated in a 24-well plate (2 x 105 cells/well). Four h
later, when the fibroblasts had completely adhered to the well, recently
activated cloned T cells (106/well) were added. The T cells were
then cloned by limiting dilution in 96-well plates, using g-irradiated
BALB/c spleen cells (5 x 105/ml) as feeder cells. Clones were
expanded until sufficient amounts of DNA could be obtained for PCR analysis.
H. PCR for detection of cytokine cDNA
DNA
extraction was done according to the instructions in the Promega Wizard Genomic
DNA purification kit. Primers used for the detection of TGF-b1 cDNA
(Clontech, Palo Alto, CA) were: FP, (5Õ) GCCCTGGACACCAACTATTGCT and RP, (3Õ)
AGGCTCCAAATGTAGGGGCAGG. They correspond closely (with one base pair difference)
to the mouse TGF-b1 sequences, 1187-1208 and
1347-1326, respectively. The PCR program followed was: 95¡C 5 min; 94¡C 30Õ, 55¡C 30Õ,72¡C 1 min, 40
cycles; 72¡C 10 min, using 1 mg sample
DNA per reaction. Approximately 3% of the cloned T cells proved positive for
the cDNA of TGF-b1. Primers used for the
detection of IL-10 cDNA were FP, (5') TCCTTAATGCAG GACTTTAAGGGTTACTTG and RP,
(3') GACACCTTGGTCTTGG AGCTTATTAAAATC, which correspond to the cDNA sequences
270-309 and 527-508, respectively. The same PCR program was used as for amplification
of TGF-b1 cDNA. For both TGF-b1 and
IL-10, the primers were chosen to span an intron, such that endogenous DNA
would not be amplified. Positive and negative controls were always included(Chen et al, 1998).
To
control for PCR conditions and DNA quality, PCR for MMTV-LTR was performed on
spinal cord samples using the forward primer: (5Õ) CTACACTTAG GAGAGAAGCAGCCA
and the reverse primer: (3Õ) CTTACTTAAACCTTGGGAACCG CAAG (Zhang et al, 1996).
I. Cytokine production
RNA was
extracted from 2 x 106 cloned T cells, 2-3 days after stimulation
with antigen, using the RNA STAT-60 isolation kit (Tel-Test, Inc., Friendswood,
TX). Cytokine mRNAs produced by antigen activated cloned T cells were
quantified by multiprobe ribonuclease protection assay, using two sets of
cytokine probes according to the manufacturerÕs instructions (PharMingen, San
Diego, CA).
The biological activity of TGF-b was
assayed in supernatants from 106 cells per ml, cultured for 24 h in
serum-free medium, by its activating effect on the plasminogen activator
inhibitor-1 (PAI-1) promotor linked to the firefly luciferase reporter gene,
transfected into mink lung epithelial cells(Abe et al, 1994). The assay cells were a generous donation from Dr.
D. B. Rifkin (Dept. Cell Biology,
NYU School of Medicine). Samples were assayed with and without activation of
latent TGF-b by treatment with acid
(0.1M HCL at 4¡C for 60 min).
The protein content of TGF-b1 was
assayed by ELISA in Immulon 4 flat bottom plates, coated with 5 mg/well of a
monoclonal anti-TGF-b{12H5 (Lucas et al, 1990)}, donated by Dr. B. M.
Fendly, Genentech Inc.), using natural TGF-b1 (Genzyme,
Cambridge, MA) as a standard, and biotinylated mAb. to TGF-b1 (R&D
systems, Minneapolis, MN), streptavidin-peroxidase (Zymed, South San Francisco,
CA) and OPD substrate (Sigma, St. Louis, MO) as developing reagents. IL-10 was
assayed by ELISA with the use of the Endogen kit (Woburn, MA).
Acknowledgements
The donations of packaging cell
lines, help and advise from Dr. D. G. Dranoff (Dana Farber Cancer Center,
Harvard Med. School, Boston, MA) are gratefully acknowledged. We are also
greatly indebted to Drs. S. Abromson-Leeman and M. E. Dorf (Harvard Medical School, Boston, MA) for giving us the
MBP-specific T cell clone. The anti-TGF-b was provided by Dr. B. M. Fendly (Genentech Inc.,
South San Francisco, CA). Dr. D. Rifkin (Dept. of Cell Biology, NYU School of
Medicine) gave valuable help in the biological assay for TGF-b activity. We thank Ching Huang for
excellent technical assistance.
References
Abe M, Harpel JG, Metz CN, Nunes I,
Loskutoff DJ, Rifkin DB. (1994) An
assay for transforming growth factor-beta using cells transfected with a
plasminogen activator inhibitor-1 promoter-luciferase construct. Anal Biochem 216, 276-284.
Abromson-Leeman S, Bronson R, Dorf ME. (1995) Experimental autoimmune
peripheral neuritis induced in BALB/c mice by myelin basic protein-specific T
cell clones. J Exp Med 182, 587-592.
Arnold R, Seifert M, Asadullah K, Volk HD.
(1999) Crosstalk between
keratinocytes and T lymphocytes via Fas/Fas ligand interaction: modulation by
cytokines. J Immunol 162, 7140-7147.
Balasa B, Davies JD, Lee J, Good A, Yeung
BT, Sarvetnick N. (1998) IL-10
impacts autoimmune diabetes via a CD8+ T cell pathway circumventing the
requirement for CD4+ T and B lymphocytes. J
Immunol 161, 4420-4427.
Barten DM, Clark RB and Ruddle NH (1995) Presence of T cells with
activated and memory phenotypes in inflammatory spinal cord lesions. J Immunol 155, 5409-5418.
Bettelli E, Das MP, Howard ED, Weiner HL,
Sobel RA and Kuchroo VK (1998) IL-10
is critical in the regulation of autoimmune encephalomyelitis as demonstrated
by studies of IL-10- and IL-4-deficient and transgenic mice. J Immunol 161, 3299-3306.
Bogdan C, Vodovotz Y and Nathan C (1991) Macrophage deactivation by
interleukin 10. J Exp Med 174, 1549-1555.
Briere F, Bridon JM, Servet C, Rousset F,
Zurawski G and Banchereau J (1993)
IL-10 and IL-13 as B cell growth and differentiation factors. Nouv Rev Fr Hematol 35, 233-235.
Burkhart C, Liu GY, Anderton SM, Metzler B
and Wraith DC (1999) Peptide-induced
T cell regulation of experimental autoimmune encephalomyelitis: a role for
IL-10. Int Immunol 11, 1625-1634.
Calabresi PA, Fields NS, Maloni HW, Hanham
A, Carlino J, Moore J, Levin MC, Dhib-Jalbut S, Tranquill LR, Austin H,
McFarland HF and Racke MK (1998)
Phase 1 trial of transforming growth factor beta 2 in chronic progressive MS. Neurology 51, 289-292.
Cannella B, Gao YL, Brosnan C and Raine CS
(1996) IL-10 fails to abrogate
experimental autoimmune encephalomyelitis. J
Neurosci Res 45, 735-746.
Cepko C and Pear W (1997) Transduction of genes using retrovirus vectors. Retrovirus
infection of cells in vitro and in vivo. In Current
Protocols in Molecular Biology, vol. 1. F. M. Ausubel, R. Brent, R. E.
Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and K. Struhl, eds. John
Wiley & Sons. Inc., New York, p. 9.14.11-16.
Chen LZ, Hochwald GM, Huang C, Dakin G, Tao
H, Cheng C, Simmons WJ, Dranoff G and Thorbecke GJ (1998) Gene therapy in allergic encephalomyelitis using myelin basic
protein- specific T cells engineered to express latent transforming growth
factor-beta1. Proc Natl Acad Sci U S A
95, 12516-12521.
Chen WF and Zlotnik A (1991) IL-10: a novel cytotoxic T cell differentiation factor. J Immunol 147, 528-534.
Chong H, Vodovotz Y, Cox GW and
Barcellos-Hoff MH (1999)
Immunocytochemical localization of latent transforming growth factor- beta1
activation by stimulated macrophages. J
Cell Physiol 178, 275-283.
Clouthier DE, Comerford SA and Hammer RE (1997) Hepatic fibrosis,
glomerulosclerosis and a lipodystrophy-like syndrome in PEPCK-TGF-beta1
transgenic mice. J Clin Invest 100, 2697-2713.
Corradin SB, Fasel N, Buchmuller-Rouiller
Y, Ransijn A, Smith J and Mauel J (1993)
Induction of macrophage nitric oxide production by interferon-gamma and tumor
necrosis factor-alpha is enhanced by interleukin-10. Eur J Immunol 23,
2045-2048.
Crisi GM, Katz IR, Zucker MB and Thorbecke
GJ (1996) Induction of inhibitory
activity for B cell differentiation in human CD8 T cells with pokeweed mitogen,
dimaprit and cAMP upregulating agents: countersuppressive effect of platelet
factor 4. Cell Immunol 172, 205-216.
Crisi GM, Santambrogio L, Hochwald GM,
Smith SR, Carlino JA and Thorbecke GJ (1995)
Staphylococcal enterotoxin B and tumor-necrosis factor-alpha-induced relapses
of experimental allergic encephalomyelitis: protection by transforming growth
factor-beta and interleukin-10. Eur J
Immunol 25, 3035-3040.
Cua DJ, Groux H, Hinton DR, Stohlman SA and
Coffman RL (1999) Transgenic
interleukin 10 prevents induction of experimental autoimmune encephalomyelitis.
J Exp Med 189, 1005-1010.
Danos O and Mulligan RC (1988) Safe and efficient generation of
recombinant retroviruses with amphotropic and ecotropic host ranges. Proc Natl Acad Sci U S A 85, 6460-6464.
de Vries JE (1995) Immunosuppressive and anti-inflammatory properties of
interleukin 10. Ann Med 27, 537-541.
de Waal Malefyt R, Abrams J, Bennett B,
Figdor CG and de Vries JE (1991)
Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an
autoregulatory role of IL-10 produced by monocytes. J Exp Med 174, 1209-1220.
Diebold RJ, Eis MJ, Yin M, Ormsby I, Boivin
GP, Darrow BJ, Saffitz JE and Doetschman T (1995) Early-onset multifocal inflammation in the transforming
growth factor beta 1-null mouse is lymphocyte mediated. Proc Natl Acad Sci U S A 92,
12215-12219.
Dranoff G, Jaffee E, Lazenby A, Golumbek P,
Levitsky H, Brose K, Jackson V, Hamada H, Pardoll D and Mulligan RC (1993) Vaccination with irradiated tumor
cells engineered to secrete murine granulocyte-macrophage colony-stimulating
factor stimulates potent, specific and long-lasting anti-tumor immunity. Proc Natl Acad Sci U S A 90, 3539-3543.
Edwards S, Zvartau M, Clarke H, Irving W
and Blumhardt LD (1998) Clinical
relapses and disease activity on magnetic resonance imaging associated with
viral upper respiratory tract infections in multiple sclerosis. J Neurol Neurosurg Psychiatry 64, 736-741.
Ellerman KE, Powers JM and Brostoff SW (1988) A suppressor T-lymphocyte cell
line for autoimmune encephalomyelitis. Nature
331, 265-267.
Epstein SP, Baer RL, Thorbecke GJ and
Belsito DV (1991) Immunosuppressive
effects of transforming growth factor beta: inhibition of the induction of Ia
antigen on Langerhans cells by cytokines and of the contact hypersensitivity
response. J Invest Dermatol 96, 832-837.
Espevik T, Figari IS, Shalaby MR, Lackides
GA, Lewis GD, Shepard HM and Palladino MA, Jr (1987) Inhibition of cytokine production by cyclosporin A and
transforming growth factor beta. J Exp
Med 166, 571-576.
Evanko SP, Raines EW, Ross R, Gold LI and
Wight TN (1998) Proteoglycan
distribution in lesions of atherosclerosis depends on lesion severity,
structural characteristics and the proximity of platelet-derived growth factor
and transforming growth factor-beta. Am
J Pathol 152, 533-546.
Fabry Z, Topham DJ, Fee D, Herlein J,
Carlino JA, Hart MN and Sriram S (1995)
TGF-beta 2 decreases migration of lymphocytes in vitro and homing of cells into
the central nervous system in vivo. J
Immunol 155, 325-332.
Fava RA, Casey TT, Wilcox J, Pelton RW,
Moses HL and Nanney LB (1990)
Synthesis of transforming growth factor-beta 1 by megakaryocytes and its
localization to megakaryocyte and platelet alpha-granules. Blood 76, 1946-1955.
Ferguson TA, Dube P and Griffith TS (1994) Regulation of contact
hypersensitivity by interleukin 10. J
Exp Med 179, 1597-1604.
Fiorelli G, Ballock RT, Wakefield LM, Sporn
MB, Gori F, Masi L, Frediani U, Tanini A, Bernabei PA and Brandi ML (1994) Role for autocrine TGF-beta 1 in
regulating differentiation of a human leukemic cell line toward osteoclast-like
cells. J Cell Physiol 160, 482-490.
Frei K, Lins H, Schwerdel C and Fontana A (1994) Antigen presentation in the
central nervous system. The inhibitory effect of IL-10 on MHC class II
expression and production of cytokines depends on the inducing signals and the
type of cell analyzed. J Immunol 152, 2720-2728.
Godar S, Horejsi V, Weidle UH, Binder BR,
Hansmann C and Stockinger H (1999)
M6P/IGFII-receptor complexes urokinase receptor and plasminogen for activation
of transforming growth factor-beta1. Eur
J Immunol 29, 1004-1013.
Gorelik L and Flavell RA (2000) Abrogation of TGFbeta signaling
in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12, 171-181.
Groux H, Cottrez F, Rouleau M, Mauze S,
Antonenko S, Hurst S, McNeil T, Bigler M, Roncarolo MG and Coffman RL (1999) A transgenic model to analyze the
immunoregulatory role of IL-10 secreted by antigen-presenting cells. J Immunol 162, 1723-1729.
Hansen G, McIntire JJ, Yeung VP, Berry G,
Thorbecke GJ, Chen L, DeKruyff RH and Umetsu DT (2000) CD4(+) T helper cells engineered to produce latent TGF-beta1
reverse allergen-induced airway hyperreactivity and inflammation. J Clin Invest 105, 61-70.
Hartman SC and Mulligan RC (1988) Two dominant-acting selectable
markers for gene transfer studies in mammalian cells. Proc Natl Acad Sci U S A 85,
8047-8051.
Heine UI, Wahl SM, Munoz EF,
Allen JB, Ellingsworth LR, Flanders KC, Roberts AB, Sporn MB (1990) Transforming growth factor-beta 1 specifically localizes in elastin
during synovial inflammation: an immunoelectron microscopic study. Arch Geschwulstforsch 60, 289-294.
Johns LD, Sriram S (1993) Experimental allergic encephalomyelitis: neutralizing antibody to TGF
beta 1 enhances the clinical severity of the disease. J Neuroimmunol 47, 1-8.
Kahne T, Lendeckel U, Wrenger
S, Neubert K, Ansorge S, Reinhold D (1999) Dipeptidyl peptidase IV: a cell
surface peptidase involved in regulating T cell growth (review) Int J Mol Med 4, 3-15.
Karpus WJ, Swanborg RH (1991) CD4+ suppressor cells inhibit the function of effector cells of
experimental autoimmune encephalomyelitis through a mechanism involving
transforming growth factor-beta. J
Immunol 146, 1163-1168.
Kasama T, Strieter RM, Lukacs
NW, Lincoln PM, Burdick MD, Kunkel SL (1995) Interleukin-10 expression and
chemokine regulation during the evolution of murine type II collagen-induced
arthritis. J Clin Invest 95, 2868-2876.
Khoury SJ, Hancock WW, Weiner
HL (1992) Oral tolerance to myelin basic protein and natural recovery from
experimental autoimmune encephalomyelitis are associated with downregulation of
inflammatory cytokines and differential upregulation of transforming growth
factor beta, interleukin 4 and prostaglandin E expression in the brain. J Exp Med 176, 1355-1364.
Kim KN, Watanabe S, Ma Y,
Thornton S, Giannini EH, Hirsch R (2000) Viral IL-10 and soluble TNF receptor act
synergistically to inhibit collagen-induced arthritis following adenovirus-
mediated gene transfer. J Immunol
164, 1576-1581.
Kitani A, Fuss IJ, Nakamura K,
Schwartz OM, Usui T, Strober W (2000) Treatment of experimental (Trinitrobenzene
sulfonic acid) colitis by intranasal administration of transforming growth
factor (TGF)-beta1 plasmid. tgf-beta1-mediated suppression of t helper cell
type 1 response occurs by interleukin (il)-10 induction and il-12 receptor
beta2 chain downregulation. J Exp Med
192, 41-52.
Kuchroo VK, Martin CA, Greer
JM, Ju ST, Sobel RA, Dorf ME (1993) Cytokines and adhesion molecules
contribute to the ability of myelin proteolipid protein-specific T cell clones
to mediate experimental allergic encephalomyelitis. J Immunol 151, 4371-4382.
Kumar V, Sercarz EE (1993) The involvement of T cell receptor peptide-specific regulatory CD4+ T
cells in recovery from antigen-induced autoimmune disease. J Exp Med 178, 909-916.
Kuruvilla AP, Shah R, Hochwald
GM, Liggitt HD, Palladino MA, Thorbecke GJ (1991) Protective effect of transforming
growth factor beta 1 on experimental autoimmune diseases in mice. Proc Natl Acad Sci U S A 88, 2918-2921.
Lechman ER, Jaffurs D, Ghivizzani SC,
Gambotto A, Kovesdi I, Mi Z, Evans CH, Robbins PD (1999) Direct adenoviral gene transfer of viral IL-10 to rabbit
knees with experimental arthritis ameliorates disease in both injected and
contralateral control knees. J Immunol
163, 2202-2208.
Lin RF, Lin TS, Tilton RG, Cross AH (1993) Nitric oxide localized to spinal
cords of mice with experimental allergic encephalomyelitis: an electron
paramagnetic resonance study. J Exp Med
178, 643-648.
Lodge PA, Sriram S (1996) Regulation of microglial activation by TGF-beta, IL-10 and CSF-1. J Leukoc Biol 60, 502-508.
Lou J, Dayer JM, Grau GE,
Burger D (1996) Direct cell/cell contact with stimulated T lymphocytes induces the
expression of cell adhesion molecules and cytokines by human brain
microvascular endothelial cells. Eur J
Immunol 26, 3107-3113.
Lucas C, Bald LN, Fendly BM,
Mora-Worms M, Figari IS, Patzer EJ, Palladino MA (1990) The autocrine production of
transforming growth factor-beta 1 during lymphocyte activation. A study with a
monoclonal antibody-based ELISA. J
Immunol 145, 1415-1422.
Lyons AB, Parish CR (1994) Determination of lymphocyte division by flow cytometry. J Immunol Methods 171, 131-137.
MacDonald KP, Pettit AR, Quinn
C, Thomas GJ, Thomas R (1999) Resistance of rheumatoid synovial
dendritic cells to the immunosuppressive effects of IL-10. J Immunol 163, 5599-5607.
Maeda K, Kosco-Vilbois MH,
Burton GF, Szakal AK, Tew JG (1995) Expression of the intercellular adhesion
molecule-1 on high endothelial venules and on non-lymphoid antigen handling
cells: interdigitating cells, antigen transporting cells and follicular
dendritic cells. Cell Tissue Res 279, 47-54.
Magnan A, Retornaz F,
Tsicopoulos A, Brisse J, Van D, P Pee, A Gosset, Tonnel AB, Vervloet D (1997) Altered compartmentalization of transforming growth factor-beta in
asthmatic airways. Clin Exp Allergy
27, 389-395.
Marrack P, Kappler J (1990) The staphylococcal enterot oxins and their relatives. Science 248, 705-707.
Mathisen PM, Yu M, Johnson JM,
Drazba JA, Tuohy VK (1997) Treatment of experimental autoimmune
encephalomyelitis with genetically modified memory T cells. J Exp Med 186, 159-164.
Metz LM, McGuinness SD, Harris
C (1998) Urinary tract infections may trigger relapse in multiple sclerosis. Axone 19, 67-70.
Mokhtarian F, Shi Y, Shirazian
D, Morgante L, Miller A, Grob D (1994) Defective production of anti-inflammatory
cytokine, TGF-beta by T cell lines of patients with active multiple sclerosis. J Immunol 152, 6003-6010.
Munger JS, Harpel JG, Gleizes
PE, Mazzieri R, Nunes I, Rifkin DB (1997) Latent transforming growth factor-beta:
structural features and mechanisms of activation. Kidney Int 51, 1376-1382.
Munger JS, Huang X, Kawakatsu
H, Griffiths MJ, Dalton SL, Wu J, Pittet JF, Kaminski N, Garat C, Matthay MA,
Rifkin DB, Sheppard D (1999) The integrin alpha v beta 6 binds and activates latent TGF
beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 96, 319-328.
Nagelkerken L, Blauw B,
Tielemans M (1997) IL-4 abrogates the inhibitory effect of
IL-10 on the development of experimental allergic encephalomyelitis in SJL
mice. Int Immunol 9, 1243-1251.
Nelson BJ, Ralph P, Green SJ,
Nacy CA (1991) Differential susceptibility of activated macrophage cytotoxic effector
reactions to the suppressive effects of transforming growth factor-beta 1. J Immunol 146, 1849-1857.
Nunes I, Shapiro RL, Rifkin DB
(1995) Characterization of latent TGF-beta activation by murine peritoneal
macrophages. J Immunol 155, 1450-1459.
Okuda Y, Nakatsuji Y, Fujimura
H, Esumi H, Ogura T, Yanagihara T, Sakoda S (1995) Expression of the inducible
isoform of nitric oxide synthase in the central nervous system of mice
correlates with the severity of actively induced experimental allergic
encephalomyelitis. J Neuroimmunol 62, 103-112.
Oswald IP, Gazzinelli RT, Sher
A, James SL (1992) IL-10 synergizes with IL-4 and transforming
growth factor-beta to inhibit macrophage cytotoxic activity. J Immunol 148, 3578-3582.
Pardoux C, Asselin-Paturel C,
Chehimi J, Gay F, Mami-Chouaib F, Chouaib S (1997) Functional interaction between
TGF-beta and IL-12 in human primary allogeneic cytotoxicity and proliferative
response. J Immunol 158, 136-143.
Powrie F, Carlino J, Leach MW,
Mauze S, Coffman RL (1996) A critical role for transforming growth
factor-beta but not interleukin 4 in the suppression of T helper type
1-mediated colitis by CD45RB(low) CD4+ T cells. J Exp Med 183, 2669-2674.
Quere P, Thorbecke GJ (1990) Multiple suppressive effects of transforming growth factor beta 1 on
the immune response in chickens. Cell
Immunol 129, 468-477.
Racke MK, Cannella B, Albert P,
Sporn M, Raine CS, McFarlin DE (1992) Evidence of endogenous regulatory
function of transforming growth factor-beta 1 in experimental allergic
encephalomyelitis. Int Immunol 4, 615-620.
Racke MK, Dhib-Jalbut S,
Cannella B, Albert PS, Raine CS, McFarlin DE (1991) Prevention and treatment of
chronic relapsing experimental allergic encephalomyelitis by transforming
growth factor-beta 1. J Immunol 146, 3012-3017.
Racke MK, Sriram S, Carlino J,
Cannella B, Raine CS, McFarlin DE (1993) Long-term treatment of chronic relapsing
experimental allergic encephalomyelitis by transforming growth factor-beta 2. J Neuroimmunol 46, 175-183.
Ribeiro SM, Poczatek M,
Schultz-Cherry S, Villain M, Murphy-Ullrich JE (1999) The activation sequence of
thrombospondin-1 interacts with the latency- associated peptide to regulate
activation of latent transforming growth factor-beta. J Biol Chem 274,
13586-13593.
Rich S, Seelig M, Lee HM, Lin J
(1995) Transforming growth factor beta 1 costimulated growth and regulatory
function of staphylococcal enterotoxin B-responsive CD8+ T cells. J Immunol 155, 609-618.
Rizzo LV, DeKruyff RH, Umetsu
DT (1992) Generation of B cell memory and affinity maturation. Induction with
Th1 and Th2 T cell clones. J Immunol
148, 3733-3739.
Rott O, Fleischer B, Cash E (1994) Interleukin-10 prevents experimental allergic encephalomyelitis in
rats. Eur J Immunol 24, 1434-1440.
Rowley DA, Becken ET, Stach RM
(1995) Autoantibodies produced spontaneously by young 1pr mice carry
transforming growth factor beta and suppress cytotoxic T lymphocyte responses. J Exp Med 181, 1875-1880.
Samoilova EB, Horton JL, Chen Y
(1998) Acceleration of experimental autoimmune encephalomyelitis in
interleukin-10-deficient mice: roles of interleukin-10 in disease progression
and recovery. Cell Immunol 188, 118-124.
Santambrogio L, Crisi GM, Leu
J, Hochwald GM, Ryan T, Thorbecke GJ (1995) Tolerogenic forms of auto-antigens
and cytokines in the induction of resistance to experimental allergic
encephalomyelitis. J Neuroimmunol 58, 211-222.
Santambrogio L, Hochwald GM,
Leu CH, Thorbecke GJ (1993) Antagonistic effects of endogenous and
exogenous TGF-beta and TNF on auto-immune diseases in mice. Immunopharmacol Immunotoxicol 15, 461-478.
Santambrogio L, Hochwald GM,
Saxena B, Leu CH, Martz JE, Carlino JA, Ruddle NH, Palladino MA, Gold LI,
Thorbecke GJ (1993) Studies on the mechanisms by which transforming
growth factor-beta (TGF-beta) protects against allergic encephalomyelitis.
Antagonism between TGF-beta and tumor necrosis factor. J Immunol 151, 1116-1127.
Santos LM, al-Sabbagh A,
Londono A, Weiner HL (1994) Oral tolerance to myelin basic protein
induces regulatory TGF-beta- secreting T cells in Peyer's patches of SJL mice. Cell Immunol 157, 439-447.
Shaw MK, Lorens JB, Dhawan A, DalCanto R, Tse HY, Tran AB,
Bonpane C, Eswaran SL, Brocke S, Sarvetnick N, Steinman L
Steinman, GP Nolan and CG Fathman (1997) Local delivery of interleukin 4
by retrovirus-transduced T lymphocytes ameliorates experimental autoimmune
encephalomyelitis. J Exp Med 185, 1711-1714.
Sironi M, Munoz C, Pollicino T,
Siboni A, Sciacca FL, Bernasconi S, Vecchi A, Colotta F, Mantovani A (1993) Divergent effects of interleukin-10 on cytokine production by
mononuclear phagocytes and endothelial cells. Eur J Immunol 23,
2692-2695.
Stevens DB, Gould KE, Swanborg
RH (1994) Transforming growth factor-beta 1 inhibits tumor necrosis factor-
alpha/lymphotoxin production and adoptive transfer of disease by effector cells
of autoimmune encephalomyelitis. J
Neuroimmunol 51, 77-83.
Stevens TL, Bossie A, Sanders
VM, Fernandez-Botran R, Coffman RL, Mosmann TR, Vitetta ES (1988) Regulation of antibody isotype secretion by subsets of
antigen-specific helper T cells. Nature
334, 255-258.
Stohlman SA, Pei L, Cua DJ, Li
Z, Hinton DR (1999) Activation of regulatory cells suppresses
experimental allergic encephalomyelitis via secretion of IL-10. J Immunol 163, 6338-6344.
Thorbecke GJ, Schwarcz R, Leu
J, Huang C, Simmons WJ (1999) Modulation by cytokines of induction of
oral tolerance to type II collagen. Arthritis
Rheum 42, 110-118.
Thorbecke GJ, Shah R, Leu CH,
Kuruvilla AP, Hardison AM, Palladino MA (1992) Involvement of endogenous tumor
necrosis factor alpha and transforming growth factor beta during induction of
collagen type II arthritis in mice. Proc
Natl Acad Sci U S A 89,
7375-7379.
Tsuyuki S, Tsuyuki J, Einsle K,
Kopf M, Coyle AJ (1997) Costimulation through B7-2 (CD86) is
required for the induction of a lung mucosal T helper cell 2 (TH2) immune
response and altered airway responsiveness. J Exp Med 185, 1671-1679.
van der, RC Veen, Stohlman SA (1993) Encephalitogenic Th1 cells are inhibited by Th2 cells with related
peptide specificity: relative roles of interleukin (IL)-4 and IL-10. J Neuroimmunol 48, 213-220.
Vignola AM, Chanez P, Chiappara
G, Merendino A, Pace E, Rizzo A, la Rocca AM, Bellia V, Bonsignore G, Bousquet
J (1997) Transforming growth factor-beta expression in mucosal biopsies in
asthma and chronic bronchitis. Am J
Respir Crit Care Med 156,
591-599.
Vodovotz Y, Bogdan C, Paik J,
Xie QW, Nathan C (1993) Mechanisms of suppression of macrophage
nitric oxide release by transforming growth factor beta. J Exp Med 178, 605-613.
Wakefield LM, Smith DM,
Flanders KC, Sporn MB (1988) Latent transforming growth factor-beta
from human platelets. A high molecular weight complex containing precursor
sequences. J Biol Chem 263, 7646-7654.
Waldburger KE, Hastings RC,
Schaub RG, Goldman SJ, Leonard JP (1996) Adoptive transfer of experimental
allergic encephalomyelitis after in vitro treatment with recombinant murine
interleukin-12. Preferential expansion of interferon-gamma-producing cells and
increased expression of macrophage-associated inducible nitric oxide synthase
as immunomodulatory mechanisms. Am J
Pathol 148, 375-382.
Walmsley M, Katsikis PD, Abney
E, Parry S, Williams RO, Maini RN, Feldmann M (1996) Interleukin-10 inhibition of the
progression of established collagen- induced arthritis. Arthritis Rheum 39,
495-503.
Xiao BG, Bai XF, Zhang GX, Link
H (1998) Suppression of acute and protracted-relapsing experimental allergic
encephalomyelitis by nasal administration of low-dose IL-10 in rats. J Neuroimmunol 84, 230-237.
Zhang DJ, Tsiagbe VK, Huang C,
Thorbecke GJ (1996) Control of endogenous mouse mammary tumor
virus superantigen expression in SJL lymphomas by a promoter within the env
region. J Immunol 157, 3510-3517.
Gerald M. Hochwald,
Dept. of Neurology, New
York University, School of Medicine, New York, NY 10016; FAX 212-2638211;
e-mail:
hochwg01@med.nyu.edu
